|
|
||||||||
1 Department of Biology, Northeastern University, and
2 Division of Hematology/Oncology, Childrens Hospital and Howard Hughes Medical Institute, Boston, Massachusetts 02115
| ABSTRACT |
|---|
|
|
|---|
embryo; vertebrate
| INTRODUCTION |
|---|
|
|
|---|
The mitotic spindle itself plays a major role in controlling the timing and the positioning of cleavage furrow formation (34, 55, 56). Both the spindle poles and the spindle midzone have been shown to regulate development of the furrow (34, 55, 56), probably through interactions with the cell cortex. Recent observations suggest that a "cleavage signal" is delivered from the spindle midzone to the cell cortex to initiate furrow formation (5). Furthermore, reduction in the number of midzone microtubules near the cell cortex inhibits or reverses progression of the cleavage furrow (71). Thus the spindle midzone apparently is required both for the initiation and progression of cytokinesis.
Although the importance of the spindle midzone to cytokinesis is clear, the nature of the midzone cleavage signal and the molecular mechanism of its interaction with the cell cortex remain to be determined. Recent studies suggest that motors of the kinesin-like microtubule motor superfamily (more generally, kinesin-like proteins, or KLPs; see Refs. 4, 28, 45) may be involved in transport of cytokinetic factors to, or in stabilization of, the spindle midzone. Several KLPs [CENP-E, MKLP1/CHO1 (hereafter MKLP1), KLP3A] are present in the spindle midzone during anaphase (48, 72, 74). The distribution of these proteins appears ideal for participation in formation of the cleavage furrow, but only KLP3A has been shown to be required for cytokinesis in Drosophila (72), where this function is restricted to male meiosis. CENP-E may be involved in the metaphase-anaphase transition (74) but apparently does not function in cytokinesis (60). Human MKLP1 has been reported to play a role in anaphase B movement based on its ability to cross-link antiparallel microtubules and to slide them past one another (48). However, two new members of the MKLP1 family, PAV-KLP from Drosophila melanogaster and ZEN-4 from Caenorhabditis elegans, have recently been shown by genetic analysis to be essential for cytokinesis (1, 54). These motors are found at the spindle midzone shortly after the onset of anaphase and appear to stabilize the midzone microtubule bundles. Furthermore, PAV-KLP may mobilize mitotic and cytokinetic regulators, such as the polo kinase (41, 43, 50). Whether MKLP1 performs primarily mitotic or cytokinetic functions in vertebrates remains unclear.
The zebrafish, Danio rerio, is an excellent experimental model for genetic and cell-biological analysis of KLP function in vertebrate development (8, 12, 15, 22, 29). Our objectives in this report are to determine the structure of Mklp1, the zebrafish ortholog of human MKLP1 and hamster CHO1, to map the chromosomal locus of the zebrafish mklp1 gene, and to assess the function of Mklp1 during embryonic cleavage. To this end, we have cloned a full-length zebrafish mklp1 cDNA, mapped the zebrafish mklp1 locus to linkage group 18, and employed epifluorescence microscopy to locate wild-type or green fluorescent protein (GFP)-tagged Mklp1 in cultured cell models and in zebrafish embryos. Using Mklp1-deletion mutants, we have determined the nuclear targeting signals of this motor and have shown that wild-type Mklp1 plays an important role in embryonic cytokinesis. We propose that successful completion of cytokinesis in vertebrate embryos requires the participation of MKLP1 orthologs in the stabilization of the microtubule midbody, in the transport of critical molecules to the cleavage furrow, or both.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Cell culture.
Zebrafish AB9 cells, a primary fibroblast cell line developed from fin tissue of the AB strain (51), were grown in sterile 60-mm culture dishes containing DMEM medium supplemented with 10% FBS. Cells were incubated in a humid, 5% CO2 environment at 29°C. Under these conditions, cells split 1:4 doubled in number in
72 h when fed with fresh culture medium at 3-day intervals.
African green monkey COS-7 cells were cultured at 37°C in DMEM supplemented with 10% FBS in a humid, 5% CO2 incubator. Cells split 1:10 doubled every 24 h when fed fresh culture medium at 3-day intervals.
Cloning and sequencing of the zebrafish mklp1 cDNA.
An oligo(dT)-primed zebrafish head kidney cDNA library (66) in the vector Lambda ZAP Express was screened for clones containing potential mlkp1 cDNA inserts by hybridization to a 166-bp, mklp1-related cDNA [clone mp8; obtained as a serendipitous by-product of an RT-PCR based screen for hematopoietic transcription factors (66)]. A total of 30 candidate mklp1 cDNA isolates were obtained from a screen of
500,000 recombinant phage, and three of these (clones T82, T113, and T118) were carried through tertiary plaque purification and in vivo excision to generate subclones in the plasmid pBK-CMV. Plasmid pmklp1, excised from phage clone T113, contained a full-length cDNA insert of
3.7 kb. The parental cDNA, and nested deletions (26) thereof, were sequenced on both strands by use of the dideoxynucleotide chain termination method (59).
Confirmation that the cDNA insert of pmklp1 encoded the zebrafish ortholog of mammalian MKLP1 was obtained by scanning the deduced protein sequence against the GenBank database using the BLASTP program (National Center for Biotechnology Information). Pairwise comparisons of the Mklp1 protein sequence to those of other KLPs (GenBank accession numbers accompany text) were performed using the algorithm of Needleman and Wunsch (47) as implemented by DNASTAR AALIGN (ver. 1.65).
GenBank data deposition.
The sequence of the zebrafish mklp1 cDNA has been deposited in the GenBank database under the accession number AF139990.
Radiation hybrid mapping.
The zebrafish mklp1 gene was mapped to the zebrafish genome using the Goodfellow T51 panel, which contains 94 radiation hybrid lines (18, 38, 39), and the PCR-based protocol described on the Childrens Hospital Zebrafish Genome Initiative web page (http://zfrhmaps.tch.harvard.edu/ZonRHmapper/). The primers, which were derived from the 3'-untranslated region (3'-UTR) of the mklp1 cDNA, were 5' CAGGTGAATTTTTCATGGCAACA 3' and 5' AGCCTCTCATCACTGTGTGCAATA 3'. Amplification was performed for 40 cycles using the following program: 1) template denaturation at 94°C for 30 s; 2) primer annealing at 55°C for 30 s; and 3) elongation at 72°C for 60 s. The expected size of the fragment amplified using these primers was 164 bp. The map position of zebrafish mklp1 was calculated on the Goodfellow T51 panel using SAMapper 1.0 (64).
Synteny analysis.
Orthologous gene pairs surrounding the zebrafish mklp1 and human MKLP1 loci were identified by reciprocal best-hit BLASTX and BLASTN searches using the criteria and databases described by others (2, 52, 73). Zebrafish genes were mapped to the radiation hybrid T51 panel as described previously. The map positions of the corresponding human genes were obtained from the Human Genome Project Working Draft at University of California, Santa Cruz (freeze of December 12, 2000) at http://genome.ucsc.edu.
Electrophoresis and immunoblotting of cell and embryo extracts.
Lysates of AB9 cells were prepared by homogenization of whole cells in electrophoresis sample buffer (40). KLP-enriched extracts of zebrafish cleavage-stage embryos were isolated by the 5'-adenylylimidodiphosphate (AMP-PNP)-dependent microtubule-affinity protocol of Wagner et al. (69). Proteins in these samples were separated by SDS-polyacrylamide gel electrophoresis (40) on 10% gels. Electrophoretic transfer of proteins from SDS-polyacrylamide gels to Immobilon-P membranes (Millipore) was performed by the method of Towbin et al. (67). Proteins were visualized by transillumination of membranes wetted with 20% methanol (method at http://www.millipore.com/analytical/pubdbase.nsf/docs/TP001.html).
To determine whether AB9 cell extracts and microtubule preparations from cleavage-stage embryos contained Mklp1, Western blots were probed with mouse monoclonal and rabbit polyclonal antibodies, respectively, that have been shown to be specific for the CHO1 antigen (i.e., MKLP1) of mammals (37, 61). (For immunoblotting protocol, see Pierce Chemical technical document 0636, available at http://www.piercenet.com. Primary antibodies were generously provided by Dr. Ryoko Kuriyama, University of Minnesota School of Medicine.) CHO1 IgM-class monoclonal and IgG-class polyclonal antibodies were used at dilutions of 1:1,000 and 1:3,000, respectively, and secondary antibodies [horseradish peroxidase (HRP)-conjugated goat anti-mouse IgM (Sigma) and HRP-conjugated goat anti-rabbit IgG (Sigma)] were used at dilutions of 1:50,000 and 1:75,000. Antigen-antibody complexes were detected using the SuperSignal West Pico Chemiluminescent Substrate (Pierce Chemical).
Immunocytochemistry of zebrafish cells and embryos.
Freshly confluent cultures of AB9 cells were split 1:2 and plated onto sterile glass coverslips in 60-mm culture dishes. On the following day, the cells were fixed with 100% methanol for 4 min at -20°C. After rehydration in blocking solution (2% BSA, 2% normal goat serum, 0.1% Triton X-100, 0.75% glycine, and 0.2% sodium azide in PBS), the fixed cell preparation was incubated (2 h, 37°C) with the mouse monoclonal antibodies CHO1 and DM1D (mouse anti-chicken
-tubulin; IgG class; Sigma Chemical) at dilutions of 1:500 and 1:250, respectively. After washing the coverslips with blocking solution (three 5-min washes), secondary antibodies [indocarbocyanine (Cy3)-conjugated goat anti-mouse IgM and fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG; Jackson ImmunoResearch Laboratories] were applied to the fixed cells at 1:200 dilutions (2 h, 37°C). Finally, the cell preparations were washed three times with blocking solution. Hoechst 33258 (Polysciences) was added to the last wash (1 µg/ml) to stain nuclei. Coverslips were mounted on glass slides with clear nail polish.
Dechorionated zebrafish embryos were processed for whole embryo immunostaining by a modification of the procedure of Solnica-Krezel and Driever (63). Because the epitope recognized by the CHO1 antibody is disrupted by aldehyde fixatives, embryos were fixed with cold methanol (-20°C), which yields suboptimal, but acceptable, preservation of microtubules. Fixed embryos were incubated with the CHO1 and DM1D primary antibodies on a rocking platform for 1618 h at 4°C and washed with blocking solution (four washes of 1 h each, room temperature). Finally, the embryos were incubated with the Cy3- and FITC-conjugated secondary antibodies (1618 h with rocking, 4°C), washed with blocking solution (4x1 h, room temperature), and then mounted in an anti-fading solution (70% glycerol, 0.2% sodium azide in PBS) on bridge slides.
RT-PCR analysis of zebrafish mklp1 mRNA levels during embryonic development.
The steady-state level of zebrafish mklp1 mRNA at discrete developmental stages was analyzed qualitatively by RT-PCR. To provide a framework for comparison, the stage-specific transcript levels of zebrafish elongation factor 1
(EF1
) and transcription factor Pou2 were also determined. Details of the protocol, including primer pairs, can be found at http://www.biology.neu.edu/detrich.html.
Whole embryo in situ hybridization.
Whole mount in situ hybridization using zebrafish mklp1 antisense RNA was performed by a modification (66) of the method of Detrich et al. (11). Stained embryos were transferred to 80% glycerol in 1x PBS for microscopic observation. The protocol can be found at http://www.biology.neu.edu/detrich.html.
Construction of expression plasmids encoding GFP-tagged wild-type and mutant Mklp1s.
The expression plasmids pGFP-Mklp1 [encodes GFP (6) fused through an 18-residue spacer (GSKEFGTRRRGIKLKHLS) to the amino terminus of wild-type Mklp1], pGFP-Mklp1(
N1275) (deletes the first 275 codons of mklp1), and pGFP-Mklp1(
C591867) (removes the last 277 codons of the mklp1 cDNA) were engineered from pmklp1 as described previously (7). Four additional deletion subclones, pGFP-Mklp1(
721867), pGFP-Mklp1 (
815818), pGFP-Mklp1(
863867), and pGFP-Mklp1(
815818,
863867), were generated by PCR-mediated mutagenesis using pfu DNA polymerase (Stratagene). The construct pGFP-Mklp1(T119N), encoding a point mutation (T119N) in Mklp1, was created via primer-based mutagenesis. Full details regarding construction of the new deletion mutants and the point mutant may be found at http://www.biology.neu.edu/detrich.html. As a control, pBK-GFP was constructed by subcloning the GFP cDNA, containing 5'-SpeI and 3'-BamHI linkers (7), between the SpeI and BamHI sites of pBK-CMV. All constructs created by PCR were sequenced to verify, in the regions subjected to amplification, both the intended alterations and the absence of secondary mutations.
Transfection of COS-7 cells with wild-type and deletion mutants of pGFP-Mklp1 and immunodetection of the fusion proteins.
COS-7 cells were transfected with pGFP-Mklp1 (or one of its derivatives) by a modification of the DEAE-dextran protocol described by Sambrook et al. (58). COS-7 cell cultures were split 1:2, and the cells were seeded onto sterile glass coverslips in 60-mm culture dishes as described above for zebrafish AB9 cells. Twenty-four hours later, the cells were incubated with 2-ml DEAE-dextran solution (4 mg/ml DEAE-dextran, 1 mM chloroquine in DMEM) containing
1.5 µg of plasmid for 13 h at 37°C. The DEAE-dextran solution was removed, and cells were then shocked by exposure to 2 ml of DMSO for 2 min at room temperature. After removal of the DMSO solution, cells were washed with PBS (37°C), fed with 2-ml DMEM plus 10% FBS, and incubated for 2024 h before processing for immunostaining with mouse anti-
tubulin IgG (Sigma) and rabbit anti-GFP IgG (Clontech) primary antibodies (see procedures under Immunocytochemistry of zebrafish cells and embryos, above). The secondary antibodies were FITC-conjugated goat anti-mouse IgG and Cy3-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories).
In vitro synthesis of mRNA and embryo microinjection.
pGFP-Mklp1, pGFP-Mklp1(
N1275), pGFP-Mklp1(T119N), and pBK-GFP were cut with KpnI to generate linear templates for in vitro transcription. 5'-Capped mRNAs were synthesized from the templates using T3 RNA polymerase (Promega) and T3 Cap-Scribe nucleotide solution (Boehringer-Mannheim Biochemicals). Only those preparations that gave a single, nondegraded RNA band of appropriate size when evaluated by denaturing electrophoresis (58) were used for microinjection.
Microinjection of synthetic mRNAs into manually dechorionated embryos was performed at the one-cell stage as described by Westerfield (70) using a PLI-100 Picoinjector (Medical Systems). Approximately 5 nl of an mRNA solution (or of sterile water as a control) were injected per embryo. Data are reported only for those experiments in which >80% of the water-injected controls developed through the shield stage. Embryos either were examined alive by confocal epifluorescence microscopy to visualize the GFP signal or were fixed (3.7% formaldehyde, 4 h, room temperature) after 45 h of development and processed for immunostaining. Cell boundaries in fixed embryos were delineated by incubation with a rabbit anti-pan-cadherin polyclonal antibody (IgG class; Sigma Chemical) followed by a Cy3-conjugated goat anti-rabbit IgG secondary antibody (Jackson ImmmunoResearch). The nuclei of fixed embryos were stained with SYTOX per the manufacturers instructions (Molecular Probes).
Microscopy.
Epifluorescence microscopy of AB9 and COS-7 cells was performed with an Olympus Model AH-2 microscope equipped with 20x, 40x, and 100x objectives and with FITC (excitation wavelengths = 380490 nm, emission
515 nm), Texas Red (excitation = 465550 nm, emission
590 nm), and ultraviolet (excitation wavelengths = 330380 nm, emission
420 nm) filter sets. Photomicrographs recorded on Kodak Ektachrome 1600 slide film were digitized at 405 dots/cm by use of a Polaroid Sprint 35 slide scanner. The intracellular distributions of GFP-Mklp1 fusion proteins in living zebrafish embryos, and of fixed embryos stained with anti-pan-cadherin antibody and SYTOX, were examined by confocal epifluorescence microscopy using a Bio-Rad model MRC-600 microscope. Embryos hybridized in situ with RNA probes were examined and photographed with a Nikon model SMZ-U dissecting microscope.
| RESULTS |
|---|
|
|
|---|
100-residue, COOH-terminal extension of the human motor. The similarity of Mklp1 to those of invertebrates was considerably lower (39% for D. melanogaster PAV-KLP; 34% for C. elegans ZEN-4). We conclude that Mklp1 is a relatively short member of the vertebrate subgroup of MKLP1 family motors.
|
The quaternary structural organization of Mklp1 also appeared to be similar to that of its mammalian counterparts. Prediction of secondary structure using COILS (ver. 2.1) revealed that residues 550640 of Mklp1 have a high propensity for formation of an
-helical coiled coil. Thus Mklp1, like human MKLP1 and hamster CHO1, probably forms a parallel coiled-coil homodimer through its stalk, thus positioning two NH2-terminal motor domains at one end of the elongated molecule and the COOH-terminal tails at the other (37).
Mapping of mklp1 to the zebrafish genome and comparative analysis to the human genome.
Using a zebrafish radiation hybrid panel, we mapped the mklp1 gene to within 96 cR of the centromere marker z5479 of linkage group 18 (Fig. 2). The orthologous human gene, MKLP1 (accession no. X67155), was found on the long arm of chromosome 15. To determine whether the zebrafish and human chromosomal segments encompassing MKLP1 constitute syntenic elements conserved between the two genomes, we examined the regions on either side of the motor gene. On the telomeric side of mklp1, we identified three genes, groucho2, MAPKK1, and smad6, whose human orthologs also mapped near the MKLP1 gene. The absolute positions of the four genes of this group appear to have been altered by two inversions. No zebrafish/human syntenies were found on the centromeric side of mklp1, perhaps indicating that the zebrafish gene resides near an inversion or translocation breakpoint that differentiates the two genomes.
|
99 kDa in whole cell extracts of zebrafish AB9 cells, which is consistent with the predicted mass of Mklp1 (98,673 Da). Similarly, a polyclonal CHO1 antibody (37) detected a single, 99-kDa protein in a KLP-enriched microtubule fraction obtained from cleavage-stage zebrafish embryos (Fig. 3B). These observations indicate that the CHO1 antibodies cross-react with zebrafish Mklp1.
|
|
|
|
and Pou2 were consistent with prior reports (17, 25), with the former abundant after MBT and the latter abundant up to the mid-somite stage. We conclude that embryonic zebrafish mklp1 mRNAs are supplied by transcription of both the maternal and zygotic genomes. Whole mount in situ hybridization was performed to examine both the temporal and spatial distribution of mklp1 mRNAs in zebrafish embryos (data not shown). mklp1 transcripts appeared to be distributed uniformly in the cells of embryos from the zygote period through gastrulation (010 h). During early somitogenesis (1012 h), mklp1 mRNAs were present throughout the embryo, with greater concentrations apparent in the head and tail regions. At late somitogenesis (1822 h) and the prim-5 stage (24 h), the message was concentrated primarily in the embryonic brain, which was undergoing neuromere formation and the sculpturing of fore-, mid-, and hindbrain regions.
Location of wild-type Mklp1 in cleaving zebrafish embryos.
We evaluated the spatial distribution of the Mklp1 motor during early embryogenesis by epifluorescence confocal microscopy of embryos stained with CHO1 and
-tubulin antibodies. Figure 7A shows the staining observed at the cleavage furrow between two blastomeres at the eight-cell stage, and Fig. 7B presents an interpretative diagram. Mklp1 was found in a subplasmalemmal annulus in close contact with the outer microtubules of the spindle midzone and nascent midbody. This pattern was observed at all cleavage furrows in early embryos.
|
|
N1275) and GFP-Mklp1(T119N) in preblastula embryos. Both mutations should disrupt the motility of the Mklp1 motor, in the former by eliminating most of its motor domain and in the latter by reducing or abolishing its ATPase activity (46). In the case of the homodimeric Mklp1 motor, expression of the dominant-negative derivatives in excess should cause the wild-type motor chains to be sequestered in functionally inactive hybrids. The resulting phenotypic effects on zebrafish embryogenesis would then suggest the function of the wild-type motor.
To determine whether the dominant-negative motors were defective in their ability to associate with microtubules and to translocate to the cleavage furrow, we transfected COS-7 cells with the corresponding expression plasmids, after which the fusion proteins were detected immunocytochemically. Figure 9 shows that the GFP-Mklp1(
N1275) fusion protein accumulated in the nuclei of cells in interphase (Fig. 9, A and A') but failed to associate with the microtubule cytoskeleton or to migrate to the midbody in cells completing cytokinesis (B and B').1 Similar results were obtained for the GFP-Mklp1 motor with the altered ATP-binding motif (T119N) (data not shown). One instance of an interphase COS-7 cell with four GFP-positive nuclei was observed for the T119N transfection, which suggests that the dominant-negative motor might be able to cause a defect in cytokinesis. Rather than pursue the latter observation in this heterologous cell line, we continued our functional studies of Mklp1 in zebrafish embryos.
|
N1275), Fig. 8, C and D; GFP-Mklp1(T119N), data not shown] consistently demonstrated, during cleavage, brightly staining nuclei but few of the intercellular foci observed with wild-type GFP-mklp1 mRNA (Fig. 8A, B). Occasionally, binucleated blastomeres were observed (Fig. 8C). These results indicated the following: 1) full-length fusion proteins were translated from the synthetic mRNAs (the functional nuclear localization signals reside at the COOH terminus of Mklp1); 2) both GFP-Mklp1(
N1275) and GFP-Mklp1(T119N) were defective in microtubule-dependent translocation; and 3) completion of cytokinesis was inhibited in some blastomeres. However, no impairment of cleavage rate or subsequent morphogenetic movements was apparent, presumably because production of the defective motor chains in most blastomeres was not sufficient to prevent formation of near-normal levels of wild-type Mklp1 dimers. We interpret the GFP signal detected at a small proportion of cleavage furrows to be the result of rare movement to the midbody of translocation-deficient heterodimers (see DISCUSSION) composed of one endogenous wild-type Mklp1 subunit and one GFP-tagged dominant-negative subunit.
The observation that cytokinesis appeared to be inhibited in some blastomeres at low doses of injected dominant-negative GFP-mklp1 mRNA motivated an examination of its effects at higher quantity. Zebrafish embryos at the one- or two-cell stage were injected with GFP-mklp1(
N1275) mRNA, or with wild-type GFP-mklp1 mRNA or GFP control mRNAs, at doses of 1.5, 3.0, or 4.5 ng (Table 1). Those receiving the lowest dose showed little, if any, developmental phenotype irrespective of mRNA type. At the highest dose, cleavage was disrupted by both dominant-negative and control mRNAs, most likely due to nonspecific developmental effects of such large boluses of mRNA (30). The intermediate level of GFP-mklp1(
N1275) mRNA was, however, quite informative. Approximately 30% of embryos (11 of the 37 scored) that received the GFP-mklp1(
N1275) mRNA failed to develop beyond the four- to eight-cell stage. These embryos repeatedly initiated cytokinesis, but their cleavage furrows retracted prior to achieving cell partition. Ten percent of experimental embryos (4 of 37) did not initiate epibolic movement within the interval during which controls reached 50% epiboly. The remaining 60% (22 of 37 scored embryos) appeared to develop normally to the bud stage but contained larger blastomeres during cleavage and exhibited slower epibolic movement than did embryos that received the control mRNAs. Some of the embryos of this last group developed through the somite stages but showed poor tissue organization and, at 24 h, did not move in response to mechanical stimulation (data not shown). Tissue degeneration commenced at 28 h in this subset of embryos. By contrast, embryos that received 3.0 ng of the wild-type GFP-mklp1 or GFP mRNAs showed few developmental abnormalities (Table 1).
|
N1275) mRNA contained many nuclei in a common cytoplasm (Fig. 10, AD), consistent with failure of cytokinesis. By contrast, normal cleavage furrows developed in embryos that received the control mRNAs, and multi-nucleated blastomeres were never observed (Fig. 10, E and F).
|
| DISCUSSION |
|---|
|
|
|---|
Classification and structure of Mklp1.
Structural analysis provides compelling support for assignment of Mklp1 to the MKLP1/CHO1 motor family. The primary sequence of Mklp1 in toto bears a striking resemblance to those of the CHO1 and MKLP1 motors of Chinese hamster and human, and its predicted domain organization (NH2-terminal motor, central stalk, and COOH-terminal tail) is identical to the mammalian proteins. The strong sequence similarity of the COOH-terminal tail domains of the three motors, a feature generally restricted to members of the same KLP family, further supports the assignment of Mklp1 to the MKLP1/CHO1 family (also termed the KIF23/CHO1 family; Ref. 44) of the N-6 class of the KLP superfamily (28). Based on secondary-structure prediction, we suggest that Mklp1 chains associate to form homodimers via coiled-coil dimerization of its stalk domain [cf. Kuriyama et al. (37)].
Zebrafish/human synteny near the MKLP1 locus.
Our observation that the MKLP1 gene orthologs of zebrafish and human are contained in larger chromosomal elements shared by linkage group 18 and chromosome 15, respectively, supports prior analyses that portions of these chromosomes are evolutionarily related (2, 73). Furthermore, the presence of two inversions within the four-gene synteny is consistent with the hypothesis that rearrangements within chromosomes, rather than translocations between, have played the greater evolutionary role in the remodeling of vertebrate karyotypes (52). Given the large size of the KLP motor superfamily (4, 28, 44, 45), future systematic mapping of KLP genes to the genomes of representative vertebrates should provide a compelling test of mechanistic models of vertebrate chromosomal evolution.
Distribution of Mklp1 during the cell cycle.
In zebrafish AB9 cells, the mitotic distribution of Mklp1, determined by staining with the CHO1 antibody (49), resembles that reported for CHO1 and human MKLP1 in several mammalian cell lines (37, 48, 49), i.e., association with spindle microtubules at metaphase, redistribution to the spindle interzone in anaphase, and concentration in the midbody during telophase. During interphase, by contrast, we detect the antigen occasionally in the nuclei of AB9 cells, in contrast to the consistent staining of nuclei in mammalian cells, and localization to the centrosome is not observed. Given the presence of a functional nuclear localization signal in the COOH terminus of Mklp1 (see below), the failure to detect consistently the motor in the nuclei of AB9 cells is puzzling. Perhaps the epitope recognized by the CHO1 antibody is altered or not accessible when Mklp1 is present in nuclei of this cell line. An alternative explanation may be that a second zebrafish paralog of Mklp1, available by virtue of tetraploidization of the zebrafish lineage (53) but devoid of the COOH-terminal epitope recognized by the CHO1 antibody, concentrates preferentially, but not exclusively, in the nuclei of AB9 fibroblasts to perform the nuclear functions of the single MKLP1/CHO1 motor of mammals. To test the latter hypothesis, additional zebrafish klp cDNAs and expressed sequence tags (ESTs) must be screened for sequence affinity to the mklp1 gene.
When fused to GFP and expressed in COS-7 cells, Mklp1 demonstrates both nuclear localization during interphase and dynamic redistribution within the spindle during mitosis [cf. Nislow et al. (48, 49), Kuriyama et al. (37)]. We therefore used COS-7 cells to map the nuclear localization signals of the Mklp1 motor. Our results indicate that nuclear targeting is conferred by a bipartite, COOH-terminal motif composed of the sequence elements RKRR and KRRKP separated by 44 amino acid residues. In contrast, human MKLP1 and PAV-KLP have been reported to contain the putative nuclear targeting motif KTPR near their NH2 termini, but the function of this motif has not been evaluated by deletion analysis. Our demonstration that the corresponding element in Mklp1 (residues 811) does not contribute to targeting of the motor to the interphase nucleus suggests that the nuclear localization sequences of the human, hamster, and Drosophila orthologs should be sought in their COOH termini. Indeed, CHO1 and human MKLP1 possess the first Mklp1 element RKRR, and PAV-KLP a variant (RKRP), in regions of high sequence conservation (Fig. 1), and CHO1 also contains the second element (KRKK- vs. KRRKP in Mklp1). Furthermore, deletion mapping of large segments of human MKLP1 has implicated two overlapping sites, 797PNGSRKR803 and 801RKRR804 (the latter corresponding to 815RKRR818 of Mklp1) in nuclear targeting of the motor (10). C. elegans ZEN-4, which lacks the COOH-terminal region containing the bipartite targeting motif (Fig. 1), associates with centrosomes in interphase cells, but not, apparently, with the nucleus (54).
In cleaving zebrafish embryos, the intracellular distribution of Mklp1 resembles that observed in cultured cells, with specific localization to interphase nuclei, to cleavage furrows, and to midbody remnants. However, Mklp1, whether wild-type or GFP-tagged fusion, has not been detected in the metaphase spindles of cleaving embryos, possibly due to either rapid transit of the motor through the spindle to the future site of furrow formation or to a low density of the motor along spindle microtubules. At the furrow, Mklp1 forms a ring, or disk, at the rim of the cytoplasmic bridge linking the nascent daughter cells [cf. C. elegans ZEN-4; Raich et al. (54)]. As mitosis ends and cytokinesis begins, Mklp1 condenses to form a compact mass coincident with the midbody. With few exceptions, dominant-negative GFP-tagged Mklp1 (i.e., the motor domain deletion) fails to appear in midbody remnants between zebrafish blastomeres completing normal cytokinesis (Fig. 8). Since the rapid, processive movement of kinesins along microtubules generally depends on the presence of two functional motor domains (3, 20, 24, 75), relatively few wild-type/dominant-negative hybrid Mklp1 motors would be expected to accumulate at the midbody. Taken together, our observations of the intracellular distribution of Mklp1 in the blastomeres of cleaving zebrafish embryos support strongly a role for Mklp1 in cytokinesis.
Functional requirement for Mklp1 in cytokinesis, not mitosis.
Our observation that Mklp1 is required for cytokinesis in embryonic zebrafish stands in apparent contradiction to prior reports that suggest that the mammalian orthologs function in mitosis. Human MKLP1 and Chinese hamster CHO1 were originally proposed to provide the force necessary for separation of the spindle poles during mitosis (37, 48, 49). Recombinant human MKLP1 has been shown to bundle antiparallel microtubules in vitro and to disperse the bundles by ATP-dependent sliding (48), activities reminiscent of the antiparallel sliding of polar microtubules during anaphase B. Furthermore, perturbation experiments employing anti-MKLP1 antibody demonstrated mitotic arrest when the antibody was injected into cells prior to onset of anaphase (49). Although suggestive, these results are subject to alternative interpretations (1, 54) and may not reflect the actual function of MKLP1/CHO1 motors in vivo.
Recent genetic analyses of MKLP1/CHO1 orthologs from invertebrates (1, 54) demonstrate that this family of motors is necessary for cytokinesis rather than mitosis. Mutations in the Drosophila gene pavarotti (encoding PAV-KLP) and in the Caenorhabditis gene zen-4 (encoding the ZEN-4 KLP) disrupt cytokinesis without perturbing anaphase B spindle elongation. Thus, if MKLP1/CHO1 motors are involved in spindle elongation, then this function is redundant and can be performed by other KLPs.
Our studies of Mklp1 demonstrate clearly that MKLP1/CHO1 motors are also required for cytokinesis in vertebrates. Expression of dominant-negative mutants of Mklp1 in zebrafish embryos produces a cytokinetic phenotype, i.e., cleavage arrest and the formation of multinucleated blastomeres in the most extreme cases, rather than a mitotic defect. The downstream consequences of perturbing Mklp1 function, which may be direct or indirect, are also severe, with gross tissue disorganization apparent in those embryos that reach the late somitic stages (
1824 h). We propose that MKLP1/CHO1 motors are required for cytokinesis in all metazoan embryos and may also perform later developmental functions (e.g., dendritic differentiation; Refs. 62 and 76).
Proposed mechanism of Mklp1 function in cytokinesis.
How do motors of the CHO1/MKLP1 family participate in the initiation and progression of the cleavage furrow? At least two general mechanisms, distinct but not mutually exclusive, can be invoked to explain their cytokinetic function. First, these motors, by virtue of their ability to cross-link antiparallel microtubules, may maintain the integrity of the spindle midbody (1, 54), hence providing a structural framework for delivery of the "cleavage signal" to the cell cortex (5) or for assembly of the contractile ring (1, 19). Second, these motors appear ideally suited to transport molecules of critical importance to the cytokinetic process to the nascent cleavage furrow. Particularly important may be the polo-like kinase, a serine/threonine kinase that regulates mitotic spindle assembly and, in yeasts, cytokinesis (21). Polo-like kinase interacts in vivo with MKLP1/CHO1 and colocalizes with the motor through mitosis and cytokinesis (42), suggesting that the motor transports the kinase to the spindle midzone where the latter delivers a signal or signals necessary for furrow formation. Alternatively, MKLP1/CHO1 may deliver maternal stores of membrane via midbody or adjacent microtubule bundles to the site of membrane addition at the leading edge of the furrow (9). In zebrafish, transport of cadherin and ß-catenin via intracellular membranes to the furrow surface to mediate blastomere cohesion requires microtubules (31) and probably KLPs. Other potential cargos for MKLP1/CHO1 motors include components of the contractile ring complex (e.g., actin, anillin, septins; Ref 1).
We propose that Mklp1 serves a multifunctional role in cytokinesis during zebrafish morphogenesis, both by stabilizing midbody microtubules and by transporting structural components and/or signaling molecules to the cleavage furrow. Our mechanistic understanding of these functions and the identification of molecular components that interact with this motor are likely to be accelerated by analysis of early acting developmental mutations (e.g., the early arrest mutants; Ref. 33) obtained in recent large-scale mutagenic screens (14, 23) in this fish. Given the substantial pool of mRNAs for Mklp1 (this work) and other KLPs (M.-C. Chen and H. W. Detrich III, unpublished results) that are stored in the zebrafish egg, the design and implementation of maternal-effect screens targeted to motor-dependent processes should be a particularly promising strategy for pursuing this goal.
| ACKNOWLEDGMENTS |
|---|
This work was supported by National Science Foundation Grants OPP-9420712, OPP-9815381, and OPP-0089451 (to H. W. Detrich).
Present address of M.-C. Chen: Academica Sinica, Taipei, Taiwan.
| FOOTNOTES |
|---|
Address for reprint requests and other correspondence: H. W. Detrich III, Dept. of Biology, Northeastern Univ., 414 Mugar Hall, 360 Huntington Ave., Boston, MA 02115 (E-mail: iceman{at}neu.edu).
10.1152/physiolgenomics.00042.2001.
1 The absence of a gross phenotypic effect of the mutant Mklp1s on COS-7 cells probably results from low levels of expression of the exogenous motor during the short posttransfection incubations. ![]()
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
X. Xu, C. He, Z. Zhang, and Y. Chen MKLP1 requires specific domains for its dendritic targeting J. Cell Sci., February 1, 2006; 119(3): 452 - 458. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhu, J. Zhao, M. Bibikova, J. D. Leverson, E. Bossy-Wetzel, J.-B. Fan, R. T. Abraham, and W. Jiang Functional Analysis of Human Microtubule-based Motor Proteins, the Kinesins and Dyneins, in Mitosis/Cytokinesis Using RNA Interference Mol. Biol. Cell, July 1, 2005; 16(7): 3187 - 3199. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Lakshmikanth, H. M. Warrick, and J. A. Spudich A mitotic kinesin-like protein required for normal karyokinesis, myosin localization to the furrow, and cytokinesis in Dictyostelium PNAS, November 23, 2004; 101(47): 16519 - 16524. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tomas, C. Futter, and S. E. Moss Annexin 11 is required for midbody formation and completion of the terminal phase of cytokinesis J. Cell Biol., June 21, 2004; 165(6): 813 - 822. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Saint and W. G. Somers Animal cell division: a fellowship of the double ring? J. Cell Sci., November 1, 2003; 116(21): 4277 - 4281. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |