Table 1.

List of primers used in this study

Forward Primer (5′-3′)Reverse Primer (5′-3′)
DGGE
Total bacteria (U0968f-GC/L1401r)CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGAACGCGAAGAACCTTACCGGTGTGTACAAGACCC
Quantitative PCR bacteria
Total bacteriaGTGSTGCAYGGYYGTCGTCAACGTCRTCCMCNCCTTCCTC
FirmicutesGGAGYATGTGGTTTAATTCGAAGCAAGCTGACGACAACCATGCAC
BacteroidetesGGARCATGTGGTTTAATTCGATGATAGCTGACGACAACCATGCAG
ProteobacteriaGCGATGTTCGCTGTGTTGAGTGATTACACCACGACCTGCACAA
ActinobacteriaTACGGCCGCAAGGCTATCRTCCCCACCTTCCTCCG
Escherichia coliCATGCCGCGTGTATGAAGAACGGGTAACGTCAATGAGCAAA
LactobacillusAGCAGTAGGGAATCTTCCAATTCCACCGCTACACATG
Clostridium XIVaCGGTACCTGACTAAGAAGCAGTTTYATTCTTGCGAACG
RoseburiaGCGGTRCGGCAAGTCTGACCTCCGACACTCTAGTMCGAC
BlautiaGTGAAGGAAGAAGTATCTCGGTTGGTAAGGTTCTTCGCGTT
Quantitative PCR genes
MT1AGCTTGGTCTCACCTGCCTCCTCTTCTTGCAGGAGGTGCAT
MT2BGCCTGAAGTTGGGGAGACCTAGCAAACGGGTCAGGTTGTAT
MT3CAAGTGCGAGGGATGCAAATTTACACACGCAATCCTTGGC
HSPA5TGGAATGACCCGTCTGTGCTGGTGCAAATGTCTTTGTTTGC
IL18GCTGCTGAACCGGAAGACAAAAACACGGCTTGATGTCCCT
HSPD1CGCAGTCCTTCGTCAGATTAGGCATAAGCCCGAGTGAG
  • DGGE, denaturing gradient gel electrophoresis.