Physiol. Genomics Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 8: 41-50, 2002. First published November 20, 2001; doi:10.1152/physiolgenomics.00085.2001
1094-8341/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
8/1/41    most recent
00085.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by RUIZ-VELASCO, V.
Right arrow Articles by PUHL, H. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by RUIZ-VELASCO, V.
Right arrow Articles by PUHL, H. L.
Received 25 September 2001; accepted in final form 17 November 2001.
Physiological Genomics 8:41-50 (2002)
1094-8341/02 $5.00 © 2002 American Physiological Society

Cloning, tissue distribution, and functional expression of the human G protein ß4-subunit

VICTOR RUIZ-VELASCO1, STEPHEN R. IKEDA1,2 and HENRY L. PUHL2

1 Laboratory of Molecular Physiology
2 cDNA Resource Center, Guthrie Research Institute, Sayre, Pennsylvania 18840


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Heterotrimeric G proteins (G{alpha}ß{gamma}) play an essential role in coupling membrane receptors to effector proteins such as ion channels and enzymes. Among the five mammalian Gß-subunits cloned, the human G protein ß4 has not been described. The purpose of the present study was to functionally characterize the newly identified human Gß4 subunit. The Gß4 open reading frame (ORF) was amplified utilizing PCR from brain cDNA. Amplification primers were generated following 5' rapid amplification of cDNA ends (5'-RACE) from an expressed sequence tag (EST) containing the predicted 3' end of the protein. Multiple tissue cDNA panel analysis showed that Gß4 mRNA was strongly expressed in lung and placenta, whereas it is weakly expressed in brain and heart. Heterologous overexpression of Gß4{gamma}2 or Gß4{gamma}4 in rat sympathetic neurons resulted in tonic modulation of N-type voltage-gated Ca2+ and G protein-gated inwardly rectifying K+ currents. Furthermore, coexpression of Gß4{gamma}2 and G{alpha}oA resulted in heterotrimer formation. These results show that the newly cloned Gß4 subunit shares several properties with other human Gß family members.

G protein ß4; signal transduction; ion channel modulation


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
HETEROTRIMERIC G PROTEINS (G{alpha}ß{gamma}) function to relay signals (i.e., neurotransmitters, hormones, light, and odors) from surface receptors to effectors. Receptor activation causes a conformational change in the G protein {alpha}-subunit, which leads to an exchange of GDP for GTP. This results in the dissociation of the GTP-bound {alpha} from the Gß{gamma} dimer. Both the G{alpha}- and Gß{gamma}-subunits subsequently regulate downstream effectors, such as ion channels and enzymes. Hydrolysis of GTP on the G{alpha}-subunit causes the reassociation of Gß{gamma} and GDP-bound G{alpha}.

The crystal structure of the G{alpha}ß{gamma} heterotrimer has shown that Gß is composed of an NH2 terminus that is 20 amino acids long and forms an {alpha}-helix, and a toroidal structure that is made up of seven repeating units (16, 28, 30). Each of these units is made up of four antiparallel ß-strands and is known as a WD repeat. The seven WD units are arranged in a ring and form a propeller structure. The G{gamma}-subunit is prenylated at the COOH terminus, whereas the NH2 terminus makes a coiled-coil interaction with the Gß {alpha}-helical structure. In addition, G{gamma} contacts Gß along blades 5, 6, and 7. G{alpha} contacts Gß in two regions. The first contact is between the first blade of the Gß-subunit and the amino terminal helix of G{alpha}. The second contact occurs between the G{alpha} region (switch II) that changes conformation between GDP- and GTP-bound forms and the "top" surface of the Gß-subunit (16, 28, 30).

Cloning studies in mammals have thus far identified 18 G{alpha}-, 5 Gß-, and 12 G{gamma}-subunits (31). Thus several hundred potential heterotrimeric combinations are likely. However, given the tissue-specific expression of some of these subunits, the number of combinations that are formed is decreased. Gß1–ß4 subunits share a sequence homology that is greater than 80%, whereas Gß5 is the least homologous ({approx}53%) to the four subunits (3, 31). Furthermore, functional studies have shown that Gß1–ß4 coexpressed with several G{gamma}-subunits are capable of modulating effectors such as N- and P/Q-type Ca2+ channels (1, 7, 11, 26, 32, but see Ref. 6), G protein-gated inwardly rectifying K+ (GIRK) channels (17, 22), adenylyl cyclase type II (9), and phospholipase C-ß2/3 (9, 23). These reports have shown minor differences in regard to modulatory specificity among the four Gß-subunits and effectors. Of the five Gß-subunits identified, the genomic and functional characteristics of the human Gß4 subunit are unknown. To date the only Gß4 clone studied has been obtained from mouse (1, 29). Therefore, the purpose of the present study was to identify and functionally characterize the human Gß4 ortholog. The hypothesis to be tested is that the heterologous expression of Gß4 with G{gamma}-subunits results in effector interaction and heterotrimer formation. To our knowledge, this is the first report describing the cloning of human Gß4, as well as the modulation of N-type Ca2+ and GIRK channels by this subunit.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Isolation of the full-length Gß4 cDNA.
The COOH-terminal end of the Gß4 open reading frame (ORF) was identified by performing a peptide search of the GenBank EST database. An EST (accession no. T68047) containing 333 bp near the 3' end, a portion of the 3'-untranslated region (3'-UTR) and stop codon was identified. Based on the obtained sequence, 5' rapid amplification of cDNA ends (5'-RACE) reactions were performed on Marathon Ready human whole brain cDNA (Clontech Laboratories, Palo Alto, CA), employing the following primer: 5' GAGCCGGCAAGTGGCATCATCAGAG 3' (Integrated DNA Technologies, Coralville, IA). PCR reactions were then carried out with the Advantage 2 Polymerase (Clontech Laboratories) in a model 480 Thermal Cycler (Perkin-Elmer, Foster City, CA) using the following protocol: 30 s at 95°C and 4 min at 68°C, 35 cycles. The PCR fragments were then purified, subcloned into the pGEM T-Easy vector (Promega, Madison, WI) and sequenced. Clones were screened for size by restriction analysis following plasmid isolation with the Wizard Plus SV Miniprep System (Promega). Fragments of the size predicted to contain the remaining portion of the ORF frame were sequenced using the BigDye Terminator Kit (Applied Biosystems, Foster City, CA) on an ABI 377 automated DNA sequencer (Perkin-Elmer). Sequence and protein alignment analysis were performed with the MacVector software package (Oxford Molecular, Madison, WI).

The Gß4 ORF from Marathon Ready human whole brain cDNA was amplified by designing primers based on both the EST sequence and 5'-RACE products. The primers for the 3' and 5' ends were GATCTTAATTCCAGATTCTAAGAAAACTGTC (XhoI site is underscored) and GATCACCATGAGCGAACTGGAACAGTTGAGG (BamHI site is underscored), respectively. The PCR reaction was performed with Pfu Turbo polymerase (Stratagene, La Jolla, CA) in the model 480 Thermal Cycler using a three-step cycling protocol as follows: denaturation for 50 s at 95°C, elongation for 50 s at 55°C, and annealing for 2 min at 72°C for 35 cycles. The amplified fragment was cut with BamHI and XhoI and ligated into the pcDNA3.1 vector (Invitrogen). Clones were screened by restriction analysis following plasmid isolation. To avoid polymerase-induced PCR errors, nine positive clones were sequenced and analyzed as described above. A single clone containing the consensus sequence was used in subsequent experiments. In preliminary experiments, the heterologous expression of Gß4 in neurons with the pcDNA 3.1 vector was inconsistent. Thus both Gß4 and Gß1 were subcloned into the NheI and XbaI sites of the pCI expression vector (Promega). This vector utilizes the cytomegalovirus (CMV) promoter to drive expression of cloned inserts. The Gß4 and Gß1 expression constructs were sequenced and found to be identical with the consensus sequence described above for the former and the sequence provided by the supplier (Guthrie cDNA Resource Center, Sayre, PA) for the latter. The assembled coding sequence was deposited into the GenBank (accession no. AF300648).

Multiple tissue cDNA panel screening.
The following primers were used to screen a Multiple Tissue cDNA (MTC, Clontech Laboratories) panel: probe for 3'-UTR GCTATAGGCTGTAGCATTGATTTCTCC and probe for 571–596 GACCACCACATTCACTGGGCATTCTG. A preliminary amplification yielded a 558-bp product from brain cDNA, which was subcloned into the pGEM T-Easy vector (Promega). The size of the clones was screened by restriction analysis following plasmid isolation with the Wizard Plus SV Miniprep System and sequenced as described above to ensure specificity. Screening of the MTC panel (Clontech Laboratories) was done according to the manufacturer. Briefly, separate PCR reactions were assembled containing cDNA from the following human tissues: brain, heart, kidney, liver, lung, pancreas, placenta, and skeletal muscle. Two sets of reactions were performed per cDNA source, one with the probe primers and a second set with the control glyceraldehyde-3-phosphate dehydrogenase (G3PDH) primers [5' (upstream) primer: TGAAGGTCGGAGTCAACGGATTTGGT and 3' (downstream) primer: CATGTGGGCCATGAGGTCCACCAC]. Negative controls (no cDNA) were performed with both G3PDH- and Gß4-specific primers. A positive control for the G3PDH primer set was provided by the manufacturer. All PCR reactions were performed with Titanium Taq DNA polymerase (Clontech Laboratories) in the model 480 thermal cycler using the following two-step protocol: 30 s at 94°C, followed by 35 cycles of 30 s at 94°C and 2 min at 68°C, with a final extension of 5 min at 68°C. Gel analysis was performed with aliquots removed at cycles 22 and 30. Amplification products were run on a 1.0% agarose gel, stained with ethidium bromide, and visualized with a Kodak model DC290 digital camera.

Neuron isolation.
Adult rat superior cervical ganglion (SCG) neurons were prepared using methods previously described (26). The experiments carried out were approved by Institutional Animal Care and Use Committee (IACUC). Briefly, male Wistar rats (175–225 g) were anesthetized with CO2 prior to decapitation with a laboratory guillotine. The ganglia were dissected in chilled Hanks’ balanced salt solution and then incubated with 0.6 mg/ml collagenase type D (Boehringer-Mannheim, Indianapolis, IN), 0.4 mg/ml trypsin (TRL type; Worthington Biochemical, Lakewood, NJ), and 0.1 mg/ml DNase type I (Sigma Chemical, St. Louis, MO) for 60 min at 36 ± 1°C. Following incubation, the dispersed neurons were centrifuged twice for 6 min at 50 g and then resuspended in minimal essential medium (MEM; Mediatech, Herndon, VA) supplemented with 10% fetal calf serum (Atlanta Biologicals, Atlanta, GA), 1% glutamine, and 1% penicillin-streptomycin solution (Mediatech). The neurons were then plated into 35-mm tissue culture plates coated with poly-L-lysine and placed in a humidified incubator containing 5% CO2 in air at 37°C.

Plasmid microinjection was performed with an Eppendorf model 5246 microinjector and model 5171 micromanipulator (Madison, WI) ~3–5 h after plating. Plasmids coding for human Gß1, Gß4, G{gamma}2, and G{gamma}4 (Guthrie cDNA Resource Center) were injected at a final concentration of 10 ng/µl; plasmids coding for human G{alpha}oA (Guthrie cDNA Resource Center) and human Kir 3.1 and 3.4 (GIRK1 and GIRK4, respectively) were injected at a final concentration of 100 ng/µl. The plasmid coding for the jellyfish green fluorescent protein (pEGFP-N1, 5 ng/µl; Clontech Laboratories) was coinjected with the plasmids and served as a "marker" for cells receiving a successful injection. Neurons were identified 12–18 h later using an inverted microscope (Diaphot 300; Nikon) equipped with an epifluorescence unit (DM510 filter cube; Nikon).

Electrophysiology and data analysis.
Ca2+ and GIRK currents were recorded using the whole-cell variant of the patch-clamp technique. Patch pipettes were pulled from borosilicate glass capillaries (Corning 7052; Garner Glass, Claremont, CA) on a Flaming-Brown (model P-97) micropipette puller (Sutter Instrument, San Rafael, CA), coated with Sylgard (Dow Corning, Midland, MI) and fire polished. Whole-cell currents were acquired with a patch-clamp amplifier (Axopatch 1-C; Axon Instruments, Foster City, CA), analog filtered at 5–10 kHz (-3 dB; 4-pole Bessel) and digitized using custom designed software (S4) on a Power PC computer (Power Computing, Austin, TX) equipped with a 16-bit analog-to-digital converter board (model ITC16; Instrutech, Elmont, NY). Cell membrane capacitance and series resistance (80–85%) were electronically compensated. Experiments were performed at room temperature (21–24°C). Data and statistical analysis were performed with Igor (Lake Oswego, OR) and GB-Stat PPC (Silver Spring, MD) software packages, respectively, employing one-way ANOVA followed by the Newman-Keuls test. P < 0.05 was considered statistically significant. Graphs and current traces were produced with Igor and Canvas (Deneba Software, Miami, FL) software packages.

Basal facilitation [i.e., prior to norepinephrine (NE) application] was calculated as the ratio of Ca2+ current (ICa) amplitude determined from the test pulse (+10 mV) occurring after (postpulse) to the test pulse (+10 mV) occurring before (prepulse) the +80 mV conditioning pulse (see Fig. 4D). ICa amplitude was measured isochronally 10 ms after initiation of each test pulse. The NE-mediated inhibition was calculated as follows: [ICa(prepulse before NE) - ICa(prepulse after NE)]/[ICa(prepulse before NE)] x 100. GIRK currents were recorded every 10 s by applying a 200-ms voltage ramp from -140 to -40 mV from a holding potential of -60 mV. Basal and NE-stimulated peak GIRK currents were calculated by digitally subtracting current traces obtained before and after NE exposure, respectively, from those obtained after application of 1 mM Ba2+. Maximal inward GIRK currents were measured between -135 and -125 mV.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Effect of heterologous expression of Gß4 with {gamma}4 or {gamma}2 and G{alpha}oA on facilitation and norepinephrine (NE)-mediated inhibition of Ca2+ currents in rat SCG neurons. Superimposed Ca2+ current (ICa) traces evoke with the "double pulse" voltage protocol (bottom of D) in the absence (lower traces) and presence (upper traces) of 10 µM NE for control (A), ß4{gamma}4- (B), ß4{gamma}2- (C), and G{alpha}oAß4{gamma}2-expressing (D) neurons. Currents were evoked every 10 s. Dashed lines refer to the zero current level. E: summary graphs of means ± SE of basal facilitation and ICa inhibition. Final concentration of cDNA injected was 10 ng/µl per ß- and {gamma}-subunits and 100 ng/µl per {alpha}-subunit. Facilitation was calculated as the ratio of ICa amplitude determined from the test pulse (+10 mV) occurring after (postpulse) to the test pulse occurring before (prepulse) the +80 mV conditioning pulse. **P < 0.01 vs. control. Numbers in parentheses indicate the number of experiments.

 
For recording Ca2+ currents, the pipette solution contained (in mM) 120 N-methyl-D-glucamine, 20 tetraethylammonium hydroxide (TEA-OH), 11 EGTA, 10 HEPES, 10 sucrose, 1 CaCl2, 4 Mg-ATP, 0.3 disodium ATP, and 14 Tris creatine phosphate. The pH was adjusted to 7.2 with methanesulfonic acid and HCl (20 mM), and the osmolality was 299–302 mosmol/kg. The external solution consisted of (in mM) 145 TEA-OH, 10 HEPES, 15 glucose, 10 CaCl2, and 0.0003 tetrodotoxin (TTX). The pH was adjusted to 7.4 with methanesulfonic acid, and the osmolality was 319–327 mosmol/kg. For recording GIRK currents, the pipette solution contained (in mM) 135 KCl, 11 EGTA, 1 CaCl2, 2 MgCl2, 10 HEPES, 4 Mg-ATP, and 0.3 disodium ATP. The pH was adjusted to 7.2 with KOH, and the osmolality was 305 mosmol/kg. The GIRK external solution consisted of (in mM) 130 NaCl, 5.4 KCl, 10 HEPES, 10 CaCl2, 0.8 MgCl2, 15 glucose, 15 sucrose, and 0.0003 TTX. The pH was adjusted to 7.4 with NaOH, and the osmolality was 326 mosmol/kg.

Stock solution (10 mM) of NE bitartrate (Sigma Chemical) was prepared in H2O and diluted in the external solution to 10 µM just prior to use. NE application to the neuron under study was performed by positioning a custom-designed gravity-fed microperfusion system {approx}100 µm from the cell.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Isolation and cloning of human Gß4 cDNA.
The mouse Gß4 peptide sequence, 230–242, was used to search the National Center for Biotechnology Information (NCBI) human tblastn database of translated EST clones. A single EST clone (GenBank accession no. T68047/IMAGE clone no. 83095) showed strong amino acid homology to mouse Gß (accession nos. M63658 and M87286). The T68047 clone contained a 660-bp fragment, which was comprised of the 3'-UTR, the stop codon, and 333 bp encoding 111 amino acids on the 3' end of the Gß4 ORF. Gene-specific primers were designed based on the sequence provided by the partial ORF. With these primers, the sequence of the remaining ORF (687 bp) was obtained by 5'-RACE of human whole brain cDNA. The largest RACE product was 819 bp in length. This product included a 69-bp overlap with the partial ORF from the EST, a 63-bp portion of the 5'-UTR, and 687 bp coding for the remaining segment of the ORF. The complete ORF was amplified by PCR with primers designed from the sequence information obtained from both the 5'-RACE reaction and original EST sequence. The intact ORF encodes a 340-amino acid protein. Figure 1 shows the nucleotide and primary protein structure of the human Gß4 protein. Gray boxes indicate the seven highly conserved WD repeats. Based on the Gß crystal structure, it has been reported that the WD repeat motifs form the blades of a ß propeller structure (16, 28, 30). Each blade is made up of four antiparallel ß-strands (Fig. 1, arrows) that form a four-stranded ß-sheet. These seven ß-sheets are arranged like the blades of a propeller.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 1. Human G protein ß4-subunit cDNA nucleotide sequence and its predicted amino acid sequence. The cDNA sequence has been numbered from the start codon ATG. The seven WD repeats are highlighted in gray shading and form the blades of a ß propeller structure. Each blade consists of four antiparallel ß-strands that form a four-stranded ß-sheet, for a total of 28 ß-strands, denoted by arrows. Stop codon is represented by the asterisk.

 
Figure 2 is a Clustal W alignment, which compares human Gß1–4 and mouse Gß4 amino acid sequences. The mouse sequence was cloned in our laboratory from IMAGE clone 457406 (GenBank accession no. AI323322), which contained the entire Gß4 ORF. All five Gß-subunits are 340 amino acids in length and have a predicted molecular mass between 35 and 39 kDa. The alignment analysis showed that Gß4 shared the highest sequence homology with Gß1 and mouse Gß4 at 91 and 96%, respectively. The amino acids at positions 19, 39, 196, 233, and 263 were found to be the least conserved (Fig. 2, nonshaded areas).



View larger version (88K):
[in this window]
[in a new window]
 
Fig. 2. Comparison of the deduced amino acid sequence of G protein ß-subunits. Sequences of human Gß1 through Gß4 and mouse Gß4. Identical residues are represented by dark shading. Light shading indicates conserved amino acids. Mismatches are represented by nonshaded areas.

 
Tissue distribution of human Gß4 mRNA.
The presence of human Gß4 mRNA in several tissues was also investigated. Figure 3A shows a multiple tissue cDNA panel employed to screen for Gß4 mRNA. A 558-bp fragment was amplified from cDNA isolated from the tissues that were analyzed. The amplified fragment was specific to segments from both the COOH-terminal portion of the Gß4 ORF and the 3'-UTR. Figure 3A demonstrates that this fragment was amplified most efficiently in the lungs, pancreas, and placenta. Furthermore, the level of amplification was intermediate in kidney and liver. Minimal levels were observed in brain and heart tissue. Figure 3B shows the amplification of a 1,000-bp fragment from G3PDH that was used as a control for normalization of cDNA quantities. The gel picture shown was produced with reactions following 35 cycles of amplification. Fewer cycle numbers (22 or 30) produced little to no visible product in the tissues tested with both the Gß4 and G3PDH (control) primer sets.



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 3. Tissue distribution of human Gß4 by multiple tissue cDNA panel analysis. A: amplification of a specific 558-bp fragment of hGß4 from cDNA obtained from the following tissues: b, brain; h, heart; k, kidney; l, liver; l', lung; p, pancreas; p', placenta; s, skeletal muscle. The 500- and 1,000-bp bands are shown in the ladder marker (M). B: amplification of a 1,000-bp G3PDH control band from the tissues above, as well as both negative (-, no cDNA) and positive (+, cDNA included) controls (see MATERIALS AND METHODS). This assay was performed three times.

 
Heterologous expression of Gß4 in rat sympathetic neurons.
The next set of experiments was performed to determine whether the heterologous expression of human Gß4 would lead to modulation of ion channels. In rat SCG neurons, the majority of G protein-coupled receptors (GPCR) modulate N-type Ca2+ channels via an inhibitory mechanism that is both voltage dependent (VD) and membrane delimited (8). NE activates G proteins via {alpha}2-adrenergic receptors, which leads to kinetic slowing of Ca2+ currents. Kinetic slowing is thought to arise from a VD relief of block during the application of a depolarizing test pulse. The neurotransmitter-induced VD inhibition of N-type Ca2+ channels is mediated by Gß{gamma} (7, 11; for review see Ref. 12). Another consequence of VD relief of inhibition is a phenomenon referred to as facilitation. Facilitation is determined by evoking Ca2+ currents with two identical test pulses (usually to +10 mV) separated by a large depolarizing conditioning pulse (+80 mV) (10). The ratio of the postpulse to prepulse current amplitude (measured isochronally at 10 ms after the start of the test pulse) is termed facilitation.

Figure 4A shows superimposed Ca2+ currents evoked with a double-pulse voltage protocol (Fig. 4D, bottom) in an uninjected neuron before (bottom trace) and after (top trace) exposure to 10 µM NE. Prior to NE application, the ICa rose rapidly to a peak and reached a plateau within 5–10 ms after the onset of the test pulse. On the other hand, exposure of the neuron to NE caused the rising phase of the ICa to be slow and biphasic. Figure 4A also shows that prior to NE application the postpulse current amplitude was affected minimally by the conditioning pulse (to +80 mV). On the other hand, in the presence of NE, the postpulse current amplitude was much greater than the prepulse current amplitude. This is a result of VD relief of inhibition during the test pulse. In uninjected neurons, the mean basal facilitation (i.e., in the absence of NE) was 1.43 ± 0.05 (n = 16), and the NE-mediated inhibition was 66.2 ± 1.5% (Fig. 4E).

Figure 4, B and C, shows the Ca2+ currents recorded from neurons coinjected with Gß4{gamma}4 and Gß4{gamma}2 cDNA (10 ng/µl per subunit). Before addition of NE to the external bath, the Ca2+ currents showed extreme kinetic slowing that was similar to that produced by NE in uninjected neurons. The basal facilitation in Gß4{gamma}4- and Gß4{gamma}2-expressing neurons was significantly greater (P < 0.05) than uninjected controls (Fig. 4E). After the application of NE, inhibition of Ca2+ currents was significantly less (P < 0.05) as a result of the near maximal modulation caused by overexpressed Gß{gamma}-subunits. In another group of cells, human Gß1{gamma}2 cDNA was also coinjected to compare with the modulatory effects observed with coexpressed Gß4 subunits. Gß1{gamma}2 has been shown previously to cause both a significant increase in basal facilitation and attenuation of NE-mediated Ca2+ current inhibition (1, 6, 11, 26, 32). The effects of the coexpressed Gß{gamma}-subunits are summarized in Fig. 4E. Compared with uninjected neurons, the three Gß{gamma} combinations caused significant changes in both basal facilitation and NE-mediated Ca2+ current inhibition.

The ability of human Gß4 to form a heterotrimer with G{alpha}oA and G{gamma}2 was also tested in SCG neurons. In this set of experiments G{alpha}oA, Gß4, and G{gamma}2 were coinjected at a ratio (weight) of ~10:1:1, respectively. This approach was taken to obtain an excess of GDP-bound G{alpha}oA that would act as a Gß{gamma} "sink" (11, 14, 27). Figure 4D shows the Ca2+ currents of a neuron coexpressing G{alpha}oAß4{gamma}2. Before NE exposure, both the pre- and postpulse currents exhibited some degree of inactivation and a decrease in basal facilitation compared with uninjected and Gß{gamma}-expressing neurons. This is a result of G{alpha}’s ability to bind endogenous Gß{gamma} and overexpressed Gß4{gamma}2 subunits. Furthermore, the application of NE resulted in a small inhibition of the Ca2+ current. These results are consistent with the ability of G{alpha} to bind released Gß{gamma} following receptor activation (11). Figure 4E is a summary showing that G{alpha}oA overexpression significantly attenuated both the basal facilitation and NE-mediated Ca2+ current inhibition. These data suggest that Gß4, G{gamma}2, and G{alpha}oA are capable of forming a heterotrimer.

{gamma}-subunits interact with GIRK channels leading to activation of GIRK currents. Although rat SCG neurons do not express GIRK channels, they can be heterologously expressed in these cells (4, 25). In this set of experiments, the ability of Gß4{gamma}4 and Gß4{gamma}2 to activate GIRK channels was examined in rat SCG neurons. Figure 5A shows peak GIRK currents as a function of time in a control neuron coexpressing GIRK1 and GIRK4 (GIRK1 and 4) channels. GIRK currents were recorded every 10 s by applying 200-ms voltage ramps from -140 to -40 mV, from a holding potential of -60 mV. Prior to NE exposure, a small discernible GIRK current was observed (Fig. 5A, inset, trace a). On the other hand, exposure to 10 µM NE (solid bar) resulted in GIRK channel activation of ~4.5 nA (inset, trace b). It can be seen that at very hyperpolarized voltages (from -140 to -110 mV), the current has a region of negative slope conductance. This is followed by a decrease in slope conductance at voltages positive to the reversal potential (approximately -80 mV, also see Ref. 25). Figure 5, B and C, shows peak GIRK current amplitude as a function of time in two neurons coexpressing Gß4{gamma}4 and Gß4{gamma}2, respectively. Both cells maintained tonic activation of GIRK currents before NE application (Fig. 5, insets, trace a). Further exposure to NE (solid bars) caused additional GIRK channels to be activated (Fig. 5, insets, trace b). The tonically activated GIRK currents were also tested for their susceptibility to block by external application of Ba2+ (25). When the cells were exposed to 1 mM Ba2+ (solid bars), GIRK currents were blocked (Fig. 5, insets, trace c). Upon Ba2+ removal, GIRK current amplitude returned to control levels. Unlike Gß{gamma}-expressing neurons, the addition of 1 mM Ba2+ to control cells did not lead to an additional block of basal GIRK currents (Fig. 5A, inset c). Figure 5D is a plot summarizing the basal (empty bars) and NE-activated (solid bars) GIRK currents in cells expressing GIRK1 and GIRK4 channels alone and with ß4{gamma}4 or ß4{gamma}2. Expression of GIRK1 and 4 alone did not lead to any significant activation of GIRK channels (0.04 ± 0.02 nA, n = 3). Conversely, both Gß4{gamma}4 and Gß4{gamma}2 led to tonic activation of GIRK channels [2.25 ± 1.07 (n = 6) and 1.01 ± 0.52 nA (n = 5), respectively]. Application of NE resulted in activation of GIRK currents that were comparable in amplitude in all groups of neurons tested (Fig. 5D). Similar findings have been previously reported in SCG neurons expressing mouse Gß4{gamma}4 (17, 25). The data also provide evidence that coexpression of the cloned human Gß4 with either {gamma}4 or {gamma}2 is capable of modulating another effector protein.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 5. Effect of heterologous expression of Gß4{gamma}2 and Gß4{gamma}4 on G protein-gated inwardly rectifying K+ (GIRK) channel activation. Time course of basal and NE-activated GIRK channel currents in control (GIRK1&4 only) (A), GIRK1&4 + ß4{gamma}4- (B), and GIRK1&4 + ß4{gamma}2-expressing neurons (C). Currents were recorded every 10 s by applying 200-ms voltage ramps from -140 to -40 mV from a holding potential of -60 mV (see insets). Filled bars indicate application of 10 µM NE or 1 mM Ba2+. Insets: current traces obtained before (trace a) and after application of NE (trace b) or Ba2+ (trace c). Dashed lines refer to the zero current level. D: summary graph showing the means ± SE of basal and NE-activated peak GIRK currents recorded before and after NE application. Numbers in parentheses indicate the number of experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Heterotrimeric G proteins (G{alpha}ß{gamma}) are an integral component in signal transduction pathways involving membrane receptors and intracellular effectors. Cloning studies have thus far identified 5 mammalian Gß-subunits and 11 G{gamma}-subunits (31). Of the five Gß proteins described, the only Gß4 clone available has been isolated from the mouse (1, 29). We now report the nucleotide (Fig. 1) and peptide (Fig. 2) sequences of human Gß4. The Gß4 amino acid sequence exhibits the characteristic features of Gß-subunits. The crystal structure of the rod cell’s heterotrimer G{alpha}trß1{gamma}1 revealed that the Gß1-subunit is arranged like a seven-blade propeller structure (16, 28, 30). Each of the "blade" structures, in turn, is made of four antiparallel strands. The Gß4 peptide sequence in Fig. 1 illustrates the 28 antiparallel strands (arrows). Similar to Gß1, the sequence contains seven WD-repeat motifs (highlighted in gray shading) that are ~40 amino acids in length (16, 28, 30). The WD motif normally terminates each repeat.

The sequence alignment analysis of the Gß sequences revealed that Gß4 had the highest homology to both human Gß1 (91%) and mouse Gß4 (96%). The comparison also showed there were five residues that were least conserved (Fig. 2). Recent studies have employed mutational analysis to examine the molecular basis for interactions of {gamma} and several effectors and G{alpha}-subunits (5, 19, 24). None of these five residues were reported to have an effect. Thus the significance of the differences observed with these residues remains to be determined.

Since the submission of our sequence to GenBank, two mRNA sequences have been deposited (BC000873, AK001890) with ORFs identical to ours. These recently submitted Gß4 mRNA sequences support our findings with respect to the nucleotide and derived amino acid sequence of the human Gß4 subunit.

The aligned mouse sequence was cloned in our laboratory (amplified from IMAGE clone 457406; accession no. A1323322). Our mouse Gß4 clone was different from two previously deposited GenBank sequences, i.e., M63658 and M87286. Compared with our mouse clone, there were 11 and 8 nucleotide mismatches, respectively. These differences resulted in several mismatches on the amino acid level including D132N, A140P, and G238V (see Fig. 2). Furthermore, a newly deposited mouse Gß4 clone (accession no. AF277893) was in close agreement with our clone with the exception of the conserved mutation G238V. G238V results from a change of G->T at base number 713 in the middle position of codon 238. Further comparison also showed the presence of three silent mutations in our mouse clone with respect to the AF277893 clone. To verify these deviations, further comparisons with other mouse ESTs that have been identified as Gß4 need to be examined.

Tissue distribution results showed a high expression of Gß4 mRNA in the pancreas and lung (Fig. 3A). An unexpected result, however, was the low expression of Gß4 in brain tissue, given that Gß1–ß5 are found in the nervous system of the rat (20). Inconsistent loading of samples can be ruled out due to the parallel controls employed with G3PDH (Fig. 3B). The assay employed in this set of experiments probes for the presence of mRNA and not protein. Furthermore, it is not unlikely to obtain differences between mRNA levels and protein expression within the same tissue. Indeed, the distribution of Gß1–ß5 in rat brain has been determined with both in situ hybridization (2) and immunohistochemical techniques (20) by the same laboratory. In the former study the presence of Gß4 mRNA was lacking in several regions of the brain. On the other hand, high levels of Gß4 were detected in the same regions with the immunohistochemical approach. The functional significance of this Gß localization remains to be elucidated.

With regard to effector modulation, Gß4 and G{gamma}2 or G{gamma}4 cDNA were microinjected in rat SCG neurons, and N-type Ca2+ channel modulation was examined. Coexpression of either Gß4{gamma}2 or Gß4{gamma}4 resulted in tonic inhibition of N-type Ca2+ currents that was significantly greater than control cells (Fig. 4). In addition, high basal facilitation was observed in Gß1{gamma}2-expressing cells, a combination well known to basally inhibit Ca2+ channel currents (1, 11, 26, 32). Given the high homology between both Gß4 and Gß1, the lack of Gß{gamma} specificity was not surprising. However, previously we have shown that the heterologously expressed mouse Gß4{gamma}4 combination produced an unusually large basal facilitation compared with Gß1–ß3 and Gß5, paired with G{gamma}1–{gamma}4 (26). In both of these studies, the amount of cDNA injected was 10 ng/µl. Thus it appears that both the G{gamma}-subtype and species contribute to the modulatory potency of a given Gß{gamma} dimer. Other reports have also failed to find effector (i.e., N-type Ca2+ channels) specificity with mouse Gß4{gamma}2 and Gß1{gamma}2 (1, 32). Both dimer combinations have also been shown to activate, with equal efficacy, phospholipase C-ß2 and C-ß3, and adenylyl cyclase type I (23), and adenylyl cyclase type II (9). The latter study did find that the heterotrimer combination G{alpha}oAß4{gamma}4 caused a higher nucleotide exchange with the M2 muscarinic receptor than G{alpha}oAß1{gamma}2. This suggests that specificity between Gß-subunits may reside at the receptor level.

Whether Gß4 could form a heterotrimer with G{gamma}2 and G{alpha}oA was also determined in the present study. By overexpressing higher amounts of G{alpha}oA than Gß4{gamma}2, the GDP-bound G{alpha}-subunit should exhibit a higher affinity for Gß{gamma} (27). The result was an occlusion of Gß{gamma}-mediated effects. Figure 4D shows that the NE-mediated inhibition of Ca2+ currents was significantly decreased in neurons expressing G{alpha}oAß4{gamma}2. Moreover, the basal facilitation observed was significantly decreased. These results are consistent with G{alpha}oA subunit behaving as a Gß{gamma} "sink." Thus the expressed human Gß4 clone is capable of forming a heterotrimer with both of these subunits. A similar approach employing a Gß{gamma} "sink" with GIRK channels and phospholipase C-ß has been reported (13, 15, 19).

GIRK channels are effectors that are differentially regulated, contingent on the G{alpha} protein subtype that is coupled to the receptor. When the receptor is coupled to pertussis toxin (PTX)-sensitive G proteins (G{alpha}i/G{alpha}o) or cholera toxin-sensitive G proteins (G{alpha}s), the released Gß{gamma} dimer causes GIRK channel activation (21, 25). It has recently been reported that GIRK channels are inhibited when receptors are coupled to PTX-insensitive G{alpha}q/11 subunits (19). The inhibition of GIRK currents is also coupled to phospholipase C activation. In the present study, receptor activation was bypassed by heterologously coexpressing Gß4{gamma}2 or Gß4{gamma}4. Under these conditions, both expressed dimers caused a tonic activation of GIRK currents that were Ba2+ sensitive (Fig. 5). As with N-type Ca2+ channels, coupling specificity between Gß1–ß4 with several G{gamma}-subunits and GIRK channels is lacking (17, 26).

In summary, this is the first report describing the human Gß4 subunit. Gß4 was characterized by employing a combination of molecular, biochemical, and electrophysiological techniques. Human Gß4 exhibited high homology to Gß1–ß3 and mouse Gß4. Furthermore, the clone appeared to be expressed in several tissues. Functional studies also showed that the heterologously expressed Gß4{gamma}2 or Gß4{gamma}4 dimers were capable of modulating two effectors (Ca2+ and GIRK channels), indistinguishable from Gß1{gamma}2. Finally, heterotrimer formation was observed with G{alpha}oA, Gß4, and G{gamma}2.


    ACKNOWLEDGMENTS
 
We thank Linda Olmstead for excellent technical assistance and Dr. D. E. Logothetis (Mount Sinai School of Medicine, New York, NY) for GIRK1 and GIRK4 cDNA clones.

This work was supported by National Institutes of Health Grants GM-56180 (to S. R. Ikeda) and MH-12288 to (V. Ruiz-Velasco).


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: H. L. Puhl, cDNA Resource Center, One Guthrie Square, Guthrie Research Institute, Sayre, PA 18840 (E-mail: hpuhl{at}inet.guthrie.org).

10.1152/physiolgenomics.00085.2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Arnot MI, Stotz SC, Jarvis SE, and Zamponi GW. Differential modulation of N-type {alpha}1B and P/Q-type {alpha}1A calcium channels by different G protein ß subunit isoforms. J Physiol (Lond) 527: 203–212, 2000.
  2. Betty M, Harnish SW, Rhodes KJ, and Cockett MI. Distribution of heterotrimeric G-protein ß and {gamma} subunits in the rat brain. Neuroscience 85: 475–486, 1998.
  3. Clapham DE and Neer EJ. G protein ß{gamma} subunits. Annu Rev Pharmacol Toxicol 37: 167–203, 1997.
  4. Fernandez-Fernandez JM, Wanaverbecq N, Halley P, Caulfield MP, and Brown DA. Selective activation of heterologously expressed G protein-gated K+ channels by M2 muscarinic receptors in rat sympathetic neurons. J Physiol (Lond) 515: 631–637, 1999.
  5. Ford CE, Skiba NP, Bae H, Daaka Y, Reuveny E, Shekter LR, Rosal R, Weng G, Yang CS, Iyengar R, Miller RJ, Jan LY, Lefkowitz RJ, and Hamm HE. Molecular basis for interactions of G protein ß{gamma} subunits with effectors. Science 280: 1271–1274, 1998.
  6. Garcia DE, Li B, Garcia-Ferreiro RE, Hernandez-Ochoa EO, Yan K, Gautam N, Catterall WA, Mackie K, and Hille B. G-protein ß-subunit specificity in the fast membrane-delimited inhibition of Ca2+ channels. J Neurosci 18: 9163–9170, 1998.
  7. Herlitze S, Garcia DE, Mackie K, Hille B, Scheurer T, and Catterall WA. Modulation of Ca2+ channels by G-protein ß{gamma} subunits. Nature 380: 258–262, 1996.
  8. Hille B. Modulation of ion-channel function by G-protein-coupled receptors. Trends Neurosci 17: 531–536, 1994.
  9. Hou Y, Chang V, Capper AB, Taussig R, and Gautam N. G protein ß subunit types differentially interact with a muscarinic receptor but not adenylyl cyclase type II or phospholipase C-ß2/ß3. J Biol Chem 276: 19982–19988, 2001.
  10. Ikeda SR. Double-pulse calcium channel current facilitation in adult rat sympathetic neurones. J Physiol (Lond) 439: 181–214, 1991.
  11. Ikeda SR. Voltage-dependent modulation of N-type calcium channels by G-protein ß{gamma} subunits. Nature 380: 255–258, 1996.
  12. Ikeda SR and Dunlap K. Voltage-dependent modulation of N-type calcium channels: role of G protein subunits. Adv Second Messenger Phosphoprotein Res 33: 131–151, 1999.
  13. Ito H, Tung RT, Sugimoto T, Kobayashi I, Takahashi K, Katada T, Ut M, and Kurachi Y. On the mechanism of G protein ß{gamma} subunit activation of the muscarinic K+ channel in guinea pig atrial cell membrane. J Gen Physiol 99: 961–983, 1992.
  14. Jeong SW and Ikeda SR. Sequestration of G-protein ß{gamma} subunits by different G-protein {alpha} subunits blocks voltage-dependent modulation of Ca2+ channels in rat sympathetic neurons. J Neurosci 19: 4755–4761, 1999.
  15. Katz A, Wu D, and Simon MI. Subunits ß{gamma} of heterotrimeric G proteins activate ß2 isoform of phospholipase C. Nature 360: 686–689, 1992.
  16. Lambright DG, Sondek J, Bohm A, Skiba NP, Hamm HE, and Sigler PB. The 2.0 Å crystal structure of a heterotrimeric G protein. Nature 379: 311–319, 1996.
  17. Lei Q, Jones MB, Talley EM, Schrier AD, McIntire WE, Garrison JC, and Bayliss DA. Activation and inhibition of G protein-coupled inwardly rectifying potassium (Kir3) channels by G protein ß{gamma} subunits. Proc Natl Acad Sci USA 97: 9771–9776, 2000.
  18. Lei Q, Talley EM, and Bayliss DA. Receptor-mediated inhibition of G protein-coupled inwardly rectifying potassium channels involves G{alpha}q family subunits, phospholipase C, and a readily diffusible messenger. J Biol Chem 276: 16720–16730, 2001.
  19. Li Y, Sternweis PM, Charnecki S, Smith TF, Gilman AG, Neer EJ, and Kozasa T. Sites for G{alpha} binding on the G protein ß subunit overlap with sites for regulation of phospholipase Cß, and adenylyl cyclase. J Biol Chem 273: 16265–16272, 1998.
  20. Liang JJ, Cockett M, and Khawaja XZ. Immunohistochemical localization of G protein ß1, ß2, ß3, ß4, ß5, and {gamma}3 subunits in the adult rat brain. J Neurochem 71: 345–355, 1998.
  21. Lim NF, Dascal N, Labarca C, Davidson N, and Lester HA. A G protein-gated K channel is activated via ß2-adrenergic receptors and Gß{gamma} subunits in Xenopus oocytes. J Gen Physiol 105: 421–439, 1995.
  22. Logothetis DE, Kurachi Y, Galper J, Neer EJ, and Clapham DE. The ß{gamma} subunits of GTP-binding proteins activate the muscarinic K+ channel in heart. Nature 325: 321–326, 1987.
  23. McIntyre WE, MacCleery G, and Garrison JC. The G protein ß subunit is a determinant in the coupling of Gs to the ß1-adrenergic and A2a adenosine receptors. J Biol Chem 276: 15801–15809, 2001.
  24. Panchenko MP, Saxena K, Li Y, Charnecki S, Sternweis PM, Smith TF, Gilman AG, Kozasa T, and Neer EJ. Sites important for PLCß2 activation by the G protein ß{gamma} subunit map to the sides of the ß propeller structure. J Biol Chem 273: 28298–28304, 1998.
  25. Ruiz-Velasco V and Ikeda SR. Heterologous expression and coupling of G protein-gated inwardly rectifying K+ channels in rat sympathetic neurons. J Physiol (Lond) 513: 761–773, 1998.
  26. Ruiz-Velasco V and Ikeda SR. Multiple G-protein ß{gamma} combinations produce voltage-dependent inhibition of N-type calcium channels in rat superior cervical ganglion neurons. J Neurosci 20: 2183–2191, 2000.
  27. Slepak VZ, Katz A, and Simon MI. Functional analysis of a dominant negative mutant of G{alpha}i2. J Biol Chem 270: 4037–4041, 1995.
  28. Sondek J, Bohm A, Lambright DG, Hamm HE, and Sigler PB. Crystal structure of a G-protein ß{gamma} dimer at 2.1A resolution. Nature 379: 369–374, 1996.
  29. Von Weizsaecker E, Strathmann MP, and Simon MI. Diversity among the beta subunits of heterotrimeric GTP-binding proteins: characterization of a novel ß-subunit cDNA. Biochem Biophys Res Commun 183: 350–356, 1992.
  30. Wall MA, Coleman DE, Lee E, Iniguez-Lluhi JA, Posner BA, Gilman AG, and Sprang SR. The structure of the G protein heterotrimer Gi{alpha}1ß1{gamma}2. Cell 83: 1047–1058, 1995.
  31. Watson S and Arkinstall S. The G-protein Linked Receptor Facts Book. San Diego: Academic, 1994, p. 350–355.
  32. Zhou JY, Siderovski DP, and Miller RJ. Selective regulation of N-type Ca channels by different combinations of G-protein ß{gamma} subunits and RGS proteins. J Neurosci 20: 7143–7148, 2000.



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. M. Krumins and A. G. Gilman
Targeted Knockdown of G Protein Subunits Selectively Prevents Receptor-mediated Modulation of Effectors and Reveals Complex Changes in Non-targeted Signaling Proteins
J. Biol. Chem., April 14, 2006; 281(15): 10250 - 10262.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
V. Ruiz-Velasco and S. R. Ikeda
A splice variant of the G protein {beta}3-subunit implicated in disease states does not modulate ion channels
Physiol Genomics, April 16, 2003; 13(2): 85 - 95.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
8/1/41    most recent
00085.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by RUIZ-VELASCO, V.
Right arrow Articles by PUHL, H. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by RUIZ-VELASCO, V.
Right arrow Articles by PUHL, H. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online