Table 1.

Quantitative real-time PCR primers

Gene SymbolGenBank Accession No.TIGR IDPrimerSequence
ABB1AI840092TC1030032ForwardGAATTCCCAGCACCAAAGAA
ReverseCGGCTACTGGAAGACAGGAC
ApoDAI837042TC804512ForwardATTTCTTTGCTTTGCGTTCC
ReverseACTTTCCATGAGTCCCCTCC
BNPAW541489TC1015293ForwardTGCTTTGGGCACAAGATAGA
ReverseAGACCCAGGCAGAGTCAGAA
DSCR1AI846152TC975094ForwardGGTGAATCAGAGCATGTGGA
ReverseACACACACGATGACTGGGAA
GLUT4AW549761TC919901ForwardAGAGCGCATCAGTCTCCATT
ReverseCGCCCTTAGTTGGTCAGAAG
Grp78AA407780TC873610ForwardTCAGATCTTCTCCACGGCTT
ReverseAGCAGGAGGAATTCCAGTCA
HerpAI835088TC836145ForwardGACCCCAACAATAACCTCCA
ReverseAGCCATGCTGTGCTCATAAA
OSF2AI849775TC1020953ForwardGCCAATCTTCAAGCAAGTCC
ReverseCCTCAGTTCCTACCCCACAG
R-Ras2AW546427TC1004309ForwardTTTCCAGTGGCCAAAATACC
ReverseCAAGTGCAGAACCAGTCCAA
S1DrAI853647TC1052189ForwardGCATCCTAGAACGCAAGAGG
ReverseAAAGAAAGGCAACCAGCAGA
SR5-HT2AU015268TC979176ForwardGGAATGGCTTGTCCCATAGA
ReverseATGGATGCGTGTCCAGTTTT
TEFAI850638TC973964ForwardAGAGGGGCCTGTAAGAGGAG
ReverseCCAACACCAAAAGACAGCAA
UCK2AW543081TC1039945ForwardCCCTTGGAACCTGTGTTGTT
ReverseCGGCAAAGGAGACAGAGAAG
UCP3BE448207TC986522ForwardTGAAGACTTGCTCCCCAGTT
ReverseTCGGATCTTTAGGCTCTCCA
URBAW552006TC1040543ForwardTTTGGGTGTTGGAGAGGAAG
ReverseATCTTTGACCAAGTGGGCTG
ANFnot on arrayTC854609ForwardCCGAAGATAACAGCCAAGGA
ReverseACAGTGGCAATGTGACCAAG
UnknownAI845730TC1024235ForwardCATGCCCAGCTAAATCCACT
ReverseTGAAAGGTCTCATTTCCCGT
  • TIGR, The Institute for Genomic Research.