Physiological Genomics

Transcriptional response of skeletal muscle to a low-protein gestation diet in porcine offspring accumulates in growth- and cell cycle-regulating pathways

Michael Oster, Eduard Murani, Cornelia C. Metges, Siriluck Ponsuksili, Klaus Wimmers


Inadequate maternal protein supply during gestation represents an environmental factor that affects physiological signaling pathways with long-term consequences for growth, function, and structure of various tissues. Hypothesizing that the offspring's transcriptome is persistently altered by maternal diets, we used a porcine model to monitor the longitudinal expression changes in muscle to identify pathways relevant to fetal initiation of postnatal growth and development. German Landrace gilts were fed isoenergetic gestational diets containing 6.5% (LP) or 12.1% protein. The longissimus dorsi samples were collected from offspring at 94 days postconception (dpc) and 1, 28, and 188 days postnatum (dpn) for expression profiling. At 94 dpc, 1 dpn, and 28 dpn relatively few transcripts (<130) showed an altered abundance between the dietary groups. In fact, at 94 dpc genes of G2/M checkpoint regulation and mitotic roles of Polo-like kinases showed lowered transcript abundance in LP. At 188 dpn 677 transcripts were altered including those related to oxidative phosphorylation, citrate cycle, fatty acid metabolism (higher abundance in LP) and cell cycle regulation (lower abundance in LP). Correspondingly, transcriptional alterations during pre and postnatal development differed considerably among dietary groups, particularly for genes related to cell cycle regulation (G1/S and G2/M checkpoint regulation; cyclines), growth factor signaling (GH, IGF1, mTOR, RAN, VEGF, INSR), lipid metabolism, energy metabolism, and nucleic acid metabolism. In skeletal muscle, fetal programming related to maternal LP diets disturbed gene expression in growth-related pathways into adulthood. Diet-dependent gene expression may hamper proper development, thereby affecting signaling pathways related to energy utilization.

  • fetal programming
  • microarray
  • intrauterine growth restriction

in murine and porcine models a relationship has been demonstrated between maternal protein supply during pregnancy and birth weight (33, 39), body composition (5), and metabolic disorders (9, 19, 31) of offspring. Furthermore, analysis of porcine skeletal muscle tissue revealed prenatal effects on the postnatal phenotype, including myofiber number and size as well as restricted muscle growth (34). Collectively, these observations are in accordance with the “thrifty phenotype hypothesis” (13) that proposes the relationship between low birth weight, i.e., intrauterine growth restriction (IUGR), and a higher propensity for adult chronic metabolic diseases. The possible molecular mechanism explaining the intrauterine adaptive response to adverse environmental changes is termed “fetal programming.” Increasing evidence indicates that dietary protein intake below requirement throughout gestation is associated with alterations in gene expression in a species-, tissue-, and stage-specific manner (12, 21, 28, 42). To gain knowledge about transcriptional mechanisms underlying the adaptive response to inadequate nutritional supply, we applied whole-genome microarrays for expression profiling in a longitudinal experimental design. Pregnant German Landrace gilts were fed isoenergetic gestational diets containing either adequate protein (AP) or low protein (LP) at the expense of carbohydrate supply. The offspring were sampled at prenatal and postnatal time points (33). In our experiment, offspring exposed to a maternal dietary undersupply of protein and appropriate postnatal dietary conditions exhibited “catch-up” growth through 28 days (34).

In fact, as previously reported, newborns from sows that received a LP supply during gestation had a significantly lower birth weight, a lower body fat content, and reduced size and number of adipocytes and muscle fibers than newborns of the control group (34). At weaning [28 days postnatum (dpn)] offspring of the LP group had significantly (albeit slightly) higher fat content and adipocyte size but still lower muscle fiber numbers. However, neither body weight at weaning nor body weight at 188 dpn differed significantly between offspring of the LP and the AP group, whereas visceral and subcutaneous fat content remained higher in LP than in AP during postnatal life (3335). We have previously demonstrated that, depending on the gestational diet, the expression profile of the liver, the central metabolic organ, was affected at both prenatal and postnatal stages; specifically, an altered hepatic expression of genes related to cell cycle and cell maintenance as well as lipid, ketone body, and amino acid metabolism was observed (28). Here, we focus on muscle tissue, representing the largest peripheral consumer of energy and nutrients, contributing to the species-typical shape of the body, and being a main agricultural product for human consumption. We show that the transcript abundances in skeletal muscle were modulated during prenatal and postnatal stages, i.e., an acute and delayed response to the nutritional stimulus is obvious.


Animals and sample collection.

Animal care and tissue collection were performed according to guidelines of the German Law of Animal Protection and with approval by the Animal Care Committee of the State Mecklenburg-Vorpommern (Landesamt für Landwirtschaft, Lebensmittelsicherheit und Fischerei, Mecklenburg-Vorpommern, Germany; LVL MV/TSD/7221.3-1.1-006/04; LALLF MV/TSD/7221.3-1.2-05/06; LALLF M-V/TSD/7221.3-1.2-013/06). Experimental diets were administered as described (33). In brief, at insemination German Landrace primiparous sows (n = 42) were randomly assigned to either an LP diet with 6.5% (wt/wt) crude protein or an AP diet containing 12.1% crude protein. Diets were formulated to be isoenergetic (∼13.7 MJ ME/kg) by adjustment of the carbohydrate component of the diet (LP: 6.5% crude protein, protein-carbohydrate ratio 1:10; AP: 12.1% crude protein, protein-carbohydrate ratio 1:5) (33). Tissue samples (n = 6 per stage and dietary group) were collected from offspring of these sows at one prenatal [94 days postconception (dpc)] and three postnatal (1, 28, 188 dpn) time points (Fig. 1).

Fig. 1.

Experimental design. Fetuses and offspring of differently fed sows were collected at 4 developmental stages. Fetuses were derived from 3 sows per dietary group. Postnatal offspring were full sibs of 6 litters per dietary group collected at 3 consecutive postnatal stages. LP, low protein; CP, crude protein; AP, adequate protein.

At 94 dpc, a representative subset of three sows per dietary group was subjected to Caesarean section. Eight viable fetuses per sow were collected starting at the tip of the left uterine horn and alternating between left and right horn. Fetuses were killed by iv injection of T61 in the V. cava cranialis and muscle samples (Musculus longissimus dorsi) were immediately collected (∼500 mg), frozen in liquid nitrogen, and stored at −80°C until analysis. All litters sampled had at least 11 viable piglets. There were no differences in the number of fetuses per litter between the gestation diet groups (24). However, fetuses from LP-fed dams had numerically lower weight compared with AP fetuses at 94 dpc (lsm ± SE, LP: 635.9 ± 18.8 g; AP: 687.4 ± 18.8 g; P ≥ 0.05) (24).

Offspring collected for postnatal time points were born to primiparous sows after prostaglandin induction of parturition as described (33) and was born after a mean pregnancy duration of 115 days. Offspring of six sows per diet with a minimum of 11 live born piglets (median litter size = 13) were used; litter size was not different among groups. At birth the piglets of each litter were allocated to groups at three time points (1, 28, and 188 dpn). Mean birth weights of LP newborn piglets were lower than birth weights of AP offspring (lsm ± SE, LP: 1.19 ± 0.04 kg; AP: 1.41 ± 0.04 kg, P ≤ 0.05) (33). Thirty-six hours after birth, the lightest and the heaviest piglets within one litter were killed by injection of 1.25 mg propionyl-promazine im (0.2 ml Combelen; Bayer, Leverkusen, Germany) and 50 mg ketamine (Ursotamin; Serumwerk Bernburg, Bernburg, Germany). Samples of M. longissimus dorsi (∼500 mg) were immediately collected, frozen in liquid nitrogen, and stored at −80°C until analysis.

Remaining piglets were cross-fostered to multiparous sows, which were fed AP diets during gestation and lactation. Litter size during suckling was standardized to 11 piglets per sow. Male piglets were castrated at 4 dpn. From weaning (28 dpn) to slaughter (188 dpn), all piglets were individually reared. They had free access to standard diets formulated for postweaning (29–76 dpn), growing (77–105 dpn), and finishing periods (33). At 28 dpn and 188 dpn pigs were weighed after an overnight fast and killed by electronarcosis followed by exsanguination in the experimental slaughterhouse of FBN. At 28 dpn (lsm ± SE, LP: 7.60 ± 0.34 kg; AP: 7.70 ± 0.34 kg; P ≥ 0.05) and 188 dpn (lsm ± SE, LP: 125.60 ± 2.40 kg; AP: 131.30 ± 2.49 kg; P ≥ 0.05) the diet groups did not differ in body weight (34, 35). Muscle tissue was immediately collected from M. longissimus dorsi, frozen in liquid nitrogen, and stored at −80°C until use for RNA isolation.

For microarray analyses, six sib pairs were chosen from each stage and diet to equally represent the experimental groups in terms of gender. At 94 dpc and 1 dpn the lightest and the heaviest piglets within one litter were selected (with three male and three female offspring belonging to either the light or the heavy group); at later stages body weight was not a criterion for selection but was recorded for consideration in the statistical evaluation.

RNA isolation, target preparation, and hybridization.

Total RNA from individual muscle samples was isolated using Tri-Reagent (Sigma-Aldrich, Taufkirchen, Germany) and subsequently subjected to DNase treatment and a column-based purification using the RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA integrity and quantity were checked by agarose gel electrophoresis and by spectrometry with a NanoDrop ND1000 spectrophotometer (PEQLAB, Erlangen, Germany). Absence of DNA contamination was verified by PCR of the porcine glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (forward primer, AAGCAGGGATGATGTTCTGG; reverse primer, ATGCCTCCTGTACCACCAAC) with isolated RNA as template. All RNA samples were stored at −80°C until downstream analysis. For the microarray experiments individual biotin-labeled cDNA was synthesized by the Gene Chip 3′ Express Kit (Affymetrix, Santa Clara, CA). cDNA was fragmented (∼100 bp) and hybridized on Affymetrix GeneChip Porcine Genome Arrays. After staining and washing steps the arrays were scanned (Affymetrix).

Data analysis.

Bioinformatic analysis was done in R (36). First, a quality control was performed. Except for the AP group at stage 188 dpn (4 samples) and the LP group at stage 94 dpn (5 samples), all diet group and stage combinations had six samples that passed the appropriate quality control criteria. Samples were GC-RMA normalized (Log2) over all stages. The MAS5 algorithm was used to skip those transcripts that were expressed in <50% of the animals within one dietary group per stage. For a second filtering step SDs were calculated for each probe set over all subsets of arrays of the particular comparisons. Probe sets with a low SD (≤ 0.25) were discarded, because such transcripts are not likely to show an altered abundance. Relative changes in mRNA levels were determined by a mixed-model analysis, including effects of dietary treatment, stage, sex, weight (as variation of the mean weight within stage in percent), and sow as a random effect confounded with dietary treatment. The interaction between dietary treatment and ontogenetic stage refers to the longitudinal experimental design. P values (significance set at P ≤ 0.05) for each comparison were converted to a set of q values (q ≤ 0.25) using the algorithm proposed by Storey and Tibshirani (40).

Throughout this article, results are given for the comparisons in the direction of LP vs. AP; thus, “increased abundance” indicates higher transcript abundance in LP than in AP. Analysis of the pathways involved was carried out using Ingenuity Pathway Analysis (IPA) (15). The up-to-date annotation of Affymetrix probe sets to EnsEMBL Sscofa 9 (20,439 of 23,935 annotated probe sets) was used (27). All the microarray data are MIAME compliant, and the raw data have been deposited in an MIAME compliant database, the National Center for Biotechnology Information Gene Expression Omnibus ( (accession numbers: GSE33737 and GSE33739).

Pathway analysis based on IPA.

Gene lists from microarray results were submitted to IPA to assign the altered genes to biofunctions and canonical pathways. With regard to the IPA features, canonical pathways were seen as IPA pathways. The focus was on those IPA pathways appearing at least once within the top-10 altered pathways within one single analysis. Interactions presented in the networks are not specific for porcine muscle tissue, as the database contains literature from many different research areas.


Diet-dependent effects associated with mechanisms of fetal programming were investigated in muscle tissue, covering one prenatal and three postnatal stages. Expression patterns of LP and AP animals were evaluated at each developmental stage (Figs. 2 and 3, vertical arrows). Furthermore, transcriptional shifts between adjacent stages among the dietary groups (Figs. 2 and 3, horizontal arrows) were investigated. Thus, information was acquired regarding diet-dependent adaptation processes during development.

In comparing LP vs. AP, we found 15,526 probe sets to be expressed according to MAS5 analysis in muscle tissue. Further filtering based on the variability of expression of probe sets revealed 14,058 probe sets for further analysis. These probe sets represent 10,028 genes according to the recent annotation (27).

Comparisons between LP and AP within stages.

The mRNA expression patterns in LP and AP offspring was compared within each developmental stage (Fig. 2). At the prenatal stage (94 dpc) 82 probe sets were found to differ significantly between LP and AP fetuses (25 LP > AP). Specifically, mRNA transcript levels of genes associated with G2/M DNA damage checkpoint regulation and mitotic roles of Polo-like kinases were decreased in LP fetuses compared with AP fetuses (Table 1, Fig. 3). In neonatal piglets (1 dpn) 20 probe sets differed between the experimental groups (5 LP > AP). In juvenile piglets at weaning (28 dpn) 25 probe sets differed significantly between LP and AP offspring (4 LP > AP). Due to the marginal differences in mRNA abundance at 1 dpn and 28 dpn, no distinct metabolic pathway was found to exhibit diet-dependent alterations in neonatal and juvenile piglets. In adult pigs (188 dpn) 677 probe sets were significantly different between LP and AP offspring. The abundance of 232 probe sets was increased in the LP offspring compared with AP offspring. Genes associated with oxidative phosphorylation, citrate cycle, and fatty acid metabolism showed increased mRNA expression levels, whereas genes associated with G1/S checkpoint regulation as well as cyclin and cell cycle regulation decreased expression in LP offspring.

Fig. 2.

Number of probe sets showing a significantly altered abundance in muscle tissue. The number of altered probe sets between adjacent developmental stages in AP or LP offspring are indicated at horizontal arrows; the number of commonly altered probe sets between stages in AP and LP offspring are indicated at intersections; the number of probe sets showing a different abundance between LP and AP offspring at the same developmental stage are indicated at vertical arrows; small arrows at the numbers indicate a higher or lower probe set abundance, respectively.

View this table:
Table 1.

Functional annotation of muscle transcripts showing altered abundance depending on the dietary group (LP vs. AP) within different developmental stages (IPA)

Fig. 3.

Affected pathways in muscle tissue between developmental stages and diets. Listed pathways between AP stages (white boxes) indicate shifts during development that are not found in LP offspring (black boxes) at the corresponding period. Pathways between the LP stages indicate alterations that occur in LP offspring but not in AP offspring in the corresponding period. Arrows between boxes show direction of comparison; small arrows indicate higher and lower transcript abundance, respectively. OXPHOS, oxidative phosphorylation; PLK, Polo-like kinase; mTOR, mammalian target of rapamycin; FA, fatty acid; IGF1, insulin-like growth factor 1; RAN, Ras-related nuclear protein; VEGF, vascular endothelial growth factor.

Differences in longitudinal developmental changes of transcript abundance among LP and AP offspring.

Expression patterns of two adjacent developmental stages within each dietary group were compared (Fig. 1) to determine transcripts showing an altered abundance between stages (P ≤ 0.05) (Fig. 2). Resulting gene lists were likened between LP and AP offspring at the corresponding developmental periods. The intersection of commonly altered genes (Supplemental Table S1) between those comparisons represents genes that showed the same shift of abundance along stages in both dietary groups and, thus, can be assumed to reflect normal physiological maturation.1 The analysis focused on those transcripts whose change of abundance between two consecutive stages (period 1: 94 dpc–1 dpn; period 2: 1–28 dpn; period 3: 28–188 dpn) belonged to the symmetric difference in either the LP or the AP group. Thus, genes and pathways identified as altered in one experimental group displayed diet-dependent longitudinal transcriptomic alterations.

When fetuses and perinatal offspring were compared (developmental period 1) 1,426 probe sets (568 94 dpc < 1 dpn in AP) differed in their frequency and direction of change between the AP group and the LP group. Genes associated with pentose phosphate pathway had increased expression at 1 dpn (Table 2). In LP offspring 1,299 probe sets showed diet-specific differences in their abundance (503 94 dpc < 1 dpn in LP) during the corresponding time period compared with the AP group. The mRNA abundance of genes associated with pyrimidine metabolism, glucocorticoid receptor signaling, RAN signaling, and oxidative phosphorylation was higher in LP perinatal piglets. Furthermore, genes participating in G1/S checkpoint regulation, growth hormone signaling, mammalian target of rapamycin (mTOR) signaling, and IGF1 signaling exhibited decreased expression in LP perinatal piglets.

View this table:
Table 2.

Functional annotation of muscle transcripts showing altered abundance between two developmental stages within either dietary group LP or AP (IPA)

Comparing perinatal and juvenile piglets (period 2), we found 2,474 probe sets were altered in AP offspring compared with LP offspring. Of these, 1,148 probe sets showed a higher abundance and 1,326 probe sets were detected at lower abundances at a higher age in AP but not in LP. Expression values of genes participating in purine metabolism and mTOR signaling were increased, while genes associated with fatty acid elongation in mitochondria were decreased in AP juvenile offspring. In the same period, differences in mRNA expression represented by 1,775 probe sets were specific to LP offspring. Of these, 939 probe sets had an increased mRNA abundance and represented genes involved in G2/M DNA damage checkpoint regulation, inositol phosphate metabolism, and VEGF signaling. Furthermore, genes associated with G1/S checkpoint regulation, insulin receptor signaling, mTOR signaling, and IGF1 signaling had lower transcript abundance in LP offspring at 28 dpn.

When juvenile and young adult pigs (period 3) were compared 1,827 probe sets differed significantly (1,214 28 dpn < 188 dpn in AP) in AP offspring. Young adult AP offspring had higher expression of transcripts participating in G1/S checkpoint regulation, glucocorticoid receptor signaling, and fatty acid biosynthesis, as well as cyclin and cell cycle regulation. Expression was lowered in transcripts associated with fatty acid metabolism, citrate cycle, and oxidative phosphorylation in adult AP pigs. In LP offspring 2,208 probe sets were differentially expressed (947 28 dpn < 188 dpn in LP). Genes involved in insulin receptor signaling as well as purine and pyrimidine metabolism displayed higher abundance in adult pigs, while transcripts involved in actin cytoskeleton signaling, growth hormone signaling and IGF1 signaling had lowered expression.

A comprehensive overview of the pathways altered between diets (LP vs. AP) and stages (94 dpc; 1, 28, 188 dpn) is depicted in Fig. 3.


Stage specificity of the transcriptional response to LP maternal gestation diet.

Whole-genome microarrays were used to analyze muscle gene expression profiles of offspring exposed to maternal isoenergetic LP or AP diets throughout fetal development. This longitudinal experiment comprised prenatal, perinatal, juvenile, and adult developmental stages in a porcine model. We sought to analyze diet- and stage-dependent gene expression as affected by maternal protein sufficiency. Because offspring were raised in a controlled and identical nutritional management by cross-fostering and whole body changes in tissue composition at adult stage were subtle (35), we interpret observed changes in 188 dpn as being a result of fetal programming enabling postnatal adaptation processes.

The direct comparisons of mRNA abundances at prenatal, perinatal, and juvenile stages revealed only slight differences among dietary groups. In terms of the number of transcripts with an altered abundance, the peripheral tissue of skeletal muscle showed low acute response to inadequate nutritional supply. In particular, at 94 dpc, 1 dpn, and 28 dpn, expression patterns of skeletal muscle tissue revealed only subtle differences. However, the resulting transcriptional phenotype at 188 dpn showed considerable divergence between the LP and AP groups. Our longitudinal holistic study design is able to trace stage-dependent modulations of the offspring's transcriptome along development, revealing even more distinct differences between dietary groups. Only later in life, at 188 dpn, do shifts of developmental changes of transcript abundance accumulate in a considerable long-term transcriptional response to the prenatal intervention that can be regarded as fetal nutritional programming. Regarding species-specific maturation differences, the number of transcripts differing in their mRNA abundances between the dietary groups is consistent with expression analyses done in rodents, in which dietary modifications during pregnancy were investigated. Investigating adult animals (84 dpn–450 dpn), the analyses revealed diet-dependent differences in mRNA expression in liver (21, 26), muscle (30), kidney (1), pancreas (41), and adipose tissue (2, 12). In this context, a great variety of metabolic processes were described, including mitochondrial biogenesis, cell differentiation, lipid metabolism, and genes associated to hypertension. Hence, transcript abundance associated with fetal programming is highly specific to both ontogenetic stage and analyzed tissue.

Molecular pathways with affected transcript abundance.

Expression analysis revealed a number of pathways associated to growth, cell cycle regulation, carbohydrate metabolism, lipid metabolism, and stress response that were altered at various stages in skeletal muscle tissue due to a maternal LP diet. In our experiment, LP diets fed to sows during pregnancy led to growth restriction of offspring at the neonatal stage. Newborns from sows that received a LP supply during gestation had significantly lower body weight, associated with lower body fat content and reduced adipocyte and muscle fiber number and size, than newborns of the control group (33, 34). Consistently, the massive shift toward a lowered transcriptional abundance of genes in growth-related pathways within fetuses (94 dpc) and developmental period 1 in LP offspring pointed to diet-dependent transcriptional processes that may contribute to IUGR. The observed transcriptional shifts indicate disturbances in muscle growth, which is in line with observations of adversely-affected myogenesis, delayed muscle maturation, and less differentiation at birth in response to the LP diet (34). Interestingly, the offspring that were exposed to an undersupply of protein during fetal development but had appropriate postnatal dietary conditions were able to broadly adapt in terms of body weight (34). However, transcriptional abundance of genes involved in growth-related pathways was lowered within developmental periods 2 and 3, indicating an impaired muscle growth performance up to adulthood, mainly compensated by increased body fat accumulation. Indeed, at weaning (28 dpn), offspring of the LP group showed slightly, but significantly, higher fat content and adipocyte size, and still lower muscle fiber numbers. Furthermore, neither body weight at weaning nor body weight at 188 dpn differed significantly among offspring of the LP and AP groups, but visceral and subcutaneous fat content remained higher, while muscle fiber number remained lower in LP than in AP during postnatal life (34, 35). The decreased amount of myofibers formed in response to a maternal LP diet in perinatal piglets (34) may have adverse long-term effects on body composition and metabolic traits (32, 43). Notably, the adjustment of the body composition due to birth weight has been revealed by studies in humans, where the birth weight correlated positively with the lean body mass (11).

Changes in transcript abundance of genes from a number of pathways mirror the compensatory growth in favor of fat accumulation rather than muscle tissue growth. Transcripts of genes assigned to pathways playing a role in general cell growth and proliferation, like RAN signaling, VEGF signaling, and G1/S and G2/S checkpoint regulation, show divergent abundance among dietary groups. In particular, mTOR signaling, an important nutrient-sensing pathway that controls protein synthesis in mammalian cells at the level of translation (16), is decreased within developmental periods 1 and 2 in LP offspring. This may lead to reduced protein synthesis in LP offspring, though, overall, LP offspring showed equivalent growth rates after weaning. Glucocorticoids act on muscle growth in a catabolic manner, including not only a diminished de novo protein synthesis but also an increased protein degradation (18, 25). In LP sows an increase in plasma cortisol levels was measured in late pregnancy. Furthermore, there were clues for increased concentrations of biologically active cortisol in LP fetuses of 93 dpc, calculated from the free cortisol index (17). This is in line with observed transcriptional alterations of genes associated with the glucocorticoid receptor signaling within developmental period 1 in LP offspring. The diet-dependent alteration in glucocorticoid receptor signaling may contribute to hampered skeletal muscle growth.

During postnatal development, pathways related to lipid metabolism were altered. Consistent with these observations, genes associated with lipid metabolism were also altered in rodent LP models at pre- and postnatal stages (2, 7, 12, 2022). The transcriptional adaptations are in line with the consequences for the offspring's organismal phenotype. Taken together, alterations of genes and pathways, which are associated with lipid metabolism, may be seen as a side-effect in terms of postnatal adaptive responses to the prenatal nutritional environment in LP offspring.

Energy-utilizing and metabolism-regulating pathways displayed expression changes by maternal diet. Various studies demonstrated that maternal gestational LP diets affect both IGF1 and insulin content. Differences between the experimental groups were mainly dependent on the exposure time of the dietary challenge and the ontogenetic stage (3, 4, 6, 14). These diet-dependent modifications may cause impairments in glucose metabolism and growth performance (10, 30, 31). Consistently, our experiment showed alterations of both IGF1 signaling and insulin signaling in skeletal muscle tissue (Fig. 3). The observed transcriptional shift in IGF1 signaling due to maternal LP diet may contribute to IUGR and influence muscle development. Incidentally, LP sows had decreased plasma IGF1 concentration in early and midpregnancy compared with sows fed AP (23). Additionally, genes associated with insulin receptor signaling were biphasically altered in an age-dependent manner in porcine LP offspring. Hence, diet-dependent effects on insulin sensitivity are the most likely result (reviewed in Ref. 8).

However, these transcriptional alterations and their possible phenotypic effects differ from results of other animal experiments using a LP model. Findings in young murine offspring suggest ameliorated insulin sensitivity, including an improved glucose tolerance and reduced insulin concentrations (29, 38). In contrast, our study revealed a lowered transcriptional abundance of genes related to insulin receptor signaling within developmental period 2 and a trend for increased insulin concentrations at weaning (P = 0.06). This suggests that ligand-based signal transduction is less sensitive at weaning in LP offspring. Regarding adult murine LP offspring, the biopositive effects observed in rodents at younger stages were reversed when impaired glucose tolerance and insulin resistance were observed (10, 31). In contrast, our study showed unaltered basal insulin concentrations at 188 dpn and an increased transcriptional abundance of genes related to insulin receptor signaling, indicating an increased signal transduction.

In addition to muscle insulin-dependent metabolism, other pathways related to energy utilization are affected by LP gestation diets. Transcripts of genes associated with oxidative phosphorylation are relatively more prominent in LP offspring at developmental period 1 as well as at 188 dpn. Regarding previously described health-promoting benefits of an activated mitochondrial system (37), this transcriptional shift could be categorized as a biopositive effect. However, considering that a poor protein supply in utero led to a numerical decrease of myofibers in skeletal muscle in LP (34) the increased transcriptional abundance of genes related to the of OXPHOS may likely reflect compensatory responses. This adaptation suggests that the available mitochondrial capacity of LP offspring warrants the daily high energy demand of skeletal muscle. Therefore, the increased mRNA expression of OXPHOS in LP offspring might not be associated with prevailing biopositive effects.


The longitudinal survey of changes in transcript abundance in skeletal muscle in response to gestational diets with low [LP, 6.5% crude protein (CP)] or adequate protein (AP, 12.1% CP) contents at prenatal (94 dpc), perinatal (1 dpn), juvenile (28 dpn), and adult (188 dpn) developmental stages revealed acute short-term and delayed long-term modulations. In terms of quantity and quality, the transcriptional response to maternal diets was shown to be stage dependent. In our model the gestational LP diet causes only weak acute differences compared with the AP diet. The dietary impact became most obvious as temporal shifts in the transcriptome accumulated in long-term effects that were prominent at the adult stage. Changes in transcript abundance were not persistent in terms of consistent differential expression of genes at all stages. However, genes related to cell cycle were differentially expressed during the developmental phases that were monitored. Differential expression of genes related to growth indicates that the offspring of both groups use different metabolic directions in response to identical nutritional conditions during postnatal life. These alterations might be related to both IUGR and postnatal compensatory effects. The expression profiles indicate adaptive response in terms of compensatory growth, with a slight shift of body composition toward fat accumulation at the cost of muscle growth, which is in line with whole body observations.


The study was part of the project FEPROeXPRESS (FUGATO plus, FKZ 0315132A), which was funded by the German Federal Ministry of Education and Research.


No conflicts of interest, financial or otherwise, are declared by the author(s).


Author contributions: M.O., E.M., S.P., and K.W. performed experiments; M.O., E.M., S.P., and K.W. analyzed data; M.O., E.M., C.C.M., S.P., and K.W. interpreted results of experiments; M.O. prepared figures; M.O. and K.W. drafted manuscript; M.O., E.M., C.C.M., S.P., and K.W. approved final version of manuscript; E.M., C.C.M., and S.P. edited and revised manuscript; C.C.M. and K.W. conception and design of research.


  • 1 The online version of this article contains supplemental material.


  1. 1.
  2. 2.
  3. 3.
  4. 4.
  5. 5.
  6. 6.
  7. 7.
  8. 8.
  9. 9.
  10. 10.
  11. 11.
  12. 12.
  13. 13.
  14. 14.
  15. 15.
  16. 16.
  17. 17.
  18. 18.
  19. 19.
  20. 20.
  21. 21.
  22. 22.
  23. 23.
  24. 24.
  25. 25.
  26. 26.
  27. 27.
  28. 28.
  29. 29.
  30. 30.
  31. 31.
  32. 32.
  33. 33.
  34. 34.
  35. 35.
  36. 36.
  37. 37.
  38. 38.
  39. 39.
  40. 40.
  41. 41.
  42. 42.
  43. 43.
View Abstract