|
|
||||||||
1 Laboratory of Molecular Physiology
2 cDNA Resource Center, Guthrie Research Institute, Sayre, Pennsylvania 18840
| ABSTRACT |
|---|
|
|
|---|
ß
) play an essential role in coupling membrane receptors to effector proteins such as ion channels and enzymes. Among the five mammalian Gß-subunits cloned, the human G protein ß4 has not been described. The purpose of the present study was to functionally characterize the newly identified human Gß4 subunit. The Gß4 open reading frame (ORF) was amplified utilizing PCR from brain cDNA. Amplification primers were generated following 5' rapid amplification of cDNA ends (5'-RACE) from an expressed sequence tag (EST) containing the predicted 3' end of the protein. Multiple tissue cDNA panel analysis showed that Gß4 mRNA was strongly expressed in lung and placenta, whereas it is weakly expressed in brain and heart. Heterologous overexpression of Gß4
2 or Gß4
4 in rat sympathetic neurons resulted in tonic modulation of N-type voltage-gated Ca2+ and G protein-gated inwardly rectifying K+ currents. Furthermore, coexpression of Gß4
2 and G
oA resulted in heterotrimer formation. These results show that the newly cloned Gß4 subunit shares several properties with other human Gß family members. G protein ß4; signal transduction; ion channel modulation
| INTRODUCTION |
|---|
|
|
|---|
ß
) function to relay signals (i.e., neurotransmitters, hormones, light, and odors) from surface receptors to effectors. Receptor activation causes a conformational change in the G protein
-subunit, which leads to an exchange of GDP for GTP. This results in the dissociation of the GTP-bound
from the Gß
dimer. Both the G
- and Gß
-subunits subsequently regulate downstream effectors, such as ion channels and enzymes. Hydrolysis of GTP on the G
-subunit causes the reassociation of Gß
and GDP-bound G
.
The crystal structure of the G
ß
heterotrimer has shown that Gß is composed of an NH2 terminus that is 20 amino acids long and forms an
-helix, and a toroidal structure that is made up of seven repeating units (16, 28, 30). Each of these units is made up of four antiparallel ß-strands and is known as a WD repeat. The seven WD units are arranged in a ring and form a propeller structure. The G
-subunit is prenylated at the COOH terminus, whereas the NH2 terminus makes a coiled-coil interaction with the Gß
-helical structure. In addition, G
contacts Gß along blades 5, 6, and 7. G
contacts Gß in two regions. The first contact is between the first blade of the Gß-subunit and the amino terminal helix of G
. The second contact occurs between the G
region (switch II) that changes conformation between GDP- and GTP-bound forms and the "top" surface of the Gß-subunit (16, 28, 30).
Cloning studies in mammals have thus far identified 18 G
-, 5 Gß-, and 12 G
-subunits (31). Thus several hundred potential heterotrimeric combinations are likely. However, given the tissue-specific expression of some of these subunits, the number of combinations that are formed is decreased. Gß1ß4 subunits share a sequence homology that is greater than 80%, whereas Gß5 is the least homologous (
53%) to the four subunits (3, 31). Furthermore, functional studies have shown that Gß1ß4 coexpressed with several G
-subunits are capable of modulating effectors such as N- and P/Q-type Ca2+ channels (1, 7, 11, 26, 32, but see Ref. 6), G protein-gated inwardly rectifying K+ (GIRK) channels (17, 22), adenylyl cyclase type II (9), and phospholipase C-ß2/3 (9, 23). These reports have shown minor differences in regard to modulatory specificity among the four Gß-subunits and effectors. Of the five Gß-subunits identified, the genomic and functional characteristics of the human Gß4 subunit are unknown. To date the only Gß4 clone studied has been obtained from mouse (1, 29). Therefore, the purpose of the present study was to identify and functionally characterize the human Gß4 ortholog. The hypothesis to be tested is that the heterologous expression of Gß4 with G
-subunits results in effector interaction and heterotrimer formation. To our knowledge, this is the first report describing the cloning of human Gß4, as well as the modulation of N-type Ca2+ and GIRK channels by this subunit.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The Gß4 ORF from Marathon Ready human whole brain cDNA was amplified by designing primers based on both the EST sequence and 5'-RACE products. The primers for the 3' and 5' ends were GATC
TTAATTCCAGATTCTAAGAAAACTGTC (XhoI site is underscored) and GATC
ACCATGAGCGAACTGGAACAGTTGAGG (BamHI site is underscored), respectively. The PCR reaction was performed with Pfu Turbo polymerase (Stratagene, La Jolla, CA) in the model 480 Thermal Cycler using a three-step cycling protocol as follows: denaturation for 50 s at 95°C, elongation for 50 s at 55°C, and annealing for 2 min at 72°C for 35 cycles. The amplified fragment was cut with BamHI and XhoI and ligated into the pcDNA3.1 vector (Invitrogen). Clones were screened by restriction analysis following plasmid isolation. To avoid polymerase-induced PCR errors, nine positive clones were sequenced and analyzed as described above. A single clone containing the consensus sequence was used in subsequent experiments. In preliminary experiments, the heterologous expression of Gß4 in neurons with the pcDNA 3.1 vector was inconsistent. Thus both Gß4 and Gß1 were subcloned into the NheI and XbaI sites of the pCI expression vector (Promega). This vector utilizes the cytomegalovirus (CMV) promoter to drive expression of cloned inserts. The Gß4 and Gß1 expression constructs were sequenced and found to be identical with the consensus sequence described above for the former and the sequence provided by the supplier (Guthrie cDNA Resource Center, Sayre, PA) for the latter. The assembled coding sequence was deposited into the GenBank (accession no. AF300648).
Multiple tissue cDNA panel screening.
The following primers were used to screen a Multiple Tissue cDNA (MTC, Clontech Laboratories) panel: probe for 3'-UTR GCTATAGGCTGTAGCATTGATTTCTCC and probe for 571596 GACCACCACATTCACTGGGCATTCTG. A preliminary amplification yielded a 558-bp product from brain cDNA, which was subcloned into the pGEM T-Easy vector (Promega). The size of the clones was screened by restriction analysis following plasmid isolation with the Wizard Plus SV Miniprep System and sequenced as described above to ensure specificity. Screening of the MTC panel (Clontech Laboratories) was done according to the manufacturer. Briefly, separate PCR reactions were assembled containing cDNA from the following human tissues: brain, heart, kidney, liver, lung, pancreas, placenta, and skeletal muscle. Two sets of reactions were performed per cDNA source, one with the probe primers and a second set with the control glyceraldehyde-3-phosphate dehydrogenase (G3PDH) primers [5' (upstream) primer: TGAAGGTCGGAGTCAACGGATTTGGT and 3' (downstream) primer: CATGTGGGCCATGAGGTCCACCAC]. Negative controls (no cDNA) were performed with both G3PDH- and Gß4-specific primers. A positive control for the G3PDH primer set was provided by the manufacturer. All PCR reactions were performed with Titanium Taq DNA polymerase (Clontech Laboratories) in the model 480 thermal cycler using the following two-step protocol: 30 s at 94°C, followed by 35 cycles of 30 s at 94°C and 2 min at 68°C, with a final extension of 5 min at 68°C. Gel analysis was performed with aliquots removed at cycles 22 and 30. Amplification products were run on a 1.0% agarose gel, stained with ethidium bromide, and visualized with a Kodak model DC290 digital camera.
Neuron isolation.
Adult rat superior cervical ganglion (SCG) neurons were prepared using methods previously described (26). The experiments carried out were approved by Institutional Animal Care and Use Committee (IACUC). Briefly, male Wistar rats (175225 g) were anesthetized with CO2 prior to decapitation with a laboratory guillotine. The ganglia were dissected in chilled Hanks balanced salt solution and then incubated with 0.6 mg/ml collagenase type D (Boehringer-Mannheim, Indianapolis, IN), 0.4 mg/ml trypsin (TRL type; Worthington Biochemical, Lakewood, NJ), and 0.1 mg/ml DNase type I (Sigma Chemical, St. Louis, MO) for 60 min at 36 ± 1°C. Following incubation, the dispersed neurons were centrifuged twice for 6 min at 50 g and then resuspended in minimal essential medium (MEM; Mediatech, Herndon, VA) supplemented with 10% fetal calf serum (Atlanta Biologicals, Atlanta, GA), 1% glutamine, and 1% penicillin-streptomycin solution (Mediatech). The neurons were then plated into 35-mm tissue culture plates coated with poly-L-lysine and placed in a humidified incubator containing 5% CO2 in air at 37°C.
Plasmid microinjection was performed with an Eppendorf model 5246 microinjector and model 5171 micromanipulator (Madison, WI)
35 h after plating. Plasmids coding for human Gß1, Gß4, G
2, and G
4 (Guthrie cDNA Resource Center) were injected at a final concentration of 10 ng/µl; plasmids coding for human G
oA (Guthrie cDNA Resource Center) and human Kir 3.1 and 3.4 (GIRK1 and GIRK4, respectively) were injected at a final concentration of 100 ng/µl. The plasmid coding for the jellyfish green fluorescent protein (pEGFP-N1, 5 ng/µl; Clontech Laboratories) was coinjected with the plasmids and served as a "marker" for cells receiving a successful injection. Neurons were identified 1218 h later using an inverted microscope (Diaphot 300; Nikon) equipped with an epifluorescence unit (DM510 filter cube; Nikon).
Electrophysiology and data analysis.
Ca2+ and GIRK currents were recorded using the whole-cell variant of the patch-clamp technique. Patch pipettes were pulled from borosilicate glass capillaries (Corning 7052; Garner Glass, Claremont, CA) on a Flaming-Brown (model P-97) micropipette puller (Sutter Instrument, San Rafael, CA), coated with Sylgard (Dow Corning, Midland, MI) and fire polished. Whole-cell currents were acquired with a patch-clamp amplifier (Axopatch 1-C; Axon Instruments, Foster City, CA), analog filtered at 510 kHz (-3 dB; 4-pole Bessel) and digitized using custom designed software (S4) on a Power PC computer (Power Computing, Austin, TX) equipped with a 16-bit analog-to-digital converter board (model ITC16; Instrutech, Elmont, NY). Cell membrane capacitance and series resistance (8085%) were electronically compensated. Experiments were performed at room temperature (2124°C). Data and statistical analysis were performed with Igor (Lake Oswego, OR) and GB-Stat PPC (Silver Spring, MD) software packages, respectively, employing one-way ANOVA followed by the Newman-Keuls test. P < 0.05 was considered statistically significant. Graphs and current traces were produced with Igor and Canvas (Deneba Software, Miami, FL) software packages.
Basal facilitation [i.e., prior to norepinephrine (NE) application] was calculated as the ratio of Ca2+ current (ICa) amplitude determined from the test pulse (+10 mV) occurring after (postpulse) to the test pulse (+10 mV) occurring before (prepulse) the +80 mV conditioning pulse (see Fig. 4D). ICa amplitude was measured isochronally 10 ms after initiation of each test pulse. The NE-mediated inhibition was calculated as follows: [ICa(prepulse before NE) - ICa(prepulse after NE)]/[ICa(prepulse before NE)] x 100. GIRK currents were recorded every 10 s by applying a 200-ms voltage ramp from -140 to -40 mV from a holding potential of -60 mV. Basal and NE-stimulated peak GIRK currents were calculated by digitally subtracting current traces obtained before and after NE exposure, respectively, from those obtained after application of 1 mM Ba2+. Maximal inward GIRK currents were measured between -135 and -125 mV.
|
Stock solution (10 mM) of NE bitartrate (Sigma Chemical) was prepared in H2O and diluted in the external solution to 10 µM just prior to use. NE application to the neuron under study was performed by positioning a custom-designed gravity-fed microperfusion system
100 µm from the cell.
| RESULTS |
|---|
|
|
|---|
|
|
|
2-adrenergic receptors, which leads to kinetic slowing of Ca2+ currents. Kinetic slowing is thought to arise from a VD relief of block during the application of a depolarizing test pulse. The neurotransmitter-induced VD inhibition of N-type Ca2+ channels is mediated by Gß
(7, 11; for review see Ref. 12). Another consequence of VD relief of inhibition is a phenomenon referred to as facilitation. Facilitation is determined by evoking Ca2+ currents with two identical test pulses (usually to +10 mV) separated by a large depolarizing conditioning pulse (+80 mV) (10). The ratio of the postpulse to prepulse current amplitude (measured isochronally at 10 ms after the start of the test pulse) is termed facilitation. Figure 4A shows superimposed Ca2+ currents evoked with a double-pulse voltage protocol (Fig. 4D, bottom) in an uninjected neuron before (bottom trace) and after (top trace) exposure to 10 µM NE. Prior to NE application, the ICa rose rapidly to a peak and reached a plateau within 510 ms after the onset of the test pulse. On the other hand, exposure of the neuron to NE caused the rising phase of the ICa to be slow and biphasic. Figure 4A also shows that prior to NE application the postpulse current amplitude was affected minimally by the conditioning pulse (to +80 mV). On the other hand, in the presence of NE, the postpulse current amplitude was much greater than the prepulse current amplitude. This is a result of VD relief of inhibition during the test pulse. In uninjected neurons, the mean basal facilitation (i.e., in the absence of NE) was 1.43 ± 0.05 (n = 16), and the NE-mediated inhibition was 66.2 ± 1.5% (Fig. 4E).
Figure 4, B and C, shows the Ca2+ currents recorded from neurons coinjected with Gß4
4 and Gß4
2 cDNA (10 ng/µl per subunit). Before addition of NE to the external bath, the Ca2+ currents showed extreme kinetic slowing that was similar to that produced by NE in uninjected neurons. The basal facilitation in Gß4
4- and Gß4
2-expressing neurons was significantly greater (P < 0.05) than uninjected controls (Fig. 4E). After the application of NE, inhibition of Ca2+ currents was significantly less (P < 0.05) as a result of the near maximal modulation caused by overexpressed Gß
-subunits. In another group of cells, human Gß1
2 cDNA was also coinjected to compare with the modulatory effects observed with coexpressed Gß4 subunits. Gß1
2 has been shown previously to cause both a significant increase in basal facilitation and attenuation of NE-mediated Ca2+ current inhibition (1, 6, 11, 26, 32). The effects of the coexpressed Gß
-subunits are summarized in Fig. 4E. Compared with uninjected neurons, the three Gß
combinations caused significant changes in both basal facilitation and NE-mediated Ca2+ current inhibition.
The ability of human Gß4 to form a heterotrimer with G
oA and G
2 was also tested in SCG neurons. In this set of experiments G
oA, Gß4, and G
2 were coinjected at a ratio (weight) of
10:1:1, respectively. This approach was taken to obtain an excess of GDP-bound G
oA that would act as a Gß
"sink" (11, 14, 27). Figure 4D shows the Ca2+ currents of a neuron coexpressing G
oAß4
2. Before NE exposure, both the pre- and postpulse currents exhibited some degree of inactivation and a decrease in basal facilitation compared with uninjected and Gß
-expressing neurons. This is a result of G
s ability to bind endogenous Gß
and overexpressed Gß4
2 subunits. Furthermore, the application of NE resulted in a small inhibition of the Ca2+ current. These results are consistent with the ability of G
to bind released Gß
following receptor activation (11). Figure 4E is a summary showing that G
oA overexpression significantly attenuated both the basal facilitation and NE-mediated Ca2+ current inhibition. These data suggest that Gß4, G
2, and G
oA are capable of forming a heterotrimer.
Gß
-subunits interact with GIRK channels leading to activation of GIRK currents. Although rat SCG neurons do not express GIRK channels, they can be heterologously expressed in these cells (4, 25). In this set of experiments, the ability of Gß4
4 and Gß4
2 to activate GIRK channels was examined in rat SCG neurons. Figure 5A shows peak GIRK currents as a function of time in a control neuron coexpressing GIRK1 and GIRK4 (GIRK1 and 4) channels. GIRK currents were recorded every 10 s by applying 200-ms voltage ramps from -140 to -40 mV, from a holding potential of -60 mV. Prior to NE exposure, a small discernible GIRK current was observed (Fig. 5A, inset, trace a). On the other hand, exposure to 10 µM NE (solid bar) resulted in GIRK channel activation of
4.5 nA (inset, trace b). It can be seen that at very hyperpolarized voltages (from -140 to -110 mV), the current has a region of negative slope conductance. This is followed by a decrease in slope conductance at voltages positive to the reversal potential (approximately -80 mV, also see Ref. 25). Figure 5, B and C, shows peak GIRK current amplitude as a function of time in two neurons coexpressing Gß4
4 and Gß4
2, respectively. Both cells maintained tonic activation of GIRK currents before NE application (Fig. 5, insets, trace a). Further exposure to NE (solid bars) caused additional GIRK channels to be activated (Fig. 5, insets, trace b). The tonically activated GIRK currents were also tested for their susceptibility to block by external application of Ba2+ (25). When the cells were exposed to 1 mM Ba2+ (solid bars), GIRK currents were blocked (Fig. 5, insets, trace c). Upon Ba2+ removal, GIRK current amplitude returned to control levels. Unlike Gß
-expressing neurons, the addition of 1 mM Ba2+ to control cells did not lead to an additional block of basal GIRK currents (Fig. 5A, inset c). Figure 5D is a plot summarizing the basal (empty bars) and NE-activated (solid bars) GIRK currents in cells expressing GIRK1 and GIRK4 channels alone and with ß4
4 or ß4
2. Expression of GIRK1 and 4 alone did not lead to any significant activation of GIRK channels (0.04 ± 0.02 nA, n = 3). Conversely, both Gß4
4 and Gß4
2 led to tonic activation of GIRK channels [2.25 ± 1.07 (n = 6) and 1.01 ± 0.52 nA (n = 5), respectively]. Application of NE resulted in activation of GIRK currents that were comparable in amplitude in all groups of neurons tested (Fig. 5D). Similar findings have been previously reported in SCG neurons expressing mouse Gß4
4 (17, 25). The data also provide evidence that coexpression of the cloned human Gß4 with either
4 or
2 is capable of modulating another effector protein.
|
| DISCUSSION |
|---|
|
|
|---|
ß
) are an integral component in signal transduction pathways involving membrane receptors and intracellular effectors. Cloning studies have thus far identified 5 mammalian Gß-subunits and 11 G
-subunits (31). Of the five Gß proteins described, the only Gß4 clone available has been isolated from the mouse (1, 29). We now report the nucleotide (Fig. 1) and peptide (Fig. 2) sequences of human Gß4. The Gß4 amino acid sequence exhibits the characteristic features of Gß-subunits. The crystal structure of the rod cells heterotrimer G
trß1
1 revealed that the Gß1-subunit is arranged like a seven-blade propeller structure (16, 28, 30). Each of the "blade" structures, in turn, is made of four antiparallel strands. The Gß4 peptide sequence in Fig. 1 illustrates the 28 antiparallel strands (arrows). Similar to Gß1, the sequence contains seven WD-repeat motifs (highlighted in gray shading) that are
40 amino acids in length (16, 28, 30). The WD motif normally terminates each repeat.
The sequence alignment analysis of the Gß sequences revealed that Gß4 had the highest homology to both human Gß1 (91%) and mouse Gß4 (96%). The comparison also showed there were five residues that were least conserved (Fig. 2). Recent studies have employed mutational analysis to examine the molecular basis for interactions of Gß
and several effectors and G
-subunits (5, 19, 24). None of these five residues were reported to have an effect. Thus the significance of the differences observed with these residues remains to be determined.
Since the submission of our sequence to GenBank, two mRNA sequences have been deposited (BC000873, AK001890) with ORFs identical to ours. These recently submitted Gß4 mRNA sequences support our findings with respect to the nucleotide and derived amino acid sequence of the human Gß4 subunit.
The aligned mouse sequence was cloned in our laboratory (amplified from IMAGE clone 457406; accession no. A1323322). Our mouse Gß4 clone was different from two previously deposited GenBank sequences, i.e., M63658 and M87286. Compared with our mouse clone, there were 11 and 8 nucleotide mismatches, respectively. These differences resulted in several mismatches on the amino acid level including D132N, A140P, and G238V (see Fig. 2). Furthermore, a newly deposited mouse Gß4 clone (accession no. AF277893) was in close agreement with our clone with the exception of the conserved mutation G238V. G238V results from a change of G
T at base number 713 in the middle position of codon 238. Further comparison also showed the presence of three silent mutations in our mouse clone with respect to the AF277893 clone. To verify these deviations, further comparisons with other mouse ESTs that have been identified as Gß4 need to be examined.
Tissue distribution results showed a high expression of Gß4 mRNA in the pancreas and lung (Fig. 3A). An unexpected result, however, was the low expression of Gß4 in brain tissue, given that Gß1ß5 are found in the nervous system of the rat (20). Inconsistent loading of samples can be ruled out due to the parallel controls employed with G3PDH (Fig. 3B). The assay employed in this set of experiments probes for the presence of mRNA and not protein. Furthermore, it is not unlikely to obtain differences between mRNA levels and protein expression within the same tissue. Indeed, the distribution of Gß1ß5 in rat brain has been determined with both in situ hybridization (2) and immunohistochemical techniques (20) by the same laboratory. In the former study the presence of Gß4 mRNA was lacking in several regions of the brain. On the other hand, high levels of Gß4 were detected in the same regions with the immunohistochemical approach. The functional significance of this Gß localization remains to be elucidated.
With regard to effector modulation, Gß4 and G
2 or G
4 cDNA were microinjected in rat SCG neurons, and N-type Ca2+ channel modulation was examined. Coexpression of either Gß4
2 or Gß4
4 resulted in tonic inhibition of N-type Ca2+ currents that was significantly greater than control cells (Fig. 4). In addition, high basal facilitation was observed in Gß1
2-expressing cells, a combination well known to basally inhibit Ca2+ channel currents (1, 11, 26, 32). Given the high homology between both Gß4 and Gß1, the lack of Gß
specificity was not surprising. However, previously we have shown that the heterologously expressed mouse Gß4
4 combination produced an unusually large basal facilitation compared with Gß1ß3 and Gß5, paired with G
1
4 (26). In both of these studies, the amount of cDNA injected was 10 ng/µl. Thus it appears that both the G
-subtype and species contribute to the modulatory potency of a given Gß
dimer. Other reports have also failed to find effector (i.e., N-type Ca2+ channels) specificity with mouse Gß4
2 and Gß1
2 (1, 32). Both dimer combinations have also been shown to activate, with equal efficacy, phospholipase C-ß2 and C-ß3, and adenylyl cyclase type I (23), and adenylyl cyclase type II (9). The latter study did find that the heterotrimer combination G
oAß4
4 caused a higher nucleotide exchange with the M2 muscarinic receptor than G
oAß1
2. This suggests that specificity between Gß-subunits may reside at the receptor level.
Whether Gß4 could form a heterotrimer with G
2 and G
oA was also determined in the present study. By overexpressing higher amounts of G
oA than Gß4
2, the GDP-bound G
-subunit should exhibit a higher affinity for Gß
(27). The result was an occlusion of Gß
-mediated effects. Figure 4D shows that the NE-mediated inhibition of Ca2+ currents was significantly decreased in neurons expressing G
oAß4
2. Moreover, the basal facilitation observed was significantly decreased. These results are consistent with G
oA subunit behaving as a Gß
"sink." Thus the expressed human Gß4 clone is capable of forming a heterotrimer with both of these subunits. A similar approach employing a Gß
"sink" with GIRK channels and phospholipase C-ß has been reported (13, 15, 19).
GIRK channels are effectors that are differentially regulated, contingent on the G
protein subtype that is coupled to the receptor. When the receptor is coupled to pertussis toxin (PTX)-sensitive G proteins (G
i/G
o) or cholera toxin-sensitive G proteins (G
s), the released Gß
dimer causes GIRK channel activation (21, 25). It has recently been reported that GIRK channels are inhibited when receptors are coupled to PTX-insensitive G
q/11 subunits (19). The inhibition of GIRK currents is also coupled to phospholipase C activation. In the present study, receptor activation was bypassed by heterologously coexpressing Gß4
2 or Gß4
4. Under these conditions, both expressed dimers caused a tonic activation of GIRK currents that were Ba2+ sensitive (Fig. 5). As with N-type Ca2+ channels, coupling specificity between Gß1ß4 with several G
-subunits and GIRK channels is lacking (17, 26).
In summary, this is the first report describing the human Gß4 subunit. Gß4 was characterized by employing a combination of molecular, biochemical, and electrophysiological techniques. Human Gß4 exhibited high homology to Gß1ß3 and mouse Gß4. Furthermore, the clone appeared to be expressed in several tissues. Functional studies also showed that the heterologously expressed Gß4
2 or Gß4
4 dimers were capable of modulating two effectors (Ca2+ and GIRK channels), indistinguishable from Gß1
2. Finally, heterotrimer formation was observed with G
oA, Gß4, and G
2.
| ACKNOWLEDGMENTS |
|---|
This work was supported by National Institutes of Health Grants GM-56180 (to S. R. Ikeda) and MH-12288 to (V. Ruiz-Velasco).
| FOOTNOTES |
|---|
Address for reprint requests and other correspondence: H. L. Puhl, cDNA Resource Center, One Guthrie Square, Guthrie Research Institute, Sayre, PA 18840 (E-mail: hpuhl{at}inet.guthrie.org).
10.1152/physiolgenomics.00085.2001.
| REFERENCES |
|---|
|
|
|---|
1B and P/Q-type
1A calcium channels by different G protein ß subunit isoforms. J Physiol (Lond) 527: 203212, 2000.
subunits in the rat brain. Neuroscience 85: 475486, 1998.
subunits. Annu Rev Pharmacol Toxicol 37: 167203, 1997.
subunits with effectors. Science 280: 12711274, 1998.
subunits. Nature 380: 258262, 1996.
subunits. Nature 380: 255258, 1996.
subunit activation of the muscarinic K+ channel in guinea pig atrial cell membrane. J Gen Physiol 99: 961983, 1992.
subunits by different G-protein
subunits blocks voltage-dependent modulation of Ca2+ channels in rat sympathetic neurons. J Neurosci 19: 47554761, 1999.
of heterotrimeric G proteins activate ß2 isoform of phospholipase C. Nature 360: 686689, 1992.
subunits. Proc Natl Acad Sci USA 97: 97719776, 2000.
q family subunits, phospholipase C, and a readily diffusible messenger. J Biol Chem 276: 1672016730, 2001.
binding on the G protein ß subunit overlap with sites for regulation of phospholipase Cß, and adenylyl cyclase. J Biol Chem 273: 1626516272, 1998.
3 subunits in the adult rat brain. J Neurochem 71: 345355, 1998.
subunits in Xenopus oocytes. J Gen Physiol 105: 421439, 1995.
subunits of GTP-binding proteins activate the muscarinic K+ channel in heart. Nature 325: 321326, 1987.
subunit map to the sides of the ß propeller structure. J Biol Chem 273: 2829828304, 1998.
combinations produce voltage-dependent inhibition of N-type calcium channels in rat superior cervical ganglion neurons. J Neurosci 20: 21832191, 2000.
i2. J Biol Chem 270: 40374041, 1995.
dimer at 2.1A resolution. Nature 379: 369374, 1996.
1ß1
2. Cell 83: 10471058, 1995.
subunits and RGS proteins. J Neurosci 20: 71437148, 2000.This article has been cited by other articles:
![]() |
A. M. Krumins and A. G. Gilman Targeted Knockdown of G Protein Subunits Selectively Prevents Receptor-mediated Modulation of Effectors and Reveals Complex Changes in Non-targeted Signaling Proteins J. Biol. Chem., April 14, 2006; 281(15): 10250 - 10262. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Ruiz-Velasco and S. R. Ikeda A splice variant of the G protein {beta}3-subunit implicated in disease states does not modulate ion channels Physiol Genomics, April 16, 2003; 13(2): 85 - 95. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |