Physiol. Genomics AJP: Cell Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 8: 107-114, 2002; doi:10.1152/physiolgenomics.00039.2001
1094-8341/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ten Hagen, K. G.
Right arrow Articles by Melvin, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ten Hagen, K. G.
Right arrow Articles by Melvin, J. E.
Received 22 May 2001; accepted in final form 13 December 2001.
Physiological Genomics 8:107-114 (2002)
1094-8341/02 $5.00 © 2002 American Physiological Society

Analysis of isoproterenol-induced changes in parotid gland gene expression

Kelly G. Ten Hagen, Marlene M. Balys, Lawrence A. Tabak and James E. Melvin

Center for Oral Biology, Aab Institute for Biomedical Sciences, University of Rochester, Rochester, New York 14642


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 References
 
Parotid gland acinar cells undergo marked hypertrophy and hyperplasia upon systemic exposure to the ß-adrenergic agonist, isoproterenol. This glandular enlargement is accompanied by substantial cellular changes including DNA synthesis, an increase in glandular protein synthesis, and differential changes in RNA transcription. To gain a more detailed understanding of the underlying changes induced by isoproterenol, we have examined the parotid gland gene expression profile of mice up to 24 h post-isoproterenol injection using high-density oligonucleotide arrays. Depending upon the exposure time, between 22 and 48 of the ~6,500 mouse genes and expressed sequence tags (ESTs) analyzed displayed significant changes in expression patterns. Genes that were previously shown to be repressed ({alpha}-amylase) or activated (proline-rich proteins) following isoproterenol exposure were found to be similarly affected in this experiment, validating this technique. This study demonstrates that the oligonucleotide array technology is a useful tool for examining isoproterenol-induced salivary gland gene expression changes. Using this as a starting point, we can begin to dissect the specific pathways involved in mediating isoproterenol action within the parotid gland.

high-density oligonucleotide arrays; proline-rich protein; ß-adrenergic agonist


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 References
 
ISOPROTERENOL IS A ß-ADRENERGIC agonist that exerts its action through receptor-mediated stimulation of adenylate cyclase and subsequent elevation of intracellular cAMP (4, 5). Increases in intracellular cAMP serve to activate cAMP-dependent protein kinase (PKA) (19); PKA is responsible for phosphorylating and thereby modulating the activity of a wide variety of molecules, including the CREB and CREM transcription factors (12). This increase in PKA activity is thought to be primarily responsible for the subsequent downstream effects of cAMP.

Systemic exposure of mouse and rat parotid glands to isoproterenol results in massive protein secretion from these glands (6, 9) followed by glandular enlargement (26). This glandular enlargement is marked by both hyperplasia (increased numbers of acinar cells) as well as hypertrophy (increased size of acinar cells) (8, 15). DNA synthesis begins within 24 h (3), with maximal mitotic activity occurring 35 h after isoproterenol injection (10). Along with the documented increase in DNA synthesis (24, 25) and mitotic activity within the parotid gland, there is an overall increase in glandular protein synthesis (16, 18). Differential changes in RNA synthesis have also been noted, with some genes expressed in acinar cells being turned on or upregulated [proline-rich proteins (PRPs); 2, 29] and others being downregulated in response to exposure ({alpha}-amylase; 22).

In this study, we have used the DNA microarray technology to begin to characterize the early changes in gene expression within murine parotid glands in response to isoproterenol exposure. This system allows us to examine the in vivo effects of isoproterenol on the expression levels of nearly 6,500 genes and expressed sequence tags (ESTs) simultaneously. Through this type of analysis, we can begin to categorize the pathways and gene families involved in this response as well as potentially identify candidate genes that may be involved in the initiation of the observed acinar cell hypertrophy and hyperplasia.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 References
 

Isoproterenol treatment.
Six-week-old male C57BL/6 NHSd mice weighing between 17.5 and 18.8 g were obtained from Harlan (Indianapolis, IN). All animals were fed ad libitum. After 7 days of acclimation, mice were given a single intraperitoneal injection of (±)-isoproterenol hydrochloride (0.025 g/kg prepared in 140 mM NaCl). Control mice received vehicle only. After 30 min, 2 h, 6 h, and 24 h of isoproterenol exposure, parotid glands were removed and snap-frozen in liquid nitrogen for subsequent RNA isolation. Five animals were used for each time point as well as for controls; parotid glands from the five animals composing each group were combined to generate the poly(A)+ RNA.

Preparation of poly(A)+ RNA, cDNA, and biotin-labeled cRNA.
The methods for preparation of the mRNA, cDNA, and cRNA were described in detailed protocols obtained from Affymetrix (Santa Clara, CA). Briefly, total RNA from parotid glands was isolated using Trizol reagent according to manufacturer’s instructions (Life Technologies). Poly(A)+ RNA was isolated using the Oligotex mRNA kit (Qiagen). mRNA was then precipitated, washed, and resuspended at a concentration of 1 mg/ml. cDNA was synthesized using the Superscript Choice System (Life Technologies) and the T7-(dT)24 primer [dGGCCAGTGAATTGTAATACGACTCACTA-TAGGGAGGCGG-(dT)24] in place of the oligo dT primer provided with the kit. cRNA was synthesized using the T7 Megascript System (Ambion) supplemented with biotin-11-CTP and biotin-16-UTP (Enzo) and subsequently cleaned using RNeasy spin columns (Qiagen).

Target preparation.
Biotinylated cRNA samples were fragmented at 95°C for 30 min in a solution of 40 mM Tris acetate, 500 mM KOAc, and 30 mM MgOAc. An aliquot of this was run on a 1% agarose gel to ensure the sample size was between 35 and 200 bases. A hybridization cocktail was prepared for each chip containing the following: 15 µg cRNA, 100 mM MES, 1 M Na+, 20 mM EDTA, 0.01% Tween 20, 0.1 mg/ml herring sperm DNA, and 0.5 mg/ml acetylated BSA. A control oligonucleotide (final concentration of 50 pM) and sequences representing bacterial control genes (BioB at 1.5 pM, BioC at 5 pM, BioD at 25 pM, and Cre at 100 pM) were also included in this mixture to aid in array alignment and to monitor levels of hybridization and detection. This cocktail was spun through an Amicon Micropure 0.22-µm filter, then heated to 99°C for 5 min followed by 10 min at 45°C. The cocktail was again spun at 12,000 rpm for 5 min and added to the mouse GeneChip Mu6500 Set from Affymetrix. cRNA cocktails were incubated with GeneChip microarrays for 16 h at 45°C in a rotisserie oven.

Washing and staining and analysis of Affymetrix oligonucleotide arrays.
Washing and staining were carried out on a GeneChip fluidics Station 400. The arrays were washed 10 times in buffer A (6x SSPE, 0.01% Tween 20, 0.005% antifoam) followed by four washes in buffer B (100 mM MES, 0.1 M Na+, 0.01% Tween 20). The arrays were then stained for 10 min in SAPE (100 mM MES, 1 M Na+, 0.05% Tween 20, 0.005% antifoam, 2 µg/µl BSA, and 10 µg/ml streptavidin phycoerythrin). Following this stain, arrays are washed 10 times in wash buffer A. The arrays were removed from the fluidics station and scanned at 570 nm using a pixel value of 6 µm on a Hewlett-Packard GeneArray laser-scanning device to generate non-antibody-stained files. The arrays were then stained a second time for antibody enhancement of the first stain. The arrays were stained for 10 min in antibody solution (100 mM MES, 1 M Na+, 0.05% Tween 20, 0.005% antifoam, 2 µg/µl BSA, 1 µg/µl normal goat IgG, and 3 µg/ml biotinylated goat anti-streptavidin antibody) and then stained again with SAPE for 10 min followed by 15 washes in buffer A at 30°C. Arrays were then scanned a second time to generate antibody-stained files. The second stain serves to enhance the signal of very-low-abundance genes. Values from the scanned arrays were analyzed using the GeneChip software. Normalization was performed based on the total intensity of all genes represented on the probe array and compared with a user-defined normalization factor generated from controls from previous experiments.

Genes showing sort scores of >1 or less than -1 and a greater than twofold change in expression level relative to the untreated control were kept for further analysis in Tables 14 and Figs. 1 and 2. The sort score, as determined by the GeneChip software, provides a statistical evaluation of the differences in expression level of a gene between the experimental and baseline and is based on fold change and average difference change. The sort score is more reliable as the measured difference becomes larger.


View this table:
[in this window]
[in a new window]
 
Table 1. Isoproterenol, 30 min

 

View this table:
[in this window]
[in a new window]
 
Table 2. Isoproterenol, 2 h

 

View this table:
[in this window]
[in a new window]
 
Table 3. Isoproterenol, 6 h

 

View this table:
[in this window]
[in a new window]
 
Table 4. Isoproterenol, 24 h

 


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1. Increases of gene expression over time in response to isoproterenol treatment. Values shown on the y-axis represent fold change in mRNA levels for each time point relative to vehicle-treated controls. Time of treatment (in hours) is shown on the x-axis. Genes displaying similar magnitude and temporal expression pattern alterations were clustered together on the same graph. Top left: N10, N10 gene; Mo54, protective protein (Mo54) gene; C3H134, growth factor-inducible immediate early gene; GADD45, growth arrest and DNA-damage-inducible protein gene; MUP IV, major urinary protein IV gene. Top right: AGP/EBP, {alpha}1-acid glycoprotein gene; Pim-1, Pim-1 proto-oncogene; Mkinase, mevalonate kinase gene; MfA-tRNAs, multifucntional aminoacyl-tRNA synthetase gene; Jun-D, Jun-D protein gene; Stat3, signal transducer and activator of transcription mRNA gene; PolPP, pol polyprotein gene; ATF-4, activating transcription factor 4 gene. Bottom left: eIF-4A, protein synthesis initiation factor 4A gene; eIF-5, eukaryotic initiation factor 5; Nip1, nuclear transport protein 1; PP2A, serine/threonine protein phosphatase PP2A. Bottom right: BMP-4, bone morphogenic protein-4 gene; stathmin, prosolin (phosphoprotein P19) gene; CDCP20, cell division control protein gene; CDC2, cell cycle protein p34 CDC2 gene; HMG2P, high-mobility group 2 protein gene.

 


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2. Decreases of gene expression over time in response to isoproterenol treatment. Values shown on the y-axis represent fold change in mRNA levels for each time point relative to untreated controls. Time of treatment (in hours) is shown on the x-axis. Genes displaying similar temporal expression pattern alterations were clustered together on the same graph. Top: KPIC-1, protein kinase C inhibitor protein gene; l-tRNAs, lysyl-tRNA synthetase gene; D8, ubiquitin activating enzyme E1 homolog gene; Hkase, hexokinase gene; G-3-PD, glyceraldehyde-3-phosphate dehydrogenase gene. Bottom: TI-225, TI-225 gene; EF-2, elongation factor gene; COX8H, cytochrome c oxidase subunit VIII-H precursor gene; ox40L, OX40 ligand gene.

 
Northern blot analysis.
Mouse total RNA was electrophoresed on a 0.7% formaldehyde agarose gel and transferred to Hybond-N membranes (Amersham) according to Sambrook and Gething (23). A 475-bp segment of the mouse Pim-1 gene (from IMAGE clone no. 553525; GenBank accession no. AA098418) was amplified by PCR using the primers PIM1–18-S, d(CGACGGCTTCTTGTTGGT), and PIM1–469-AS, d(TCAGGGAGAGACACCATT). This PCR product was labeled using the Random Primers DNA Labeling System (Life Technologies) according to manufacturer’s instructions and used as a probe for Pim-1 transcripts. Antisense 18S ribosomal subunit oligonucleotide d(TATTGGAGCTGGAATTACCGCGGCTGCTGG) was end-labeled as described (27) and used to normalize sample loading by hybridizing with 5 M excess of probe. All hybridizations were performed in 5x SSPE/50% formamide at 42°C with two final washes in 2x SSC/0.1% SDS at 65°C for 20 min. Blots were exposed to Kodak XAR film at -70°C. Signals were quantitated using a Molecular Dynamics PhosphorImager.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 References
 
To begin to define both the specific genes affected as well as the degree of the cellular response during the ß-adrenergic stimulation elicited by isoproterenol within the parotid gland, we have taken advantage of the high-density oligonucleotide array technology. Parotid gland mRNA isolated from groups of mice treated with isoproterenol for 30 min, 2 h, 6 h, and 24 h as well as from controls was used to synthesize biotin-labeled cRNA. Labeled cRNA from each isoproterenol time point was hybridized to a mouse GeneChip Mu6500 Set and analyzed using GeneChip software. Genes displaying a sort score of >1 or less than -1 and a greater than twofold change in expression levels relative to vehicle-treated controls were categorized and annotated in Tables 1 4 (30 min, 2 h, 6 h, and 24 h isoproterenol treatment, respectively). General categories of cellular function of genes showing significant changes in expression levels included metabolism/biosynthesis, protein synthesis, gene expression, structural components, and stress response. Genes encoding other proteins, such as kinases, ATPases, signaling molecules, growth factors, ligands, receptors, and many of unknown function were also affected. After 30 min, 2 h, 6 h, and 24 h of isoproterenol exposure, a total of 22, 45, 48, and 42 genes showed significant changes in expression levels, respectively. The proline-rich proteins, which are known to increase in expression upon isoproterenol exposure (2, 29), showed an increase in expression in this experimental system; similarly, a gene whose expression is known to decrease in response to isoproterenol ({alpha}-amylase; Ref. 22), was also found to decrease, validating the ability of this system to detect such changes in gene expression.

Graphs of genes displaying similar expression pattern changes over the isoproterenol time course are shown in Figs. 1 and 2. Certain genes show a very rapid, but short-lived, increase in expression levels 30 min after isoproterenol treatment [Fig. 1, top left: N10 gene, protective protein (Mo54) gene, growth factor-inducible immediate early gene, GADD45, major urinary protein IV], whereas others show more gradual increases to peaks at 2 h (Fig. 1, top right: {alpha}1-acid glycoprotein gene, Pim-1 oncogene, mevalonate kinase gene, multifunctional aminoacyl-tRNA synthetase gene, Jun-D gene, Stat3 gene, pol polyprotein gene, activating transcription factor 4), 6 h (Fig. 1, bottom left: eIF-4A gene, eIF-5, nuclear transport protein 1, protein phosphatase PP2A), and 24 h (Fig. 1, bottom right: BMP-4 gene, stathmin gene, CDC20 gene, p34 CDC2 gene, high-mobility group 2 protein gene) after isoproterenol exposure. Still other genes show very rapid significant decreases in expression levels (Fig. 2, top: KPIC-1, lysyl-tRNA synthetase gene, ubiquitin activating enzyme E1 homolog gene, hexokinase gene, glyceraldehyde-3-phosphate dehydrogenase) or a delayed response after exposure to isoproterenol (Fig. 2, bottom: TI-225 gene, EF-2 gene, COX8H gene, ox40L gene).

To provide insight into the correctness of the kinetic pattern of the microarray experiment, we verified the expression level changes of the Pim-1 oncogene by Northern blot analysis of parotid gland total RNA. As is seen in Fig. 3, expression of the Pim-1 gene is increased by 3.7-fold after 30 min to reach a peak of 14-fold induction after 2 h of isoproterenol treatment, once again validating the results obtained by the GeneChip methodology (see Fig. 1, top right).



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 3. Northern blot analysis of PIM-1 expression. Total RNA from C57BL/6 mice was extracted from parotid glands after various times of isoproterenol exposure listed above each lane. After electrophoresis on 1% formaldehyde-agarose gels and transfer to Hybond-N membranes, RNA was hybridized with a Pim-1-specific probe. Bottom: the same blot stripped and hybridized with an 18S probe to control for RNA integrity and lane loading variation. Each lane contains 8 µg of total RNA. Size markers are indicated on the left.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 References
 
Exposure of mice and rats to the ß-adrenergic agonist, isoproterenol, has been shown to cause marked hypertrophy and hyperplasia of parotid gland acinar cells through mechanisms that are largely unknown. We have used DNA microarrays to begin to define some of the changes in gene expression levels at various time points after systemic isoproterenol exposure. DNA microarrays allow one to examine the expression of thousands of genes in a given sample simultaneously. The arrays used in these experiments contain oligonucleotides representing nearly 6,500 mouse genes or ESTs. This analysis provided us with information about genes whose expression is rapidly increased in the presence of isoproterenol (Fig. 1, top) as well as those whose expression peaks after more extended times of treatment (Fig. 1, bottom). There were also many genes whose expression decreased upon exposure (Fig. 2). Furthermore, the expression of many different categories of genes was affected by isoproterenol exposure; genes encoding cell cycle proteins, transcription factors, protein synthesis factors, signaling molecules, kinases, and structural proteins were all found to have altered expression levels, indicating the broad range of isoproterenol action/influence. All of these genes represent potential candidates for being involved in the physiological effects of isoproterenol. Although the time of induction in our experiment is difficult to directly compare to the known information in the literature because of differences in the time courses studied, the proline-rich proteins showed an increase in expression upon isoproterenol exposure, as previously shown (2, 29); similarly, {alpha}-amylase decreased, a gene whose expression is known to decrease in response to isoproterenol (22).

Genes whose expression peaks immediately after isoproterenol exposure may represent strong candidates for those acting as mediators of the subsequent downstream effects observed after extended treatment. One such gene identified in this study, Pim-1, was previously described as a proto-oncogene encoding a serine/threonine phosphokinase (17). Overexpression of Pim-1 in mice results in a predisposition to lymphomagenesis (21). Pim-1-deficient mice are apparently healthy and fertile, with the exception that they exhibit erythrocyte microcytosis; this decrease in erythrocyte mean cell volume is directly related to Pim-1 expression. These results implicate Pim-1 in some aspect of cell volume regulation within erythrocytes. It is not know what effect Pim-1 expression may have in the isoproterenol-induced hypertrophy/hyperplasia within parotid acinar cells. Future studies will attempt to address whether the same degree of hypertrophy/hyperplasia is observed in the Pim-1-deficient mice relative to wild-type controls.

Many genes from other systems have been implicated in the regulation of cell size and/or cell division. The Drosophila S6 kinase (DS6K) has been shown to reduce cell and body size when mutated (20) while the total number of cells remains the same. Components of the insulin signaling pathway have likewise been implicated in reduced cell size and number (7, 11). Other studies have identified mutations within the genes involved in protein synthesis as responsible for reduced cell growth and division (14). In our current study, we have identified numerous genes involved in protein synthesis as well as a number of potential signaling molecules whose expression is altered in response to isoproterenol exposure. Future studies will investigate whether these genes contribute to the observed hypertrophy and hyperplasia of salivary gland acinar cells.

A recent DNA microarray study investigated isoproterenol-induced cardiac hypertrophy in mice (13). A total of 32 genes out of 4,000 surveyed showed reproducible changes in expression levels upon isoproterenol treatment. As in the present study, many functional classes such as genes involved in metabolism, protein synthesis, signaling, and gene expression were affected.

This study represents an initial attempt to define and categorize the genes influenced by isoproterenol action within the parotid gland. Because the predominant cell type in this gland is acinar (70–80%), this model system provides a unique opportunity to investigate gene expression changes in a specific cell type in vivo. However, significant changes in gene expression within a minor cell type will also be detected in this study. Therefore, other confirmatory methods, such as in situ hybridization, will be needed to determine conclusively the cell type in which expression changes are occurring. It should also be noted that the samples used in this study were from pools of five individual mice; although pooling may aid in reducing the variability seen from individual to individual, more subtle changes in gene expression may go undetectable in these pools. Taking these caveats into consideration, we have identified a number of genes whose expression profile appears to be influenced by isoproterenol. Currently, there exist microarrays encompassing nearly 30,000 mouse genes and ESTs, with scanning devices capable of accurately detecting very minimal changes in gene expression. Future analyses should reveal an even larger set of genes influenced by systemic isoproterenol exposure. Such studies can also be extended into other tissues affected by isoproterenol to determine similarities in gene expression profiles. Ultimately, understanding the genes responsible for this glandular enlargement might also provide us with information regarding those involved in normal cell growth and division.


    ACKNOWLEDGMENTS
 
This work was supported in part by National Institutes of Health Grants DE-08108 (to L. A. Tabak) and DE-13539 (to J. E. Melvin). We thank the Gene Expression Core at the Lerner Research Institute of the Cleveland Clinic Foundation for technical assistance.

Present address of K. G. Ten Hagen and L. A. Tabak: National Institute of Dental and Craniofacial Research, 31 Center Drive MSC 2290, Building 31, Room 2C39, Bethesda, MD 20892-2290.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: J. E. Melvin, Center for Oral Biology, Univ. of Rochester Medical Center, Box 611, 601 Elmwood Ave., Rochester, NY 14642 (E-mail: james_melvin{at}urmc.rochester.edu).

physiolgenomics.00039.2001.


    References
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 References
 

  1. Ann DK, Clements S, Johnstone EM, and Carlson DM. Induction of tissue-specific proline-rich protein multigene families in rat and mouse parotid glands by isoproterenol. Unusual strain differences of proline-rich protein mRNAs. J Biol Chem 262: 899–904, 1987.[Abstract/Free Full Text]
  2. Ann DK and Lin HH. Transcriptional regulation of salivary proline-rich protein gene expression. Ann NY Acad Sci 842: 108–114, 1998.[Abstract/Free Full Text]
  3. Barka T. Stimulation of DNA synthesis by isoproterenol in the salivary glands. Exp Cell Res 39: 355–364, 1965.[ISI][Medline]
  4. Barnes PJ. Cyclic nucleotides and phosphodiesterases and airway function. Eur Respir J 8: 457–462, 1995.[Abstract]
  5. Birnbaumer L. Receptor-to-effector signaling through G proteins: roles for ß{gamma} dimers as well as {alpha}-subunits. Cell 71: 1069–1072, 1992.[ISI][Medline]
  6. Bogart BI. Secretory dynamics of the rat submandibular gland. An ultrastructural and cytochemical study of the isoproterenol-induced secretory cycle. J Ultrastruct Res 52: 139–155, 1975.[Medline]
  7. Bohni R, Riesgo-Escovar J, Oldham S, Brogiolo W, Stocker H, Andruss BF, Beckingham K, and Hafen E. Autonomous control of cell and organ size by CHICO, a Drosophila homolog of vertebrate IRS1–4. Cell 97: 865–875, 1999.[ISI][Medline]
  8. Brenner GM and Wulf RG. Adrenergic beta receptors mediating submandibular salivary gland hypertrophy in the rat. J Pharmacol Exp Ther 218: 608–612, 1981.[Abstract/Free Full Text]
  9. Butcher FR and Putney JW Jr. Regulation of parotid gland function by cyclic nucleotides and calcium. Adv Cyclic Nucleotide Res 13: 215–249, 1980.[Medline]
  10. Chapola A, Villa N, Valle LB, Oliveira-Filho RM, and Minetti CA. Beta-adrenergic stimulation of mouse parotid gland: amylase activity and secretory granules during isoproterenol-induced mitosis. Gen Pharmacol 16: 419–421, 1985.[Medline]
  11. Chen C, Jack J, and Garofalo RS. The Drosophila insulin receptor is required for normal growth. Endocrinology 137: 846–856, 1996.[Abstract]
  12. De Cesare D, Fimia GM, and Sassone-Corsi P. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci 24: 281–285, 1999.[ISI][Medline]
  13. Friddle CJ, Koga T, Rubin EM, and Bristow J. Expression profiling reveals distinct sets of genes altered during induction and regression of cardiac hypertrophy. Proc Natl Acad Sci USA 97: 6745–6750, 2000.[Abstract/Free Full Text]
  14. Galloni M and Edgar BA. Cell-autonomous and non-autonomous growth-defective mutants of Drosophila melanogaster. Development 126: 2365–2375, 1999.[Abstract]
  15. Hand AR and Ho B. Mitosis and hypertrophy of intercalated duct cells and endothelial cells in the isoproterenol-treated rat parotid gland. J Dent Res 64: 1031–1038, 1985.[Abstract/Free Full Text]
  16. Kim SK, Jones TP, and Cuzzort LM. Protein synthesis and amylase messenger RNA content in rat parotid salivary glands after total or partial stimulation with isoproterenol. Arch Oral Biol 34: 895–901, 1989.[Medline]
  17. Laird PW, van der Lugt NM, Clarke A, Domen J, Linders K, McWhir J, Berns A, and Hooper M. In vivo analysis of Pim-1 deficiency. Nucleic Acids Res 21: 4750–4755, 1993.[Abstract/Free Full Text]
  18. Lillie JH and Han SS. Secretory protein synthesis in the stimulated rat parotid gland. Temporal dissociation of the maximal response from secretion. J Cell Biol 59: 708–721, 1973.[Abstract/Free Full Text]
  19. McKnight GS. Cyclic AMP second messenger systems. Curr Opin Cell Biol 3: 213–217, 1991.[Medline]
  20. Montagne J, Stewart MJ, Stocker H, Hafen E, Kozma SC, and Thomas G. Drosophila S6 kinase: a regulator of cell size. Science 285: 2126–2129, 1999.[Abstract/Free Full Text]
  21. Moroy T, Verbeek S, Ma A, Achacoso P, Berns A, and Alt F. E mu N- and E mu L-myc cooperate with E mu pim-1 to generate lymphoid tumors at high frequency in double-transgenic mice. Oncogene 6: 1941–1948, 1991.[ISI][Medline]
  22. Roberts SG and McDonald CJ. Differential regulation of gene expression in mouse parotid glands in response to isoprenaline treatment. Biochem Soc Trans 19: 118S, 1991.[Medline]
  23. Sambrook J and Gething MJ. Protein structure. Chaperones, paperones. Nature 342: 224–225, 1989.[Medline]
  24. Schneyer CA and Humphreys-Beher M. Inhibition of isoproterenol-induced DNA and RNA synthesis in rat parotid and pancreas following removal of submandibular-sublingual glands. Cell Tissue Res 256: 361–363, 1989.[Medline]
  25. Schneyer CA and Shackleford JM. Accelerated development of salivary glands of early postnatal rats following isoproterenol. Proc Soc Exp Biol Med 112: 320–324, 1963.
  26. Selye H, Veilleux R, and Cantin M. Excessive stimulation of salivary gland growth by isoproterenol. Science 133: 44–45, 1961.[Abstract/Free Full Text]
  27. Ten Hagen KG, Hagen FK, Balys MM, Beres TM, Van Wuyckhuyse B, and Tabak LA. Cloning and expression of a novel, tissue specifically expressed member of the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase family. J Biol Chem 273: 27749–27754, 1998.[Abstract/Free Full Text]
  28. Woon PY, Jeyaseelan K, and Thiyagarajah P. Adrenergic regulation of RNA synthesis in the rat parotid gland. Biochem Pharmacol 45: 1395–1401, 1993.[Medline]
  29. Zhou J, Wright PS, Wong E, Jessen K, Morand JN, and Carlson DM. Cyclic AMP regulation of mouse proline-rich protein gene expression: isoproterenol induction of AP-1 transcription factors in parotid glands. Arch Biochem Biophys 338: 97–103, 1997.[ISI][Medline]



This article has been cited by other articles:


Home page
J. Histochem. Cytochem.Home page
J.-F. Huaulme, Y. Courty, F. Rougeon, and I. Rosinski-Chupin
Androgen Regulation of SMR2 Gene Expression in Rat Submandibular Gland: Evidence for a Graded but not a Binary Response
J. Histochem. Cytochem., October 1, 2003; 51(10): 1317 - 1329.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ten Hagen, K. G.
Right arrow Articles by Melvin, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ten Hagen, K. G.
Right arrow Articles by Melvin, J. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online