Physiol. Genomics Journal of Neurophysiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 8: 51-66, 2002. First published November 27, 2001; doi:10.1152/physiolgenomics.00042.2001
1094-8341/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
8/1/51    most recent
00042.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (16)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, M.-C.
Right arrow Articles by Detrich, H. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, M.-C.
Right arrow Articles by Detrich, H. W., III
Received 31 May 2001; accepted in final form 21 November 2001.
Physiological Genomics 8:51-66 (2002)
1094-8341/02 $5.00 © 2002 American Physiological Society

Zebrafish mitotic kinesin-like protein 1 (Mklp1) functions in embryonic cytokinesis

Ming-Chyuan Chen 1, Yi Zhou 2 and H. William Detrich, III 2

1 Department of Biology, Northeastern University, and
2 Division of Hematology/Oncology, Children’s Hospital and Howard Hughes Medical Institute, Boston, Massachusetts 02115


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 References
 
To understand the functions of microtubule motors in vertebrate development, we are investigating the kinesin-like proteins (KLPs) of the zebrafish, Danio rerio. Here we describe the structure, intracellular distribution, and function of zebrafish mitotic KLP1 (Mklp1). The zebrafish mklp1 gene that encodes this 867-amino acid protein maps to a region of zebrafish linkage group 18 that is syntenic with part of human chromosome 15. In zebrafish AB9 fibroblasts and in COS-7 cells, the zebrafish Mklp1 protein decorates spindle microtubules at metaphase, redistributes to the spindle midzone during anaphase, and becomes concentrated in the midbody during telophase and cytokinesis. The motor is detected consistently in interphase nuclei of COS cells and occasionally in those of AB9 cells. Nuclear targeting of Mklp1 is conferred by two basic motifs located in the COOH terminus of the motor. In cleaving zebrafish embryos, green fluorescent protein (GFP)-tagged Mklp1 is found in the nucleus in interphase and associates with microtubules of the spindle midbody in cytokinesis. One- or two-cell embryos injected with synthetic mRNAs encoding dominant-negative variants of GFP-Mklp1 frequently fail to complete cytokinesis during cleavage, resulting in formation of multinucleated blastomeres. Our results indicate that the zebrafish Mklp1 motor performs a critical function that is required for completion of embryonic cytokinesis.

embryo; vertebrate


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 References
 
METAZOAN DEVELOPMENT GENERALLY begins with cleavage, the period during which the zygote undergoes rapid cell division. In vertebrates, karyokinesis (division of the nucleus) alternates with cytokinesis (division of the cytoplasm) to partition the zygote into a multicellular blastula. The requirement for two mechanochemical systems, the mitotic spindle in nuclear division and the actin-myosin contractile ring in cytoplasmic partitioning, to accomplish cleavage has long been recognized. However, the regulatory systems that ensure the temporal and spatial coordination of mitosis and cytokinesis in cleaving embryos remain poorly understood.

The mitotic spindle itself plays a major role in controlling the timing and the positioning of cleavage furrow formation (34, 55, 56). Both the spindle poles and the spindle midzone have been shown to regulate development of the furrow (34, 55, 56), probably through interactions with the cell cortex. Recent observations suggest that a "cleavage signal" is delivered from the spindle midzone to the cell cortex to initiate furrow formation (5). Furthermore, reduction in the number of midzone microtubules near the cell cortex inhibits or reverses progression of the cleavage furrow (71). Thus the spindle midzone apparently is required both for the initiation and progression of cytokinesis.

Although the importance of the spindle midzone to cytokinesis is clear, the nature of the midzone cleavage signal and the molecular mechanism of its interaction with the cell cortex remain to be determined. Recent studies suggest that motors of the kinesin-like microtubule motor superfamily (more generally, kinesin-like proteins, or KLPs; see Refs. 4, 28, 45) may be involved in transport of cytokinetic factors to, or in stabilization of, the spindle midzone. Several KLPs [CENP-E, MKLP1/CHO1 (hereafter MKLP1), KLP3A] are present in the spindle midzone during anaphase (48, 72, 74). The distribution of these proteins appears ideal for participation in formation of the cleavage furrow, but only KLP3A has been shown to be required for cytokinesis in Drosophila (72), where this function is restricted to male meiosis. CENP-E may be involved in the metaphase-anaphase transition (74) but apparently does not function in cytokinesis (60). Human MKLP1 has been reported to play a role in anaphase B movement based on its ability to cross-link antiparallel microtubules and to slide them past one another (48). However, two new members of the MKLP1 family, PAV-KLP from Drosophila melanogaster and ZEN-4 from Caenorhabditis elegans, have recently been shown by genetic analysis to be essential for cytokinesis (1, 54). These motors are found at the spindle midzone shortly after the onset of anaphase and appear to stabilize the midzone microtubule bundles. Furthermore, PAV-KLP may mobilize mitotic and cytokinetic regulators, such as the polo kinase (41, 43, 50). Whether MKLP1 performs primarily mitotic or cytokinetic functions in vertebrates remains unclear.

The zebrafish, Danio rerio, is an excellent experimental model for genetic and cell-biological analysis of KLP function in vertebrate development (8, 12, 15, 22, 29). Our objectives in this report are to determine the structure of Mklp1, the zebrafish ortholog of human MKLP1 and hamster CHO1, to map the chromosomal locus of the zebrafish mklp1 gene, and to assess the function of Mklp1 during embryonic cleavage. To this end, we have cloned a full-length zebrafish mklp1 cDNA, mapped the zebrafish mklp1 locus to linkage group 18, and employed epifluorescence microscopy to locate wild-type or green fluorescent protein (GFP)-tagged Mklp1 in cultured cell models and in zebrafish embryos. Using Mklp1-deletion mutants, we have determined the nuclear targeting signals of this motor and have shown that wild-type Mklp1 plays an important role in embryonic cytokinesis. We propose that successful completion of cytokinesis in vertebrate embryos requires the participation of MKLP1 orthologs in the stabilization of the microtubule midbody, in the transport of critical molecules to the cleavage furrow, or both.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 References
 

Fish maintenance and embryo culture.
Wild-type zebrafish, D. rerio, were obtained from EKK Will Waterlife Resources (Gibsonton, FL) and were maintained in 40-l freshwater aquaria on a 14:10-h light/dark photoperiod at 28–29°C (70). Embryos, obtained by mating two males with three or four females, were collected and placed in egg water (0.03% Instant Ocean synthetic sea salts in deionized water) within the first hour postfertilization. Staging of embryos followed the criteria of Kimmel et al. (35).

Cell culture.
Zebrafish AB9 cells, a primary fibroblast cell line developed from fin tissue of the AB strain (51), were grown in sterile 60-mm culture dishes containing DMEM medium supplemented with 10% FBS. Cells were incubated in a humid, 5% CO2 environment at 29°C. Under these conditions, cells split 1:4 doubled in number in ~72 h when fed with fresh culture medium at 3-day intervals.

African green monkey COS-7 cells were cultured at 37°C in DMEM supplemented with 10% FBS in a humid, 5% CO2 incubator. Cells split 1:10 doubled every 24 h when fed fresh culture medium at 3-day intervals.

Cloning and sequencing of the zebrafish mklp1 cDNA.
An oligo(dT)-primed zebrafish head kidney cDNA library (66) in the vector Lambda ZAP Express was screened for clones containing potential mlkp1 cDNA inserts by hybridization to a 166-bp, mklp1-related cDNA [clone mp8; obtained as a serendipitous by-product of an RT-PCR based screen for hematopoietic transcription factors (66)]. A total of 30 candidate mklp1 cDNA isolates were obtained from a screen of ~500,000 recombinant phage, and three of these (clones T8–2, T11–3, and T11–8) were carried through tertiary plaque purification and in vivo excision to generate subclones in the plasmid pBK-CMV. Plasmid pmklp1, excised from phage clone T11–3, contained a full-length cDNA insert of ~3.7 kb. The parental cDNA, and nested deletions (26) thereof, were sequenced on both strands by use of the dideoxynucleotide chain termination method (59).

Confirmation that the cDNA insert of pmklp1 encoded the zebrafish ortholog of mammalian MKLP1 was obtained by scanning the deduced protein sequence against the GenBank database using the BLASTP program (National Center for Biotechnology Information). Pairwise comparisons of the Mklp1 protein sequence to those of other KLPs (GenBank accession numbers accompany text) were performed using the algorithm of Needleman and Wunsch (47) as implemented by DNASTAR AALIGN (ver. 1.65).

GenBank data deposition.
The sequence of the zebrafish mklp1 cDNA has been deposited in the GenBank database under the accession number AF139990.

Radiation hybrid mapping.
The zebrafish mklp1 gene was mapped to the zebrafish genome using the Goodfellow T51 panel, which contains 94 radiation hybrid lines (18, 38, 39), and the PCR-based protocol described on the Children’s Hospital Zebrafish Genome Initiative web page (http://zfrhmaps.tch.harvard.edu/ZonRHmapper/). The primers, which were derived from the 3'-untranslated region (3'-UTR) of the mklp1 cDNA, were 5' CAGGTGAATTTTTCATGGCAACA 3' and 5' AGCCTCTCATCACTGTGTGCAATA 3'. Amplification was performed for 40 cycles using the following program: 1) template denaturation at 94°C for 30 s; 2) primer annealing at 55°C for 30 s; and 3) elongation at 72°C for 60 s. The expected size of the fragment amplified using these primers was 164 bp. The map position of zebrafish mklp1 was calculated on the Goodfellow T51 panel using SAMapper 1.0 (64).

Synteny analysis.
Orthologous gene pairs surrounding the zebrafish mklp1 and human MKLP1 loci were identified by reciprocal best-hit BLASTX and BLASTN searches using the criteria and databases described by others (2, 52, 73). Zebrafish genes were mapped to the radiation hybrid T51 panel as described previously. The map positions of the corresponding human genes were obtained from the Human Genome Project Working Draft at University of California, Santa Cruz (freeze of December 12, 2000) at http://genome.ucsc.edu.

Electrophoresis and immunoblotting of cell and embryo extracts.
Lysates of AB9 cells were prepared by homogenization of whole cells in electrophoresis sample buffer (40). KLP-enriched extracts of zebrafish cleavage-stage embryos were isolated by the 5'-adenylylimidodiphosphate (AMP-PNP)-dependent microtubule-affinity protocol of Wagner et al. (69). Proteins in these samples were separated by SDS-polyacrylamide gel electrophoresis (40) on 10% gels. Electrophoretic transfer of proteins from SDS-polyacrylamide gels to Immobilon-P membranes (Millipore) was performed by the method of Towbin et al. (67). Proteins were visualized by transillumination of membranes wetted with 20% methanol (method at http://www.millipore.com/analytical/pubdbase.nsf/docs/TP001.html).

To determine whether AB9 cell extracts and microtubule preparations from cleavage-stage embryos contained Mklp1, Western blots were probed with mouse monoclonal and rabbit polyclonal antibodies, respectively, that have been shown to be specific for the CHO1 antigen (i.e., MKLP1) of mammals (37, 61). (For immunoblotting protocol, see Pierce Chemical technical document 0636, available at http://www.piercenet.com. Primary antibodies were generously provided by Dr. Ryoko Kuriyama, University of Minnesota School of Medicine.) CHO1 IgM-class monoclonal and IgG-class polyclonal antibodies were used at dilutions of 1:1,000 and 1:3,000, respectively, and secondary antibodies [horseradish peroxidase (HRP)-conjugated goat anti-mouse IgM (Sigma) and HRP-conjugated goat anti-rabbit IgG (Sigma)] were used at dilutions of 1:50,000 and 1:75,000. Antigen-antibody complexes were detected using the SuperSignal West Pico Chemiluminescent Substrate (Pierce Chemical).

Immunocytochemistry of zebrafish cells and embryos.
Freshly confluent cultures of AB9 cells were split 1:2 and plated onto sterile glass coverslips in 60-mm culture dishes. On the following day, the cells were fixed with 100% methanol for 4 min at -20°C. After rehydration in blocking solution (2% BSA, 2% normal goat serum, 0.1% Triton X-100, 0.75% glycine, and 0.2% sodium azide in PBS), the fixed cell preparation was incubated (2 h, 37°C) with the mouse monoclonal antibodies CHO1 and DM1D (mouse anti-chicken {alpha}-tubulin; IgG class; Sigma Chemical) at dilutions of 1:500 and 1:250, respectively. After washing the coverslips with blocking solution (three 5-min washes), secondary antibodies [indocarbocyanine (Cy3)-conjugated goat anti-mouse IgM and fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG; Jackson ImmunoResearch Laboratories] were applied to the fixed cells at 1:200 dilutions (2 h, 37°C). Finally, the cell preparations were washed three times with blocking solution. Hoechst 33258 (Polysciences) was added to the last wash (1 µg/ml) to stain nuclei. Coverslips were mounted on glass slides with clear nail polish.

Dechorionated zebrafish embryos were processed for whole embryo immunostaining by a modification of the procedure of Solnica-Krezel and Driever (63). Because the epitope recognized by the CHO1 antibody is disrupted by aldehyde fixatives, embryos were fixed with cold methanol (-20°C), which yields suboptimal, but acceptable, preservation of microtubules. Fixed embryos were incubated with the CHO1 and DM1D primary antibodies on a rocking platform for 16–18 h at 4°C and washed with blocking solution (four washes of 1 h each, room temperature). Finally, the embryos were incubated with the Cy3- and FITC-conjugated secondary antibodies (16–18 h with rocking, 4°C), washed with blocking solution (4x1 h, room temperature), and then mounted in an anti-fading solution (70% glycerol, 0.2% sodium azide in PBS) on bridge slides.

RT-PCR analysis of zebrafish mklp1 mRNA levels during embryonic development.
The steady-state level of zebrafish mklp1 mRNA at discrete developmental stages was analyzed qualitatively by RT-PCR. To provide a framework for comparison, the stage-specific transcript levels of zebrafish elongation factor 1{alpha} (EF1{alpha}) and transcription factor Pou2 were also determined. Details of the protocol, including primer pairs, can be found at http://www.biology.neu.edu/detrich.html.

Whole embryo in situ hybridization.
Whole mount in situ hybridization using zebrafish mklp1 antisense RNA was performed by a modification (66) of the method of Detrich et al. (11). Stained embryos were transferred to 80% glycerol in 1x PBS for microscopic observation. The protocol can be found at http://www.biology.neu.edu/detrich.html.

Construction of expression plasmids encoding GFP-tagged wild-type and mutant Mklp1s.
The expression plasmids pGFP-Mklp1 [encodes GFP (6) fused through an 18-residue spacer (GSKEFGTRRRGIKLKHLS) to the amino terminus of wild-type Mklp1], pGFP-Mklp1({Delta}N1–275) (deletes the first 275 codons of mklp1), and pGFP-Mklp1({Delta}C591–867) (removes the last 277 codons of the mklp1 cDNA) were engineered from pmklp1 as described previously (7). Four additional deletion subclones, pGFP-Mklp1({Delta}721–867), pGFP-Mklp1 ({Delta}815–818), pGFP-Mklp1({Delta}863–867), and pGFP-Mklp1({Delta}815–818, {Delta}863–867), were generated by PCR-mediated mutagenesis using pfu DNA polymerase (Stratagene). The construct pGFP-Mklp1(T119N), encoding a point mutation (T119N) in Mklp1, was created via primer-based mutagenesis. Full details regarding construction of the new deletion mutants and the point mutant may be found at http://www.biology.neu.edu/detrich.html. As a control, pBK-GFP was constructed by subcloning the GFP cDNA, containing 5'-SpeI and 3'-BamHI linkers (7), between the SpeI and BamHI sites of pBK-CMV. All constructs created by PCR were sequenced to verify, in the regions subjected to amplification, both the intended alterations and the absence of secondary mutations.

Transfection of COS-7 cells with wild-type and deletion mutants of pGFP-Mklp1 and immunodetection of the fusion proteins.
COS-7 cells were transfected with pGFP-Mklp1 (or one of its derivatives) by a modification of the DEAE-dextran protocol described by Sambrook et al. (58). COS-7 cell cultures were split 1:2, and the cells were seeded onto sterile glass coverslips in 60-mm culture dishes as described above for zebrafish AB9 cells. Twenty-four hours later, the cells were incubated with 2-ml DEAE-dextran solution (4 mg/ml DEAE-dextran, 1 mM chloroquine in DMEM) containing ~1.5 µg of plasmid for 1–3 h at 37°C. The DEAE-dextran solution was removed, and cells were then shocked by exposure to 2 ml of DMSO for 2 min at room temperature. After removal of the DMSO solution, cells were washed with PBS (37°C), fed with 2-ml DMEM plus 10% FBS, and incubated for 20–24 h before processing for immunostaining with mouse anti-{alpha} tubulin IgG (Sigma) and rabbit anti-GFP IgG (Clontech) primary antibodies (see procedures under Immunocytochemistry of zebrafish cells and embryos, above). The secondary antibodies were FITC-conjugated goat anti-mouse IgG and Cy3-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories).

In vitro synthesis of mRNA and embryo microinjection.
pGFP-Mklp1, pGFP-Mklp1({Delta}N1–275), pGFP-Mklp1(T119N), and pBK-GFP were cut with KpnI to generate linear templates for in vitro transcription. 5'-Capped mRNAs were synthesized from the templates using T3 RNA polymerase (Promega) and T3 Cap-Scribe nucleotide solution (Boehringer-Mannheim Biochemicals). Only those preparations that gave a single, nondegraded RNA band of appropriate size when evaluated by denaturing electrophoresis (58) were used for microinjection.

Microinjection of synthetic mRNAs into manually dechorionated embryos was performed at the one-cell stage as described by Westerfield (70) using a PLI-100 Picoinjector (Medical Systems). Approximately 5 nl of an mRNA solution (or of sterile water as a control) were injected per embryo. Data are reported only for those experiments in which >80% of the water-injected controls developed through the shield stage. Embryos either were examined alive by confocal epifluorescence microscopy to visualize the GFP signal or were fixed (3.7% formaldehyde, 4 h, room temperature) after 4–5 h of development and processed for immunostaining. Cell boundaries in fixed embryos were delineated by incubation with a rabbit anti-pan-cadherin polyclonal antibody (IgG class; Sigma Chemical) followed by a Cy3-conjugated goat anti-rabbit IgG secondary antibody (Jackson ImmmunoResearch). The nuclei of fixed embryos were stained with SYTOX per the manufacturer’s instructions (Molecular Probes).

Microscopy.
Epifluorescence microscopy of AB9 and COS-7 cells was performed with an Olympus Model AH-2 microscope equipped with 20x, 40x, and 100x objectives and with FITC (excitation wavelengths = 380–490 nm, emission >= 515 nm), Texas Red (excitation = 465–550 nm, emission >= 590 nm), and ultraviolet (excitation wavelengths = 330–380 nm, emission >= 420 nm) filter sets. Photomicrographs recorded on Kodak Ektachrome 1600 slide film were digitized at 405 dots/cm by use of a Polaroid Sprint 35 slide scanner. The intracellular distributions of GFP-Mklp1 fusion proteins in living zebrafish embryos, and of fixed embryos stained with anti-pan-cadherin antibody and SYTOX, were examined by confocal epifluorescence microscopy using a Bio-Rad model MRC-600 microscope. Embryos hybridized in situ with RNA probes were examined and photographed with a Nikon model SMZ-U dissecting microscope.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 References
 

Primary sequence and structural organization of zebrafish Mklp1.
The 867-residue Mklp1 protein was found to be closely related to, but shorter than, two MKLP1s from mammals, human MKLP1 and CHO1 (68 and 71% overall sequence identity, respectively) (Fig. 1). The sequence identity of Mklp1 to these MKLP1s was greatest in their motor domains (77% to both human MKLP1 and CHO1 covering residues 1–350) but was also significant in their presumptive cargo-binding tails (71% to MKLP1, 70% to CHO1 covering Mklp1 residues 650–867). However, the zebrafish motor lacked the long insertion of CHO1 (residues 691–793) and the ~100-residue, COOH-terminal extension of the human motor. The similarity of Mklp1 to those of invertebrates was considerably lower (39% for D. melanogaster PAV-KLP; 34% for C. elegans ZEN-4). We conclude that Mklp1 is a relatively short member of the vertebrate subgroup of MKLP1 family motors.




View larger version (111K):
[in this window]
[in a new window]
 
Fig. 1. Primary sequence of zebrafish mitotic kinesin-like protein 1 (zMklp1). Sequence alignment of Mklp1 with respect to its orthologs in the MKLP1/CHO1 family: CgCHO1, MKLP1 from the Chinese hamster, Cricetulus griseus (GenBank accession no. X83575); HsMKLP1, MKLP1 from the human, Homo sapiens (accession no. X67155); PAV-KLP, MKLP1 encoded by the Drosophila melanogaster gene pavarotti (accession no. AJ224882); and ZEN-4; MKLP1 encoded by the zen-4 gene of Caenorhabditis elegans (accession no. AF057567). Residues that are identical and/or conserved in three or more of the five proteins are shown in reversed text. Dashes indicate insertions introduced to maximize sequence identity. The P-loop sequence, GSGKT (residues 115–119), is underscored and labeled, and two oligopeptides common to most KLPs, SSRSHS and DLAGSE (residues 298–303 and 337–342), are indicated by dashed underscore. Three putative nuclear localization signals located near the amino- and carboxyl termini are underscored and labeled with Roman numerals.

 
Sequence motifs shared by Mklp1, human MKLP1, CHO1, and many other KLPs included a P-loop sequence, GSGKT (residues 115–119), and two oligopeptides, SSRSHS and DLAGSE (residues 298–303 and 337–342) that are likely to be involved in sensing the status of bound adenosine nucleotide and propagating the conformational changes that generate mechanochemical work (36, 68). Furthermore, potential nuclear-localization signals were present in both the amino- and carboxy-terminal regions (Fig. 1, residues 8–12, 815–818, and 863–867).

The quaternary structural organization of Mklp1 also appeared to be similar to that of its mammalian counterparts. Prediction of secondary structure using COILS (ver. 2.1) revealed that residues 550–640 of Mklp1 have a high propensity for formation of an {alpha}-helical coiled coil. Thus Mklp1, like human MKLP1 and hamster CHO1, probably forms a parallel coiled-coil homodimer through its stalk, thus positioning two NH2-terminal motor domains at one end of the elongated molecule and the COOH-terminal tails at the other (37).

Mapping of mklp1 to the zebrafish genome and comparative analysis to the human genome.
Using a zebrafish radiation hybrid panel, we mapped the mklp1 gene to within 96 cR of the centromere marker z5479 of linkage group 18 (Fig. 2). The orthologous human gene, MKLP1 (accession no. X67155), was found on the long arm of chromosome 15. To determine whether the zebrafish and human chromosomal segments encompassing MKLP1 constitute syntenic elements conserved between the two genomes, we examined the regions on either side of the motor gene. On the telomeric side of mklp1, we identified three genes, groucho2, MAPKK1, and smad6, whose human orthologs also mapped near the MKLP1 gene. The absolute positions of the four genes of this group appear to have been altered by two inversions. No zebrafish/human syntenies were found on the centromeric side of mklp1, perhaps indicating that the zebrafish gene resides near an inversion or translocation breakpoint that differentiates the two genomes.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 2. Synteny of zebrafish and human chromosomal segments encompassing the mklp1/MKLP1 gene. The region of zebrafish linkage group 18 containing the MKLP1, groucho2, MAP2K1, and smad6 genes (left bar, between simple-sequence length polymorphism markers z13426 and z5479) is compared with the segment of human chromosome 15 (right bar, 15q22.31–15q23) that contains the orthologous human genes. Zebrafish and human orthologs are indicated by "EST/GenBank" or "GenBank/GenBank" designators (e.g., fk08g05.y1 = AF035528 or Y12466 = A142116, respectively), the names of the genes are shown below the designators in italic font, and their loci are indicated by the solid lines and white bars. Physical separation between zebrafish genes is shown on the vertical axis in centirays (one cR ~ 60 kb), whereas human genes are bracketed by their base positions (kb). Arrows indicate direction to the respective chromosomal centromeres (cen). EST, expressed sequence tag.

 
Intracellular distribution of Mklp1 in zebrafish AB9 cells.
The monoclonal CHO1 antibody has been shown previously to be specific for an epitope present in the COOH-terminal half of MKLP1/CHO1 family motors from several mammalian cell lines (37, 48, 49). Figure 3A shows that the CHO1 antibody recognized specifically a single protein of ~99 kDa in whole cell extracts of zebrafish AB9 cells, which is consistent with the predicted mass of Mklp1 (98,673 Da). Similarly, a polyclonal CHO1 antibody (37) detected a single, 99-kDa protein in a KLP-enriched microtubule fraction obtained from cleavage-stage zebrafish embryos (Fig. 3B). These observations indicate that the CHO1 antibodies cross-react with zebrafish Mklp1.



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 3. Detection of zebrafish Mklp1 using anti-CHO1 antibodies. A: whole cell extract of AB9 cells (protein) and immunoblot stained with the monoclonal CHO1 antibody (mCHO1). B: KLP-enriched microtubule fraction obtained from cleavage-stage zebrafish embryos (protein) and immunoblot stained with the polyclonal CHO1 antibody (pCHO1). The molecular masses of protein standards (kDa) are indicated in the middle.

 
The cell cycle-dependent intracellular distribution of Mklp1 was analyzed by staining zebrafish AB9 cells with the monoclonal CHO1 antibody. Figure 4 shows that Mklp1 colocalized with a subset of microtubules in a pattern similar to that described for MKLP1 motors in other cell systems. The motor epitope first appeared associated with the microtubules of mitotic spindles at pro-metaphase (Fig. 4C), became concentrated in the microtubules of the spindle interzone in anaphase (Fig. 4D), and remained associated with the spindle midbody during telophase and cytokinesis (Fig. 4, E and F). In some cultures we detected Mklp1 in the nuclei of AB9 cells during interphase, but this observation has not been consistently reproducible (e.g., Fig. 4, A and B). (Consideration of the significance of this observation is reserved to the DISCUSSION, below.) Staining of centrosomes, either in interphase or in mitosis, was not observed.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 4. Distribution of Mklp1 in zebrafish AB9 cells during the cell cycle. Cells at interphase (A and B columns), pro-metaphase (C column), anaphase (D column), telophase (E column), and cytokinesis (F column). Each cell was examined by phase-contrast microscopy (no prime mark) and by epifluorescence microscopy to detect DNA (Hoechst 33258 signal, single prime mark), microtubules (FITC signal, double prime), or Mklp1 (Cy3 signal, triple prime). Immunocytochemistry of proteins and staining of DNA were performed as described under EXPERIMENTAL PROCEDURES. Bar in F''' = 5 µm. Cy3, indocarbocyanine; FITC, fluorescein isothiocyanate.

 
Expression and subcellular distribution of Mklp1 in transfected COS-7 cells.
To verify the cell cycle-dependent behavior of Mklp1 revealed by our immunocytochemical observations, we engineered the expression of a GFP-Mklp1 fusion protein in COS-7 cells. Figure 5 shows that the GFP-tagged motor was readily detected in the nuclei of cells in interphase (A" and D"), redistributed to spindle microtubules at metaphase (B"), migrated to the spindle interzone in anaphase (C"), and finally became concentrated in the midbody during telophase and cytokinesis (D"). Thus the distribution of Mklp1 throughout the cell cycle in this heterologous cell system resembles that reported for other vertebrate MKLPs.



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 5. Cell cycle-dependent distribution of GFP-Mklp1 in COS-7 cells. Cells at interphase (A), metaphase (B), anaphase (C), and cytokinesis (D). Each cell was examined by phase-contrast microscopy (no prime mark) and by epifluorescence microscopy to detect microtubules (green FITC signal, single prime), or GFP-Mklp1 (red Cy3 signal, double prime). Transfection of cells with pGFP-Mklp1 and immunodetection of microtubules and GFP-Mklp1 were performed as described under EXPERIMENTAL PROCEDURES. Arrows in D indicate the midbody. Bar in D" = 5 µm. GFP, green fluorescent protein.

 
Nuclear targeting of Mklp1.
Sequence analysis of Mklp1 revealed potential nuclear localization signals in both the amino- and carboxy-terminal regions of the motor (Fig. 1). To define the sequence motifs that confer nuclear targeting of Mklp1 during interphase, we constructed a series of deletion mutants in pGFP-Mklp1 and examined the cell cycle-dependent behavior of the mutant motors in COS-7 cells. Removal of the amino terminus (residues 1–275) had no effect on nuclear localization during interphase, thus ruling out the sequence element therein (KTPRR, residues 8–12) as a functional targeting signal (Fig. 6). In contrast, deletion of large portions of the carboxy terminus (residues 591–867 or 720–867) abrogated nuclear accumulation. Removal of either of the COOH-terminal sequence elements, 815RKRR818 or 863KRRKP867, resulted in an ambiguous, nuclear/cytoplasmic phenotype, whereas their removal in combination eliminated nuclear targeting. Therefore, the two elements apparently constitute a bipartite nuclear localization motif (13).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 6. Nuclear targeting of Mklp1. COS-7 cells were transfected with pGFP-Mklp1, and deletions thereof, and the expressed proteins were detected by indirect immunocytochemistry (see EXPERIMENTAL PROCEDURES). Deletion mutants, all tagged at the amino terminus with GFP: Mklp1{Delta}N, Mklp1 lacking the first 275 residues; Mklp1{Delta}C, Mklp1 lacking the final 277 residues; Mklp1({Delta}720–867), Mklp1({Delta}815–818), and Mklp1({Delta}863–867), Mklp1 lacking the residues indicated; Mklp1(double {Delta}), Mklp1 lacking both residues 815–818 and 863–867. The subcellular distribution of wild-type and deletion mutants of GFP-Mklp1 is indicated by N (nuclear), C (cytoplasmic), or N/C (both nuclear and cytoplasmic). M, motor domain; S, stalk domain; T, tail domain.

 
Expression of the mklp1 gene in zebrafish embryos.
We investigated the quantity and localization of mklp1 mRNA in zebrafish embryos, both preceding and following the mid-blastula transition (MBT), by RT-PCR and by whole mount in situ hybridization. mklp1 mRNA was abundant in the zygote, cleavage, and early blastula stages, which indicates that message is maternally supplied (for figure, visit http://www.biology.neu.edu/detrich.html). Following MBT, transcript levels declined moderately during the gastrula and somitic stages and then increased markedly by the hatching stage. By contrast, stage-specific transcript levels of zebrafish EF1{alpha} and Pou2 were consistent with prior reports (17, 25), with the former abundant after MBT and the latter abundant up to the mid-somite stage. We conclude that embryonic zebrafish mklp1 mRNAs are supplied by transcription of both the maternal and zygotic genomes.

Whole mount in situ hybridization was performed to examine both the temporal and spatial distribution of mklp1 mRNAs in zebrafish embryos (data not shown). mklp1 transcripts appeared to be distributed uniformly in the cells of embryos from the zygote period through gastrulation (0–10 h). During early somitogenesis (10–12 h), mklp1 mRNAs were present throughout the embryo, with greater concentrations apparent in the head and tail regions. At late somitogenesis (18–22 h) and the prim-5 stage (24 h), the message was concentrated primarily in the embryonic brain, which was undergoing neuromere formation and the sculpturing of fore-, mid-, and hindbrain regions.

Location of wild-type Mklp1 in cleaving zebrafish embryos.
We evaluated the spatial distribution of the Mklp1 motor during early embryogenesis by epifluorescence confocal microscopy of embryos stained with CHO1 and {alpha}-tubulin antibodies. Figure 7A shows the staining observed at the cleavage furrow between two blastomeres at the eight-cell stage, and Fig. 7B presents an interpretative diagram. Mklp1 was found in a subplasmalemmal annulus in close contact with the outer microtubules of the spindle midzone and nascent midbody. This pattern was observed at all cleavage furrows in early embryos.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 7. Colocalization of Mklp1 and microtubules at the cleavage furrow. A: merged confocal image of the cleavage furrow between two blastomeres of an eight-cell embryo showing Mklp1 in red (CHO1 primary antibody, Cy3-conjugated secondary antibody), microtubules in green (anti-chick brain {alpha}-tubulin primary antibody, FITC-conjugated secondary), and the overlap of the antigens in yellow. Preservation of the microtubules was suboptimal due to the use of methanol fixation to preserve the CHO1 epitope of Mklp1. The embryo is oriented with the animal pole to the left and the vegetal pole/yolk cell (not shown) to the right. Bar = 100 µm. B: interpretation of the staining observed in A. Midzone microtubules (or small bundles of microtubules) are indicated by the straight lines that intersect to form the left-to-right chevron pattern, and Mklp1 is represented by the solid circles located at the chevron vertices.

 
When living zebrafish embryos were injected at the one- or two-cell stage with synthetic mRNAs encoding wild-type GFP-Mklp1, the tagged motor was detected both in the nuclei of, and in discrete foci equidistant between, cleaving blastomeres (Fig. 8, A and B). The latter probably correspond to cytokinetic midbodies. Optical sectioning of the cleavage furrow (arrowhead) between the blastomeres indicated in Fig. 8B (curved lines) showed that the motor was distributed as a ring beneath the equatorial cortex (data not shown; for figure, visit http://www.biology.neu.edu/detrich.html). Some staining of the central midbody was also observed. These results are consistent with physical linkage of the microtubule midbody to the cleavage furrow via Mklp1 and suggest that the motor may participate in cytokinesis.



View larger version (168K):
[in this window]
[in a new window]
 
Fig. 8. Distribution of wild-type and dominant-negative GFP-Mklp1 in living zebrafish embryos. One- or two-cell embryos were injected with mRNA (0.5 ng) encoding either GFP-Mklp1 or GFP-Mklp1({Delta}N1–275), and the GFP signal of the expressed fusion protein was detected by confocal microscopy of late blastulae. A and B: wild-type GFP-Mklp1. Numerous labeled nuclei and midbody remnants (examples indicated by arrow and arrowhead, respectively) are visible (A). In dividing blastomeres (B), the fusion protein forms a ring (arrowhead) equidistant between the nascent daughter cells (boundaries indicated by curved lines). C and D: GFP-Mklp1({Delta}N1–275). Many labeled nuclei are present (C), but midbody staining is rare (D). The arrows in C and D show multinucleated blastomeres, and the arrowhead in D indicates a rare midbody containing GFP-Mklp1({Delta}N1–275). Bars = 50 µm.

 
Function of Mklp1 in zebrafish development.
To investigate the function of Mklp1 in embryogenesis, we employed a dominant-negative strategy (27) by expressing the GFP-tagged, amino-terminal mutants GFP-Mklp1({Delta}N1–275) and GFP-Mklp1(T119N) in preblastula embryos. Both mutations should disrupt the motility of the Mklp1 motor, in the former by eliminating most of its motor domain and in the latter by reducing or abolishing its ATPase activity (46). In the case of the homodimeric Mklp1 motor, expression of the dominant-negative derivatives in excess should cause the wild-type motor chains to be sequestered in functionally inactive hybrids. The resulting phenotypic effects on zebrafish embryogenesis would then suggest the function of the wild-type motor.

To determine whether the dominant-negative motors were defective in their ability to associate with microtubules and to translocate to the cleavage furrow, we transfected COS-7 cells with the corresponding expression plasmids, after which the fusion proteins were detected immunocytochemically. Figure 9 shows that the GFP-Mklp1({Delta}N1–275) fusion protein accumulated in the nuclei of cells in interphase (Fig. 9, A and A') but failed to associate with the microtubule cytoskeleton or to migrate to the midbody in cells completing cytokinesis (B and B').1 Similar results were obtained for the GFP-Mklp1 motor with the altered ATP-binding motif (T119N) (data not shown). One instance of an interphase COS-7 cell with four GFP-positive nuclei was observed for the T119N transfection, which suggests that the dominant-negative motor might be able to cause a defect in cytokinesis. Rather than pursue the latter observation in this heterologous cell line, we continued our functional studies of Mklp1 in zebrafish embryos.



View larger version (104K):
[in this window]
[in a new window]
 
Fig. 9. Cell cycle-dependent distribution of dominant-negative GFP-Mklp1 in COS-7 cells. A and B: cells in interphase and cytokinesis, respectively. During interphase, GFP-Mklp1({Delta}N1–275) was present in the nucleus (A and A'). At cytokinesis (B and B'), in contrast, the fusion protein was located throughout the cytoplasm with no significant accumulation at the midbody (arrows). Nuclei were stained with Hoechst 33258 (A). GFP-Mklp1({Delta}N1–275) (A' and B') and microtubules (B) were detected immunocytochemically. Bar in A' = 5 µm.

 
Zebrafish embryos injected with small quantities (0.5 ng) of mRNAs encoding the dominant-negative mutants of GFP-Mklp1 [GFP-Mklp1({Delta}N1–275), Fig. 8, C and D; GFP-Mklp1(T119N), data not shown] consistently demonstrated, during cleavage, brightly staining nuclei but few of the intercellular foci observed with wild-type GFP-mklp1 mRNA (Fig. 8A, B). Occasionally, binucleated blastomeres were observed (Fig. 8C). These results indicated the following: 1) full-length fusion proteins were translated from the synthetic mRNAs (the functional nuclear localization signals reside at the COOH terminus of Mklp1); 2) both GFP-Mklp1({Delta}N1–275) and GFP-Mklp1(T119N) were defective in microtubule-dependent translocation; and 3) completion of cytokinesis was inhibited in some blastomeres. However, no impairment of cleavage rate or subsequent morphogenetic movements was apparent, presumably because production of the defective motor chains in most blastomeres was not sufficient to prevent formation of near-normal levels of wild-type Mklp1 dimers. We interpret the GFP signal detected at a small proportion of cleavage furrows to be the result of rare movement to the midbody of translocation-deficient heterodimers (see DISCUSSION) composed of one endogenous wild-type Mklp1 subunit and one GFP-tagged dominant-negative subunit.

The observation that cytokinesis appeared to be inhibited in some blastomeres at low doses of injected dominant-negative GFP-mklp1 mRNA motivated an examination of its effects at higher quantity. Zebrafish embryos at the one- or two-cell stage were injected with GFP-mklp1({Delta}N1–275) mRNA, or with wild-type GFP-mklp1 mRNA or GFP control mRNAs, at doses of 1.5, 3.0, or 4.5 ng (Table 1). Those receiving the lowest dose showed little, if any, developmental phenotype irrespective of mRNA type. At the highest dose, cleavage was disrupted by both dominant-negative and control mRNAs, most likely due to nonspecific developmental effects of such large boluses of mRNA (30). The intermediate level of GFP-mklp1({Delta}N1–275) mRNA was, however, quite informative. Approximately 30% of embryos (11 of the 37 scored) that received the GFP-mklp1({Delta}N1–275) mRNA failed to develop beyond the four- to eight-cell stage. These embryos repeatedly initiated cytokinesis, but their cleavage furrows retracted prior to achieving cell partition. Ten percent of experimental embryos (4 of 37) did not initiate epibolic movement within the interval during which controls reached 50% epiboly. The remaining 60% (22 of 37 scored embryos) appeared to develop normally to the bud stage but contained larger blastomeres during cleavage and exhibited slower epibolic movement than did embryos that received the control mRNAs. Some of the embryos of this last group developed through the somite stages but showed poor tissue organization and, at 24 h, did not move in response to mechanical stimulation (data not shown). Tissue degeneration commenced at 28 h in this subset of embryos. By contrast, embryos that received 3.0 ng of the wild-type GFP-mklp1 or GFP mRNAs showed few developmental abnormalities (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1. Phenotypes of embryos injected with dominant-negative and control mklp1 mRNAs

 
The cellular defect resulting from injection of mutant mRNA was investigated by confocal microscopy. Figure 10 compares embryos injected at the one- or two-cell stage with dominant-negative or wild-type GFP-mklp1 mRNAs at the intermediate dose. Blastomeres from embryos injected with GFP-mklp1({Delta}N1–275) mRNA contained many nuclei in a common cytoplasm (Fig. 10, A–D), consistent with failure of cytokinesis. By contrast, normal cleavage furrows developed in embryos that received the control mRNAs, and multi-nucleated blastomeres were never observed (Fig. 10, E and F).



View larger version (77K):
[in this window]
[in a new window]
 
Fig. 10. Cytokinetic phenotypes of embryos injected with dominant-negative or control GFP-mklp1 mRNAs. A and B: multiple nuclei in a common cytoplasm. In the most severe phenotype observed, single blastomeres contained many nuclei. B is a 2x enlargement of part of the embryo shown in A. C and D: less severe phenotype in which blastomeres contained 2–4 nuclei. Note the clear delineation of the plasma membrane by the pan-cadherin staining (D). E and F: embryos (8-cell stage) that received wild-type GFP-mklp1 mRNA formed normal cleavage furrows (arrows). Multinucleated blastomeres were never observed in embryos that received the control mRNAs. Embryos were injected with dominant-negative or control mRNAs at the one- to two-cell stage as described under EXPERIMENTAL PROCEDURES. Bars in A, B, E, and F = 50 µm, whereas those in C and D = 10 µm.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 References
 
Cytoplasmic microtubules and their associated motors participate in many processes that govern development of the metazoan embryo, including the mitotic divisions of cleavage, segregation of the germ plasm, localization of determinants during embryonic axis formation, and morphogenetic movements (16, 32, 57, 63, 65). Less well appreciated is the active participation of the microtubule cytoskeleton in embryonic cytokinesis. In this report, we characterize the zebrafish kinesin-like microtubule motor Mklp1, map the locus of the mklp1 gene, and demonstrate that the motor is required for successful completion of cytokinesis in cleaving zebrafish embryos.


Classification and structure of Mklp1.
Structural analysis provides compelling support for assignment of Mklp1 to the MKLP1/CHO1 motor family. The primary sequence of Mklp1 in toto bears a striking resemblance to those of the CHO1 and MKLP1 motors of Chinese hamster and human, and its predicted domain organization (NH2-terminal motor, central stalk, and COOH-terminal tail) is identical to the mammalian proteins. The strong sequence similarity of the COOH-terminal tail domains of the three motors, a feature generally restricted to members of the same KLP family, further supports the assignment of Mklp1 to the MKLP1/CHO1 family (also termed the KIF23/CHO1 family; Ref. 44) of the N-6 class of the KLP superfamily (28). Based on secondary-structure prediction, we suggest that Mklp1 chains associate to form homodimers via coiled-coil dimerization of its stalk domain [cf. Kuriyama et al. (37)].

Zebrafish/human synteny near the MKLP1 locus.
Our observation that the MKLP1 gene orthologs of zebrafish and human are contained in larger chromosomal elements shared by linkage group 18 and chromosome 15, respectively, supports prior analyses that portions of these chromosomes are evolutionarily related (2, 73). Furthermore, the presence of two inversions within the four-gene synteny is consistent with the hypothesis that rearrangements within chromosomes, rather than translocations between, have played the greater evolutionary role in the remodeling of vertebrate karyotypes (52). Given the large size of the KLP motor superfamily (4, 28, 44, 45), future systematic mapping of KLP genes to the genomes of representative vertebrates should provide a compelling test of mechanistic models of vertebrate chromosomal evolution.

Distribution of Mklp1 during the cell cycle.
In zebrafish AB9 cells, the mitotic distribution of Mklp1, determined by staining with the CHO1 antibody (49), resembles that reported for CHO1 and human MKLP1 in several mammalian cell lines (37, 48, 49), i.e., association with spindle microtubules at metaphase, redistribution to the spindle interzone in anaphase, and concentration in the midbody during telophase. During interphase, by contrast, we detect the antigen occasionally in the nuclei of AB9 cells, in contrast to the consistent staining of nuclei in mammalian cells, and localization to the centrosome is not observed. Given the presence of a functional nuclear localization signal in the COOH terminus of Mklp1 (see below), the failure to detect consistently the motor in the nuclei of AB9 cells is puzzling. Perhaps the epitope recognized by the CHO1 antibody is altered or not accessible when Mklp1 is present in nuclei of this cell line. An alternative explanation may be that a second zebrafish paralog of Mklp1, available by virtue of tetraploidization of the zebrafish lineage (53) but devoid of the COOH-terminal epitope recognized by the CHO1 antibody, concentrates preferentially, but not exclusively, in the nuclei of AB9 fibroblasts to perform the nuclear functions of the single MKLP1/CHO1 motor of mammals. To test the latter hypothesis, additional zebrafish klp cDNAs and expressed sequence tags (ESTs) must be screened for sequence affinity to the mklp1 gene.

When fused to GFP and expressed in COS-7 cells, Mklp1 demonstrates both nuclear localization during interphase and dynamic redistribution within the spindle during mitosis [cf. Nislow et al. (48, 49), Kuriyama et al. (37)]. We therefore used COS-7 cells to map the nuclear localization signals of the Mklp1 motor. Our results indicate that nuclear targeting is conferred by a bipartite, COOH-terminal motif composed of the sequence elements RKRR and KRRKP separated by 44 amino acid residues. In contrast, human MKLP1 and PAV-KLP have been reported to contain the putative nuclear targeting motif KTPR near their NH2 termini, but the function of this motif has not been evaluated by deletion analysis. Our demonstration that the corresponding element in Mklp1 (residues 8–11) does not contribute to targeting of the motor to the interphase nucleus suggests that the nuclear localization sequences of the human, hamster, and Drosophila orthologs should be sought in their COOH termini. Indeed, CHO1 and human MKLP1 possess the first Mklp1 element RKRR, and PAV-KLP a variant (RKRP), in regions of high sequence conservation (Fig. 1), and CHO1 also contains the second element (KRKK- vs. KRRKP in Mklp1). Furthermore, deletion mapping of large segments of human MKLP1 has implicated two overlapping sites, 797PNGSRKR803 and 801RKRR804 (the latter corresponding to 815RKRR818 of Mklp1) in nuclear targeting of the motor (10). C. elegans ZEN-4, which lacks the COOH-terminal region containing the bipartite targeting motif (Fig. 1), associates with centrosomes in interphase cells, but not, apparently, with the nucleus (54).

In cleaving zebrafish embryos, the intracellular distribution of Mklp1 resembles that observed in cultured cells, with specific localization to interphase nuclei, to cleavage furrows, and to midbody remnants. However, Mklp1, whether wild-type or GFP-tagged fusion, has not been detected in the metaphase spindles of cleaving embryos, possibly due to either rapid transit of the motor through the spindle to the future site of furrow formation or to a low density of the motor along spindle microtubules. At the furrow, Mklp1 forms a ring, or disk, at the rim of the cytoplasmic bridge linking the nascent daughter cells [cf. C. elegans ZEN-4; Raich et al. (54)]. As mitosis ends and cytokinesis begins, Mklp1 condenses to form a compact mass coincident with the midbody. With few exceptions, dominant-negative GFP-tagged Mklp1 (i.e., the motor domain deletion) fails to appear in midbody remnants between zebrafish blastomeres completing normal cytokinesis (Fig. 8). Since the rapid, processive movement of kinesins along microtubules generally depends on the presence of two functional motor domains (3, 20, 24, 75), relatively few wild-type/dominant-negative hybrid Mklp1 motors would be expected to accumulate at the midbody. Taken together, our observations of the intracellular distribution of Mklp1 in the blastomeres of cleaving zebrafish embryos support strongly a role for Mklp1 in cytokinesis.

Functional requirement for Mklp1 in cytokinesis, not mitosis.
Our observation that Mklp1 is required for cytokinesis in embryonic zebrafish stands in apparent contradiction to prior reports that suggest that the mammalian orthologs function in mitosis. Human MKLP1 and Chinese hamster CHO1 were originally proposed to provide the force necessary for separation of the spindle poles during mitosis (37, 48, 49). Recombinant human MKLP1 has been shown to bundle antiparallel microtubules in vitro and to disperse the bundles by ATP-dependent sliding (48), activities reminiscent of the antiparallel sliding of polar microtubules during anaphase B. Furthermore, perturbation experiments employing anti-MKLP1 antibody demonstrated mitotic arrest when the antibody was injected into cells prior to onset of anaphase (49). Although suggestive, these results are subject to alternative interpretations (1, 54) and may not reflect the actual function of MKLP1/CHO1 motors in vivo.

Recent genetic analyses of MKLP1/CHO1 orthologs from invertebrates (1, 54) demonstrate that this family of motors is necessary for cytokinesis rather than mitosis. Mutations in the Drosophila gene pavarotti (encoding PAV-KLP) and in the Caenorhabditis gene zen-4 (encoding the ZEN-4 KLP) disrupt cytokinesis without perturbing anaphase B spindle elongation. Thus, if MKLP1/CHO1 motors are involved in spindle elongation, then this function is redundant and can be performed by other KLPs.

Our studies of Mklp1 demonstrate clearly that MKLP1/CHO1 motors are also required for cytokinesis in vertebrates. Expression of dominant-negative mutants of Mklp1 in zebrafish embryos produces a cytokinetic phenotype, i.e., cleavage arrest and the formation of multinucleated blastomeres in the most extreme cases, rather than a mitotic defect. The downstream consequences of perturbing Mklp1 function, which may be direct or indirect, are also severe, with gross tissue disorganization apparent in those embryos that reach the late somitic stages (~18–24 h). We propose that MKLP1/CHO1 motors are required for cytokinesis in all metazoan embryos and may also perform later developmental functions (e.g., dendritic differentiation; Refs. 62 and 76).

Proposed mechanism of Mklp1 function in cytokinesis.
How do motors of the CHO1/MKLP1 family participate in the initiation and progression of the cleavage furrow? At least two general mechanisms, distinct but not mutually exclusive, can be invoked to explain their cytokinetic function. First, these motors, by virtue of their ability to cross-link antiparallel microtubules, may maintain the integrity of the spindle midbody (1, 54), hence providing a structural framework for delivery of the "cleavage signal" to the cell cortex (5) or for assembly of the contractile ring (1, 19). Second, these motors appear ideally suited to transport molecules of critical importance to the cytokinetic process to the nascent cleavage furrow. Particularly important may be the polo-like kinase, a serine/threonine kinase that regulates mitotic spindle assembly and, in yeasts, cytokinesis (21). Polo-like kinase interacts in vivo with MKLP1/CHO1 and colocalizes with the motor through mitosis and cytokinesis (42), suggesting that the motor transports the kinase to the spindle midzone where the latter delivers a signal or signals necessary for furrow formation. Alternatively, MKLP1/CHO1 may deliver maternal stores of membrane via midbody or adjacent microtubule bundles to the site of membrane addition at the leading edge of the furrow (9). In zebrafish, transport of cadherin and ß-catenin via intracellular membranes to the furrow surface to mediate blastomere cohesion requires microtubules (31) and probably KLPs. Other potential cargos for MKLP1/CHO1 motors include components of the contractile ring complex (e.g., actin, anillin, septins; Ref 1).

We propose that Mklp1 serves a multifunctional role in cytokinesis during zebrafish morphogenesis, both by stabilizing midbody microtubules and by transporting structural components and/or signaling molecules to the cleavage furrow. Our mechanistic understanding of these functions and the identification of molecular components that interact with this motor are likely to be accelerated by analysis of early acting developmental mutations (e.g., the early arrest mutants; Ref. 33) obtained in recent large-scale mutagenic screens (14, 23) in this fish. Given the substantial pool of mRNAs for Mklp1 (this work) and other KLPs (M.-C. Chen and H. W. Detrich III, unpublished results) that are stored in the zebrafish egg, the design and implementation of maternal-effect screens targeted to motor-dependent processes should be a particularly promising strategy for pursuing this goal.


    ACKNOWLEDGMENTS
 
We thank Dr. Leonard I. Zon for the gift of the zebrafish Mklp1-related cDNA mp8, Dr. Ryoko Kuriyama for kindly providing the monoclonal and polyclonal CHO1 antibodies, and Sandra Parker for help with the Western blots and the preparation of the figures.

This work was supported by National Science Foundation Grants OPP-9420712, OPP-9815381, and OPP-0089451 (to H. W. Detrich).

Present address of M.-C. Chen: Academica Sinica, Taipei, Taiwan.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: H. W. Detrich III, Dept. of Biology, Northeastern Univ., 414 Mugar Hall, 360 Huntington Ave., Boston, MA 02115 (E-mail: iceman{at}neu.edu).

10.1152/physiolgenomics.00042.2001.

1 The absence of a gross phenotypic effect of the mutant Mklp1s on COS-7 cells probably results from low levels of expression of the exogenous motor during the short posttransfection incubations. Back


    References
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 References
 

  1. Adams RR, Tavares AAM, Salzberg A, Bellen HJ, and Glover DM. pavarotti encodes a kinesin-like protein required to organize the central spindle and contractile ring for cytokinesis. Genes Dev 12: 1483–1494, 1998.
  2. Barbazuk WB, Korf I, Kadavi C, Heyen J, Tate S, Wun E, Bedell JA, McPherson JD, and Johnson SL. The syntenic relationship of the zebrafish and human genomes. Genome Res 10: 1351–1358, 2000.
  3. Berliner E, Young EC, Anderson K, Mahtani HK, and Gelles J. Failure of a single-headed kinesin to track parallel to microtubule protofilaments. Nature 373: 718–721, 1995.
  4. Bloom GS and Endow SA. Motor proteins 1: kinesins. Prot Profile 2: 1109–1171, 1995.
  5. Cao LG and Wang YL. Signals from the spindle midzone are required for the stimulation of cytokinesis in cultured epithelial cells. Mol Biol Cell 7: 225–232, 1996.
  6. Chalfie M, Euskirchen G, Ward W, and Prasher DC. Green fluorescent protein as a marker for gene expression. Science 263: 802–805, 1994.
  7. Chen MC and Detrich HW III. Kinesin-like microtubule motors in early development. Methods Cell Biol 59: 227–250, 1999.
  8. Currie PD. Zebrafish genetics: mutant cornucopia. Curr Biol 6: 1548–1552, 1996.
  9. Danilchik MV, Funk WC, Brown EE, and Larkin L. Requirement for microtubules in new membrane formation during cytokinesis in Xenopus embryos. Dev Biol 194: 47–60, 1998.
  10. Deavours BE and Walker RA. Nuclear localization of C-terminal domains of the kinesin-like protein MKLP-1. Biochem Biophys Res Commun 260: 605–608, 1999.
  11. Detrich HW, III, Kieran MW, Chan FY, Barone LM, Yee K, Rundstadler JA, Pratt S, Ransom D, and Zon LI. Intraembryonic hematopoietic cell migration during vertebrate development. Proc Natl Acad Sci USA 92: 10713–10717, 1995.
  12. Detrich HW, III, Westerfield M, and Zon LI. Overview of the zebrafish system. Methods Cell Biol 59: 3–10, 1999.
  13. Dingwall C and Laskey R. Nuclear targeting sequences: a consensus? Trends Biol Sci 16: 478–481, 1991.
  14. Driever W, Solnica-Krezel L, Schier AF, Neuhauss SCF, Malicki J, Stemple DL, Stainier DYR, Zwartkruis F, Abdelilah S, Rangini Z, Belak J, and Boggs C. A genetic screen for mutations affecting embryogenesis in zebrafish. Development 123: 37–46, 1996.
  15. Eisen JS. Zebrafish make a big splash. Cell 87: 969–977, 1996.
  16. Eyal-Giladi H. Establishment of the axis in chordates: facts and speculations. Development 124: 2285–2296, 1997.
  17. Gao D, Li Z, Murphy T, and Sauerbier W. Structure and transcription of the gene for translation elongation factor 2 subunit alpha of zebrafish (Danio rerio). Biochim Biophys Acta 1350: 1–5, 1997.
  18. Geisler R, Rauch GJ, Baier H, van Bebber F, Brobeta L, Dekens MP, Finger K, Fricke C, Gates MA, Geiger H, Geiger-Rudolph S, Gilmour D, Glaser S, Gnugge L, Habeck H, Hingst K, Holley S, Keenan J, Kirn A, Knaut H, Lashkari D, Maderspacher F, Martyn U, Neuhauss S, and Haffter P. A radiation hybrid map of the zebrafish genome. Nat Genet 23: 86–89, 1999.
  19. Giansanti MG, Bonaccorsi S, Williams B, Williams EV, Santolamazza C, Goldberg ML, and Gatti M. Cooperative interactions between the central spindle and the contractile ring during Drosophila cytokinesis. Genes Dev 12: 396–410, 1998.
  20. Gilbert SP, Webb MR, Brune M, and Johnson KA. Pathway of processive ATP hydrolysis by kinesin. Nature 373: 671–676, 1995.
  21. Glover DM, Okhura H, and Tavares A. Polo kinase: the choreographer of the mitotic stage? J Cell Biol 135: 1681–1684, 1996.
  22. Grunwald DJ. A fin-de-siècle achievement: charting new waters in vertebrate biology. Science 274: 1634–1635, 1996.
  23. Haffter P, Granato M, Brand M, Mullins MC, Hammerschmidt M, Kane DC, Odenthal J, van Eeden FJM, Jiang YJ, Heisenberg CP, Kelsh RN, Furutani-Seiki M, Vogelsang E, Beuchle D, Schach U, Fabian C, and Nüsslein-Volhard C. The identification of genes with unique and essential functions in the development of the zebrafish, Danio rerio. Development 123: 1–36, 1996.
  24. Hancock WO and Howard J. Processivity of the motor protein kinesin requires two heads. J Cell Biol 140: 1395–1405, 1998.
  25. Hauptmann G and Gerster T. Pou-2: a zebrafish gene active during cleavage stages and in the early hindbrain. Mech Dev 51: 127–138, 1995.
  26. Henikoff S. Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28: 351–359, 1984.
  27. Herskowitz I. Functional inactivation of genes by dominant negative mutations. Nature 329: 219–222, 1987.
  28. Hirokawa N. Kinesin and dynein superfamily proteins and the mechanism of organelle transport. Science 279: 519–526, 1998.
  29. Holder N and McMahon A. Genes from zebrafish screens. Nature 384: 515–516, 1996.
  30. Hyatt TM and Ekker SC. Vectors and techniques for ectopic gene expression in zebrafish. Methods Cell Biol 59: 117–126, 1999.
  31. Jesuthasan S. Furrow-associated microtubule arrays are required for the cohesion of zebrafish blastomeres following cytokinesis. J Cell Sci 111: 3695–3703, 1998.
  32. Jesuthasan S and Strähle U. Dynamic microtubules and specification of the zebrafish embryonic axis. Curr Biol 7: 31–42, 1996.
  33. Kane DC, Maischein HM, Brand M, van Eeden FJM, Furutani-Seiki M, Granato M, Haffter P, Hammerschmidt M, Heisenberg CP, Jiang YJ, Kelsh RN, Mullins MC, Odenthal J, Warga RM, and Nüsslein-Volhard C. The zebrafish early arrest mutants. Development 123: 57–66, 1996.
  34. Kawamura K. Microdissection studies on the dividing neuroblast of the grasshopper, with special reference to the mechanism of unequal cytokinesis. Exp Cell Res 106: 127–137, 1977.
  35. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, and Schilling TF. Stages of embryonic development of the zebrafish. Dev Dyn 203: 253–310, 1995.
  36. Kull FJ, Sablin EP, Lau R, Fletterick RJ, and Vale RD. Crystal structure of the kinesin motor domain reveals a structural similarity to myosin. Nature 380: 550–555, 1996.
  37. Kuriyama R, Dragas-Granoic S, Maekawa T, Vassilev A, Khodjakov A, and Kobayashi H. Heterogeneity and microtubule interaction of the CHO1 antigen, a mitosis-specific kinesin-like protein. J Cell Sci 107: 3485–3499, 1994.
  38. Kwok C, Critcher R, and Schmitt K. Construction and characterization of zebrafish whole genome radiation hybrids. Methods Cell Biol 60: 287–302, 1999.
  39. Kwok C, Korn RM, Davis ME, Burt DW, Critcher R, McCarthy L, Paw BH, Zon LI, Goodfellow PN, and Schmitt K. Characterization of whole genome radiation hybrid mapping resources for non-mammalian vertebrates. Nucleic Acids Res 26: 3562–3566, 1998.
  40. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685, 1970.
  41. Lane HA and Nigg EA. Antibody microinjection reveals an essential role for human polo-like kinase 1 (Plk1) in the functional maturation of mitotic centrosomes. J Cell Biol 135: 1701–1713, 1996.
  42. Lee KS, Yuan YL, Kuriyama R, and Erickson RL. Plk is an M-phase-specific protein kinase and interacts with a kinesin-like protein, CHO1/MKLP1. Mol Cell Biol 15: 7143–7151, 1995.
  43. Llamazares S, Moreira A, Tavares A, Girdham C, Spruce BA, Gonzalez C, Karess RE, Glover DM, and Sunkel CE. Polo encodes a protein kinase homolog required for mitosis in Drosophila. Genes Dev 5: 2153–2165, 1991.
  44. Miki H, Setou M, Kaneshiro K, and Hirokawa N. All kinesin superfamily protein, KIF, genes in mouse and human. Proc Natl Acad Sci USA 98: 7004–7011, 2001.
  45. Moore JD and Endow SA. Kinesin proteins: a phylum of motors for microtubule-based motility. Bioessays 18: 207–219, 1996.
  46. Nakata T and Hirokawa N. Point mutation of adenosine triphosphate-binding motif generated rigor kinesin that selectively blocks anterograde lysosome membrane transport. J Cell Biol 131: 1039–1053, 1995.
  47. Needleman SB and Wunsch CD. A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol 48: 443–453, 1970.
  48. Nislow C, Lombillo VA, Kuriyama R, and McIntosh JR. A plus-end-directed motor enzyme that moves antiparallel microtubules in vitro localizes to the interzone of mitotic spindles. Nature 359: 543–547, 1992.
  49. Nislow C, Sellito C, Kuriyama R, and McIntosh JR. A monoclonal antibody to a mitotic microtubule-associated protein blocks mitotic progression. J Cell Biol 111: 511–522, 1990.
  50. Ohkura H, Hagan IM, and Glover DM. The conserved Schizosaccharomyces pombe kinase, plo1, required to form a bipolar spindle, the actin ring, and septum, can drive septum formation in G1 and G2 cells. Genes Dev 9: 1059–1073, 1995.
  51. Paw BH and Zon LI. Primary fibroblast cell culture. Methods Cell Biol 59: 39–43, 1999.
  52. Postlethwait JH, Woods IG, Ngo-Hazelett P, Yan YL, Kelly PD, Chu F, Huang H, Hill-Force A, and Talbot WS. Zebrafish comparative genomics and the origins of vertebrate chromosomes. Genome Res 10: 1890–1902, 2000.
  53. Postlethwait JH, Yan YL, Gates MA, Horne S, Amores A, Brownlie A, Donovan A, Egan ES, Force A, Gong Z, Goutel C, Fritz A, Kelsh R, Knapik E, Liao E, Paw B, Ransom D, Singer A, Thomson M, Abduljabbar TS, Yelick P, Beier D, Joly JS, Larhammar D, and Rosa F. Vertebrate genome evolution and the zebrafish gene map. Nat Genet 18: 345–349, 1998.
  54. Raich WB, Moran AN, Rothman JH, and Hardin J. Cytokinesis and midzone microtubule organization in Caenorhabditis elegans require the kinesin-like protein ZEN-4. Mol Biol Cell 9: 2037–2049, 1998.
  55. Rappaport R. Establishment of the mechanism of cytokinesis in animal cells. Int Rev Cytol 105: 245–281, 1986.
  56. Rappaport R and Rappaport BN. Establishment of cleavage furrows by the mitotic spindle. J Exp Zool 189: 189–196, 1974.
  57. Robb DL, Heasman J, Raats J, and Wylie C. A kinesin-like protein is required for germ plasm aggregation in Xenopus. Cell 87: 823–831, 1996.
  58. Sambrook J, Fritsch EF, and Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989.
  59. Sanger F, Nicklen S, and Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463–5467, 1977.
  60. Savoian MS, Earnshaw WC, Khodjakov A, and Rieder CL. Cleavage furrows formed between centrosomes lacking an intervening spindle and chromosomes contain microtubule bundles, INCENP, and CHO1 but not CENP-E. Mol Biol Cell 10: 297–311, 1999.
  61. Sellito C and Kuriyama R. Distribution of a matrix component of the midbody during the cell cycle in Chinese hamster ovary cells. J Cell Biol 106: 431–439, 1988.
  62. Sharp DJ, Yu W, Ferhat L, Kuriyama R, Rueger DD, and Baas PW. Identification of a microtubule-associated motor protein essential for dendritic differentiation. J Cell Biol 138: 833–843, 1997.
  63. Solnica-Krezel L and Driever W. Microtubule arrays of the zebrafish yolk cell: organization and function during epiboly. Development 120: 2443–2455, 1994.
  64. Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O’Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, and Cox DR. An STS-based radiation hybrid map of the human genome. Genome Res 7: 422–433, 1997.
  65. Strähle U and Jesuthasan S. Ultraviolet radiation impairs epiboly in zebrafish embryos: evidence for a microtubule-dependent mechanism of epiboly. Development 119: 909–919, 1993.
  66. Thompson MA, Ransom DG, Pratt SJ, MacLennan H, Kieran MW, Detrich HW, III, Vail B, Huber TL, Paw B, Brownlie AJ, Oates AC, Fritz A, Gates MA, Amores A, Bahary N, Talbot WS, Her H, Beier DR, Postlethwait JH, and Zon LI. The cloche and spadetail genes differentially affect hematopoiesis and vasculogenesis. Dev Biol 197: 248–269, 1998.
  67. Towbin H, Staehelin T, and Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 76: 4350–4354, 1979.
  68. Vale RD. Switches, latches, and amplifiers: common themes of G proteins and molecular motors. J Cell Biol 135: 291–302, 1996.
  69. Wagner MC, Pfister KK, Brady ST, and Bloom GS. Purification of kinesin from bovine brain and assay of microtubule-stimulated ATPase activity. Methods Enzymol 196: 157–175, 1991.
  70. Westerfield M. The Zebrafish Book. Eugene, OR: University of Oregon Press, 1995, p. 1.1–11.78.
  71. Wheatley SP and Wang Y. Midzone microtubule bundles are continuously required for cytokinesis in cultured epithelial cells. J Cell Biol 135: 981–989, 1996.
  72. Williams BC, Riedy MF, Williams EV, Gatti M, and Goldberg ML. The Drosophila kinesin-like protein KLP3A is a midbody component required for central spindle assembly and initiation of cytokinesis. J Cell Biol 129: 709–723, 1995.
  73. Woods IG, Kelly PD, Chu F, Ngo-Hazelett P, Yan YL, Huang H, Postlethwait JH, and Talbot WS. A comparative map of the zebrafish genome. Genome Res 10: 1903–1914, 2000.
  74. Yen TJ, Compton DA, Wise D, Zinkowski RP, Brinkley BR, Earnshaw WC, and Cleveland DW. CENP-E, a novel human centromere-associated protein required for progression from metaphase to anaphase. EMBO J 10: 1245–1254, 1991.
  75. Young EC, Mahtani HK, and Gelles J. One-headed kinesin derivatives move by a nonprocessive, low-duty ratio mechanism unlike that of two-headed kinesin. Biochemistry 37: 3467–3479, 1998.
  76. Yu W, Sharp DJ, Kuriyama R, Mallik P, and Baas PW. Inhibition of a mitotic motor compromises the formation of dendrite-like processes from neuroblastoma cells. J Cell Biol 136: 659–668, 1997.



This article has been cited by other articles:


Home page
J. Cell Sci.Home page
X. Xu, C. He, Z. Zhang, and Y. Chen
MKLP1 requires specific domains for its dendritic targeting
J. Cell Sci., February 1, 2006; 119(3): 452 - 458.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
C. Zhu, J. Zhao, M. Bibikova, J. D. Leverson, E. Bossy-Wetzel, J.-B. Fan, R. T. Abraham, and W. Jiang
Functional Analysis of Human Microtubule-based Motor Proteins, the Kinesins and Dyneins, in Mitosis/Cytokinesis Using RNA Interference
Mol. Biol. Cell, July 1, 2005; 16(7): 3187 - 3199.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. S. Lakshmikanth, H. M. Warrick, and J. A. Spudich
A mitotic kinesin-like protein required for normal karyokinesis, myosin localization to the furrow, and cytokinesis in Dictyostelium
PNAS, November 23, 2004; 101(47): 16519 - 16524.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
A. Tomas, C. Futter, and S. E. Moss
Annexin 11 is required for midbody formation and completion of the terminal phase of cytokinesis
J. Cell Biol., June 21, 2004; 165(6): 813 - 822.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
R. Saint and W. G. Somers
Animal cell division: a fellowship of the double ring?
J. Cell Sci., November 1, 2003; 116(21): 4277 - 4281.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
8/1/51    most recent
00042.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (16)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, M.-C.
Right arrow Articles by Detrich, H. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, M.-C.
Right arrow Articles by Detrich, H. W., III


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online