Physiol. Genomics Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 7: 187-200, 2001; doi:10.1152/physiolgenomics.00046.2001
1094-8341/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by LEE, T. H.
Right arrow Articles by PELLETIER, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by LEE, T. H.
Right arrow Articles by PELLETIER, J.
Received 4 June 2001; accepted in final form 7 November 2001.
Physiological Genomics 7:187-200 (2001)
1094-8341/01 $5.00 © 2001 American Physiological Society

Functional characterization of WT1 binding sites within the human vitamin D receptor gene promoter

TAE HO LEE1 and JERRY PELLETIER1,2

1 Department of Biochemistry
2 McGill Cancer Center, McGill University, Montreal, Quebec, Canada H3G 1Y6


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Wilms’ tumor suppressor gene, wt1, encodes a zinc finger transcription factor that can regulate gene expression. It plays an essential role in tumorigenesis, kidney differentiation, and urogenital development. To identify WT1 downstream targets, gene expression profiling was conducted using a cDNA array hybridization approach. We confirm herein that the human vitamin D receptor (VDR), a ligand-activated transcription factor, is a WT1 downstream target. Nuclear run on experiments demonstrated that the effect of WT1 on VDR expression is at the transcriptional level. Transient transfection assays, deletion mutagenesis, electrophoretic mobility shift assays, and chromatin immunoprecipitation assays suggest that, although WT1 is presented with a possibility of three binding sites within the VDR promoter, activation of the human VDR gene appears to occur through a single site. This site differs from a previously identified WT1-responsive site in the murine VDR promoter (Maurer U, Jehan F, Englert C, Hübinger G, Weidmann E, DeLucas HF, and Bergmann L. J Biol Chem 276: 3727–3732, 2001). We also show that the products of a Denys-Drash syndrome allele of wt1 inhibit WT1-mediated transactivation of the human VDR promoter. Our results indicate that the human VDR gene is a downstream target of WT1 and may be regulated differently than its murine counterpart.

vitamin D receptor; gene regulation; Wilms’ tumor


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
WILMS TUMOR (WT) is a pediatric malignancy of the kidney, occurring mostly in children under the age of 5 yr with an incidence of 1/10,000 (35). It is thought to arise when multipotential cells of the metanephric blastema fail to differentiate and remain locked in a state of continual proliferation. WT has long been considered an excellent model for studying the relationship of cancer to development. The tumors derive from mesenchymal stem cells that would normally differentiate into epithelial components of the nephron and are remarkable in attempting to recapitulate the different stages of nephron development, albeit abnormally. A tumor suppressor gene, wt1, implicated in predisposition to WT has been extensively characterized and is mutated in 10–15% of sporadic WTs (3, 6, 8, 18, 40) and in some hereditary WT cases (31, 32). It also plays a role in initiation of this disease (30).

The WT1 gene spans ~50 kbp of genomic DNA consisting of 10 exons, the last 4 of which encode individual zinc fingers. The WT1 product is a ~50-kDa transcription factor with a proline-glutamine-rich amino terminus and four carboxy-terminal zinc fingers of the Krüppel C2-H2 class. The mRNA contains two alternatively spliced exons (reviewed in Ref. 35). The function of the first alternative splicing event (exon V) has not been well defined, although exon V can repress transcription when fused to a heterologous DNA binding domain (42). Alternative splicing of exon IX inserts or removes three amino acids (+/-KTS) [referred to as WT1(+KTS) or WT1(-KTS)] between zinc fingers III and IV and changes the DNA binding specificity of WT1 (34). The WT1(-KTS) isoforms can bind to two DNA motifs: 1) a GC-rich motif, 5' GXGXGGGXG 3', related to the EGR-1 binding site (34); and 2) a (5' TCC 3')n-containing sequence (44). Recently nuclear magnetic resonance (NMR) relaxation studies have indicated that the KTS insertion increases the flexibility of the linker between fingers III and IV and abrogates binding of the fourth zinc finger to its cognate site in the DNA major groove (14). A role for WT1 in splicing is also postulated based on the subnuclear localization of WT1(+KTS) isoforms and the interaction of these isoforms with a splicing factor (7).

The wt1 gene product has been shown to mediate both transcriptional repression and activation (35). Experiments focusing on transcriptional regulation by WT1 mediated through Egr-1 consensus sites demonstrated that WT1 is capable of repressing transcription and that this effect is mediated by sequences within the amino-terminal domain (NTD) of WT1 (20). However, further characterization of the WT1 transcriptional properties and assessment of activity on putative cellular target genes revealed that WT1 may also activate transcription (43). Transcriptional regulation by WT1 appears complex, and a number of factors are known to influence WT1’s ability to act as a repressor or activator (reviewed in Ref. 35). The transcriptional activity of WT1 can be modulated by interaction with several proteins: 1) the p53 tumor suppressor gene product (22); 2) the Par-4 (prostate apoptosis response-4) protein (10); 3) Ciao-1, a WD40 protein that decreases WT1’s transcriptional activation properties but does not affect its repression activity (11); and 4) Hsp70, which may also play a role in the regulation of WT1 (21). The WT1 isoforms can also self-associate, and the domain required for this maps to the first 182 amino acids of WT1 (28, 36).

Candidate WT1 downstream targets (as determined by responsiveness of core promoter elements to exogenously supplied WT1 in transfection assays) include c-myc, epidermal growth factor receptor (EGFR), insulin-like growth factor-I receptor (IGF-IR), platelet-derived growth factor (PDGF-A), IGF-II, colony-stimulating factor (CSF-1), transforming growth factor-ß1 (TGF-ß1), epidermal growth receptor-1 (EGR1), Pax-2, c-myb, G-protein {alpha}i-2, Ki-ras, insulin receptor, p21, Nov-H, RAR-{alpha}, inhibin-{alpha}, syndecan-1, midkine, Dax-1, E-cadherin, wt1 (see Ref. 35 for a review on many of these targets), amphiregulin (17), bcl-2 (25), connective tissue growth factor (CTGF) (39), and the vitamin D receptor (VDR) (24). The activities of some of these gene products are associated with oncogenic potential (e.g., autocrine and paracrine growth factors), whereas others (e.g., Dax-1) are associated with development of the genital system. However, with the exception of a small number of these putative targets (bcl-2, EGFR, Dax-1, VDR, and amphiregulin), there are no supporting data that the endogenous promoters can be influenced by WT1, and one must regard the majority of these downstream targets with caution until these are better characterized.

In an attempt to identify endogenous WT1 target genes, we performed an expression array screen utilizing human embryonic kidney 293 cell lines expressing WT1 under control of tetracycline regulation. The major gene identified by our screen was the human VDR. During the course of these studies, Maurer et al. (24) identified the murine and human VDR as a downstream target of WT1. However, the WT1 binding site within the murine promoter is not present in the human counterpart. We therefore pursued detailed characterization of the human VDR promoter and found that activation of the human VDR gene is through a GC-rich binding site that significantly differs from the site identified upstream of the murine VDR gene by Maurer et al. (24). In addition, the presence of additional, nonfunctional WT1 binding sites within the VDR promoter suggests the existence of cis-regulatory factors/elements that provide additional selectivity. Our results also indicate that the human VDR gene represents a bona fide downstream target of the Wilms’ tumor suppressor gene and is activated differently than its murine counterpart.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Materials and general methods.
Restriction endonucleases, calf intestinal alkaline phosphatase, the Klenow fragment of DNA polymerase I, T4 DNA ligase, and T4 DNA polymerase were purchased from New England Biolabs. The luciferase assay kit was purchased from Promega. [{gamma}-32P]ATP (6,000 Ci/mmol) and [{alpha}-32P]dCTP (3,000 Ci/mmol) were purchased from New England Nuclear.

Preparation of plasmid DNA, restriction enzyme digestion, agarose gel electrophoresis of DNA, DNA ligation, and bacterial transformations were carried out using standard methods (Ref. 37 and references therein). Subclones of DNA PCR amplifications were always sequenced by the chain termination method using double-stranded DNA templates to ensure the absence of mutations.

Plasmid construction.
A portion of the human VDR promoter was cloned by PCR amplification from genomic DNA. The amplification primers used for this purpose were 1) 5'-th94 (5' GTTACTGCTGG-ATGATTTTGTGAGC 3'; XhoI site underscored) and 2) 3'-th95 (5' GTTAAGA-CAGCCCAGCACCTGGCCC 3'; HindIII site underscored). The PCR product was digested with XhoI and HindIII and cloned into the same sites of the luciferase expression vector pGL-3 basic (Promega) to generate -960 phVDR/Luc.

Deletion constructs of the VDR promoter were prepared as follows. 1) For -436 phVDR/Luc, the corresponding fragment of the VDR promoter was generated by PCR using primers 5'-th96 (5' GTTACCGCCGGTGCCAGTCGCAGCG 3'; XhoI site underscored) and 3'-th95. The PCR product was digested with XhoI and HindIII, and introduced into the same sites of the luciferase expression vector pGL-3 basic. 2) For -354 phVDR/Luc, the corresponding fragment of the VDR promoter was generated by PCR using primers 5'-th97 (5' GTTACCTGGCTCAGGCGTCCGCAGC 3'; XhoI site underscored) and 3'-th95. The PCR product was introduced into the XhoI and HindIII sites of pGL-3 basic. 3) For -270 phVDR/Luc, the corresponding fragment of the VDR promoter was generated by PCR using primers 5'-th98 (5' GTTACGGGTATCCGCACCTATAATC 3'; XhoI site underscored) and 3'-th95. The fragment was digested with XhoI and HindIII and introduced into the same sites of pGL-3 basic. The VDR cDNA was cloned by RT-PCR amplification from 293 cell poly(A)+ RNA. The amplification primers used for this purpose were 1) 5'-th99 (5' GTTAATGGAGGCAATGGCGGCCAGC 3'; XhoI site underscored) and 2) 3'-th100 (5' GTTAGGAGATCTCATTGCCAAACTCC 3'; HindIII site underscored). The PCR product was digested with XhoI and HindIII and cloned into the same sites of the pBluescript KS II+. WT1 expression vectors have already been described (32).

Cell culture, transfection, and luciferase assay.
293 and NIH 3T3 cell lines were maintained in DMEM supplemented with 10% heat-inactivated fetal calf serum (Life Technologies), penicillin, and streptomycin. For transient transfections, cells were plated at a density of 2 x 105 to 5 x 105 cells per 100-mm-diameter dish 24 h prior to transfection. The 293 cells were transfected by the calcium phosphate precipitation method (37), and NIH 3T3 cells were transfected using DMRIE-C reagent (Life Technologies). Unless stated otherwise, total DNA per plate of cells was 1 µg of pRSV/ß-gal vector, 1 µg of reporter plasmid, and 5 µg of expression vector. Individual DNA precipitates were adjusted to contain equal amounts of total DNA by the addition of the empty expression vector, pcDNA3. All transfections and subsequent luciferase assays were performed at least in duplicate. Cells were washed and refed 16 h posttransfection and harvested ~48 h later. Luciferase activity was determined using the Promega luciferase assay kit. All luciferase activity values were normalized to ß-galactosidase values, which served as internal controls for the transfections.

cDNA array analysis.
An HEK293 cell line with WT1(+/-) under the regulation of the tetracycline-inducible expression system has been previously described (12). Differential hybridization analysis was performed utilizing Research Genetics cDNA array filters (GF200), containing 5,184 selected cDNAs spotted onto a nylon membrane. Poly(A)+ RNA was purified from 293/WT1(+/-) control cells or from 293/WT1(+/-) cells that had been exposed to 2 mM doxycycline for 36 h. cDNA probe preparation and hybridizations to filters were performed according to the manufacturer’s protocol (Research Genetics). Data was analyzed using Research Genetics Pathway software (version 2.01).

S1 nuclease analysis and Western blotting.
S1 nuclease analysis was used to assess the level of endogenous VDR mRNA produced upon induction of WT1 expression. Probes used in the S1 analysis were: 1) VDR-TH (5' CAGGGTCAGGCAGGGAAGTGCTGGCCGCCATTGCCTCCATAAAAAAA-AAA 3'), a 50-base oligonucleotide consisting of 40 nucleotides (+1 to +40 relative to the translation start site) complementary to the human VDR mRNA and 10 noncomplementary adenosine residues at the 3' end; 2) GAPDH-HIT(AS) (5' GGGGTCATTGATGGCAACAATATCCACTTTACCAGAGTTATTTTTTTTTT 3'), a 50-base probe containing 40 nucleotides complementary to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript (nucleotide +59 to +98 relative to the translation start site) and 10 noncomplementary thymidine residues at the 3' end; and 3) GAPDH-HIT(S) (5' GGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATAAAAAAAAA 3'), a 50-base oligonucleotide containing of 40 nucleotides from the sense strand of the GAPDH mRNA (nucleotide +59 to +98 relative to the translation start site) and 10 noncomplementary adenosine residues. Oligonucleotide probes were radiolabeled with [{gamma}-32P]ATP (6,000 Ci/mmol) and T4 polynucleotide kinase. S1 nuclease analyses with gel-purified probes were performed as described (37). Briefly, 10 µg (for human VDR) or 2.5 µg (for GAPDH control) of poly(A)+ RNA was ethanol precipitated with ~30,000 cpm of radiolabeled probe, resuspended in 20 µl of S1 hybridization solution [80% deionized formamide, 40 mM PIPES (pH 6.4), 400 mM NaCl, and 1 mM EDTA (pH 8.0)], denatured at 90°C for 10 min, and hybridized at 30°C overnight. The samples were treated with 250 U of S1 nuclease (Boehringer) at 30°C for 60 min, ethanol precipitated, and analyzed on a 6% polyacrylamide (acrylamide/bisacrylamide ratio, 18:1)/8 M urea gel.

Total cell extracts for Western blot analysis were prepared by lysing 1.5 x 106 cells in 50 µl gel loading buffer [125 mM Tris·HCl (pH 6.8), 10% SDS, 20% glycerol, and 10% 2-mercaptoethanol]. Samples were boiled for 3 min, electrophoresed on SDS-10% polyacrylamide gels, then electroblotted onto an Immobilon-P membrane (Millipore). After blocking with 5% skim milk in PBST (80 mM Na2HPO4, 20 mM NaH2PO4, 100 mM NaCl, and 0.1% Tween-20), the membrane was incubated for 1 h with anti-WT1 (C-19), anti-VDR (C-20), or anti-Sp1 (PEP2) antibodies (1:1,000) (Santa Cruz Biotechnology). The membrane was washed in PBST, and antibody binding was visualized with peroxidase-conjugated donkey anti-rabbit secondary antibody (1:5,000) (Amersham) utilizing enhanced chemiluminescent (ECL) reagents (Amersham).

Electrophoretic mobility shift assays.
A truncated domain of the WT1 protein consisting of zinc fingers I to IV fused to a His6 tag has been previously described (12). Probes for electrophoretic mobility shift assays (EMSAs) were prepared from synthetically generated oligonucleotides. The sequences of the probes are as follows: 1) B1, 5' TCGATTACGCGA-TGCACGGGGAAGGCGGAACTCGG 3' (two overlapping putative WT1 binding sites are shown, one underscored and the other in italics); 2) B2, 5' TCGAGGCCTGGTCAGCCCAGACGCACCTGGCTCAG 3' (the putative WT1 binding site is underscored); 3) B3, 5' TCGAGAACCACGGCAGGAAGCTGCAT-CCCCGATTA 3'; 4) B1(m), 5' TCGATTACGCGATGCACGGGGAAGGCGGAACTCGG 3' (the mutation introduced into the putative WT1 binding site is in boldface); 5) B2(m), 5' TCGAGGCCTGGTCAGCCCAG-ACGCACCTGGCTCAG 3'; 6) B3(m), 5' TCGAGAACCACGGCAGGAAGCTGCATCC-CCGATTA 3'; 7) WTE, 5' GAGTAGAA 3' (the WT1 recognition site is underscored); and 8) WTE(m), 5' GAGTTAGAA 3' (the altered nucleotide is indicated in boldface). Synthetic oligonucleotide probes to the VDR promoter region were labeled by back-filling with the Klenow fragment of DNA polymerase I using [{alpha}-32P]dCTP (New England Nuclear; 3,000 Ci/mmol). EMSAs were performed with recombinant WT1 zinc finger (WTZF) protein (-KTS isoform) for 20 min at room temperature in the presence of 50 mM HEPES (pH 7.5), 50 mM KCl, 5 mM MgCl2, 10 mM ZnSO4, 1 mM dithiothreitol (DTT), 12% glycerol, 2 µg poly[(dI·dC)·(dI·dC)], 100 ng pBluescript KS II+, and 20 mM spermidine. For competition experiments, reaction mixtures were preincubated for 15 min with unlabeled oligonucleotide prior to the addition of radiolabeled probes. Following binding, the reaction mixtures were electrophoresed on a 4% polyacrylamide gel (acrylamide/bisacrylamide ratio, 29:1) in 0.5x TBE (44.5 mM Tris·HCl, 44.5 mM boric acid, and 1 mM EDTA) buffer at 92 V for 1 h at 4°C. The gels were dried and exposed to Kodak X-Omat film at room temperature.

Nuclear run-on analysis.
Nuclei from 293 or 293/WT1(+/-) cells grown in the presence or absence of doxycycline were prepared by lysis in buffer A [0.3 M sucrose, 60 mM KCl, 15 mM NaCl, 15 mM HEPES (pH 7.5), 2 mM EDTA, 0.5 mM EGTA, 0.5 mM spermidine, 0.15 mM spermine, and 0.1% Nonidet P-40] and pelleted at 1,500 g. The nuclei (2 x 107) were frozen in 100 µl of storage buffer [50% glycerol, 20 mM Tris (pH 7.9), 75 mM NaCl, 0.5 mM EDTA, 0.85 mM DTT, 0.125 mM phenylmethylsulfonyl fluoride (PMSF), and 100 U/ml RNasin] at -70°C until ready for use. The elongation reaction was carried out in reaction buffer {0.3 M (NH4)2SO4, 100 mM Tris (pH 7.9), 4 mM MgCl2, 4 mM MnCl2, 50 mM NaCl, 0.4 mM EDTA, 0.1 mM PMSF, 1.2 mM dithiothreitol, 1 mM GTP, ATP, and CTP, 10 mM creatine-kinase, 20 U/ml RNasin, and 150 µCi [{alpha}-32P]UTP} for 30 min at 27°C, at which point 100 µg of carrier tRNA was added. The RNA was purified by DNase I and proteinase K digestion, phenol-chloroform extracted, and passed over a Sephadex G-50 spin column. To remove unincorporated [{alpha}-32P]UTP, 10% trichloroacetic acid (TCA) and 60 mM sodium pyrophosphate was added for 10 min, and the precipitate was collected by centrifugation. The RNA pellet was resuspended in 250 µl of 20 mM HEPES (pH 7.5)/5 mM EDTA, and 62.5 µl of 1 M NaOH was added followed by incubation on ice for 13 min, and then the hydrolysis reaction was stopped by adding 125 µl of 1 M HEPES (pH 5.5), followed by ethanol precipitation. Prehybridization of nitrocellulose filters were performed at 42°C overnight, then hybridized at 42°C for 40 h. Prehybridization and hybridization solutions consisted of 50 mM HEPES (pH 7.0), 0.75 M NaCl, 50% formamide, 0.5% SDS, 2 mM EDTA, 10x Denhardt’s solution, 500 µg/ml salmon sperm DNA, and 10 µg/ml poly(rA). Five washes with 0.1x SSC/0.1% SDS were performed at 65°C for 20 min each, and filters were exposed to X-ray film (X-OMAT, Kodak) with an intensifying screen.

Chromatin immunoprecipitation.
293/WT1(+/-) cells grown in the presence or absence of doxycycline were washed in PBS, and fixed in DMEM without serum containing 1% paraformaldehyde for 10 min at 37°C. The fixed cells were lysed in lysis buffer [25 mM HEPES (pH 7.4), 137 mM NaCl, 1% Triton X-100, 10% glycerol, 2.5 mM EDTA, 2.5 mM EGTA, 5 mM ß-glycerol phosphate, 1 mM Na3VO4, 1 µg/ml of aprotinin, 1 µg/ml of leupeptin, 1 µg/ml of prefaBloc, 1 µg/ml of pepstatin A, 1 µg/ml of 1-chloro-3-(4-tosylamido)-4-phenyl-2-butanone (TPCK), 1 µg/ml of 1-chloro-3-tosylamido-7-amino-L-2-heptanone (TLCK), 5 mM NaF, and 5 mM sodium pyrophosphate] and forcefully drawn into and out of a 21-gauge hypodermic needle three times. The chromatin was sonicated 10 times for 30 s, which sheared the chromatin into smaller fragments of 1.5–3.5 kb by digesting with SphI, HindIII, PstI, and EcoRI at 37°C for 6 h. Sheared chromatin lysed extracts were incubated with WT1 antibody (C19; Santa Cruz Biotechnology) overnight, and immune complex were collected with protein G-Sepharose beads at 4°C for 1 h. The collected precipitates were incubated at 42°C for 1 h with 100 µg of proteinase K. Finally, the samples were processed for DNA purification by passing them through QIAquick PCR purification columns (Qiagen). PCR amplification by Platinum High Fidelity Taq DNA polymerase was performed in 50 µl of supplemented buffer with either the immunoselected DNA or total genomic DNA. The nucleotide sequences of the primers used were as follows: 1) TB3F, 5' CACCTGGCTCAGGCGTCC 3'; 2) TB3R, 5' GCCAGGAGCTCCGTTGGC 3'; 3) ActinF, 5' CCCGCCCCCAATCCTCTTG 3'; and 4) ActinR, 5' AAGACCAGGCCTGGGGCG 3'. These primers were used at a final concentration of 0.8 µM. An initial incubation for 5 min at 94°C was followed by 30 cycles of denaturation for 1 min at 94°C, annealing for 1 min at 62°C , and elongation for 90 s at 68°C, with a final extension for 10 min at 68°C. PCR products were separated in 1.6% agarose gels and visualized by staining with ethidium bromide.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Expression profiling in 293/WT(+/-) cells for genes under WT1 regulation.
To identify genes whose expressions are potentially regulated by WT1, we used a 293 cell line in which expression of WT1(+/-) was under tetracycline regulation. In this system, removal of the tetracycline analog, doxycycline, from the growth medium results in the production of WT1(+/-) protein (>10-fold induction). We have previously used this cell line to demonstrate regulation of Dax-1 expression by WT1 (12). Poly(A)+ RNA was isolated from 293/WT1(+/-) cells grown in the presence or absence of doxycycline, and 33P-radiolabeled cDNAs were generated. These labeled cDNAs were hybridized to probe sequences on cDNA arrays, and differentially expressed genes were determined by comparing the intensity of signals between both arrays. We used commercially available cDNA arrays containing ~5,200 PCR products from selected IMAGE clones amplified using vector primers (Research Genetics). To test the reproducibility of the screen, the entire procedure was carried out on a second independently obtained poly(A)+ RNA preparation. Overall, we found that the expression of most genes assayed was not altered in response to WT1(+/-) (Fig. 1A). Approximately 1% of the cDNAs examined showed a change in expression of approximately threefold. Of the 46 putative differentially expressed genes, 28 were repressed by WT1(+/-) and 16 displayed activation (Table 1). No obvious alteration in expression profile of specific gene families by WT1(+/-) could be identified from the small gene set used in this experiment.



View larger version (75K):
[in this window]
[in a new window]
 
Fig. 1. Differential expression of the vitamin D receptor (VDR) gene in 293/WT1(+/-) cells. A: gene expression profiling of uninduced and doxycycline-treated 293/WT1(+/-) cells using cDNA filter arrays. Filters were processed as described in MATERIALS AND METHODS, in the presence (+Dox) or absence (-Dox) of doxycycline in the culture media of 293/WT1(+/-) cells. Magnified views of a portion of each array are shown on the right; arrows indicate the array position of the VDR cDNA. B: RT-PCR analysis of VDR expression in induced or uninduced 293/WT1(+/-) cells. Following incubation of 293/WT1(+/-) cells for 36 h in media containing (lanes 1 and 3) or lacking (lanes 2 and 4) doxycycline, cells were harvested, and total RNA was isolated. Total RNA was reverse-transcribed with random hexamers and Superscript II, followed by amplification by the PCR (30 cycles) using primers for the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (lanes 1 and 2) or the VDR gene (lanes 3 and 4). PCR products were fractionated on a 1.0% agarose gel and visualized by staining with ethidium bromide.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Genes differentially expressed in uninduced and doxycycline-induced 293/WT1 (+/-) cells

 
We found that the VDR gene showed the most pronounced activation among the genes with known function (Table 1 and Fig. 1A). The expression level of the VDR gene increased 5.2-fold in WT1(+/-)-expressing cells, relative to control cells, as assessed by cDNA array hybridization. To confirm this potential activation of VDR in WT1(+/-)-expressing cells, we analyzed VDR expression in uninduced and induced 293/WT1(+/-) cells by RT-PCR. Equivalent amounts of total RNA were isolated from uninduced or induced 293/WT1(+/-) cells, as judged by amplification of GAPDH (Fig. 1B, compare lane 1 with lane 2). Activation of WT1(+/-) expression in 293 cells correlated with a striking increase in VDR gene expression (Fig. 1B, compare lane 4 with lane 3), confirming the results obtained in the expression profile experiment.

To more accurately measure the induction of endogenous VDR gene expression by WT1(+/-), S1 nuclease analyses were performed with complementary synthetic oligonucleotides targeting the VDR mRNA. To distinguish between undigested probe and protected probe, a 50-mer oligonucleotide containing 10 noncomplementary nucleotides (adenosine residues at the 3' end) was synthesized. Protection with this probe was observed only when it was hybridized to poly(A)+ RNA isolated from 293/WT1(+/-) cells grown in the absence of doxycycline [WT1(+/-) is induced under these conditions], but not when it was hybridized to poly(A)+ RNA from 293/WT1(+/-) cells grown in the presence of doxycycline, or when incubated with control tRNA (Fig. 2A). Sense and antisense probes against GAPDH were used as controls in these experiments, and this indicated that both samples contained equivalent amounts of GAPDH mRNA (Fig. 2B). The observed GAPDH signal was not due to DNA contamination of the RNA preparation, since it was not observed when a sense GAPDH oligonucleotide was utilized (Fig. 2B).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2. Activation of the endogenous VDR gene by WT1(+/-). A: quantitation of VDR poly(A)+ RNA levels in poly(A)+ RNA preparations from 293/WT1(+/-) grown in the presence or absence of doxycycline. S1 analysis was performed with a single-stranded radioactive synthetic oligonucleotide probe directed against +1 to +40 (relative to the translation start site) of the human VDR gene. The products of the protection were visualized by autoradiography by exposing the dried gel to X-Omat film at -70°C overnight with an intensifying screen. The position of migration of the free probe lane is indicated in the "-S1" lane. The RNA sources incubated with the S1 probes are denoted at the top as tRNA, 293/WT1(+/-)/(-)Dox, or 293/WT1(+/-)/(+)Dox. B: quantitation of GAPDH poly(A)+ RNA levels in poly(A)+ RNA preparations from 293/WT1(+/-) under control of the inducible tetracycline promoter. The products of the protection assay were analyzed on a 6% polyacrylamide/8 M urea gel, and size determinations were made by comparing the positions of migration of the products with a set of sequencing reactions which had been electrophoresed in parallel. The position of migration of the free probe lane is indicated in the -S1 lanes. The RNA sources incubated with the S1 probes are denoted at the top of the panel as tRNA, 293/WT1(+/-)/(-)Dox, or 293/WT1(+/-)/(+)Dox. The products of the protection were visualized by exposing the dried gel to X-Omat film at -70°C overnight with an intensifying screen. C: Western blot analysis of VDR and WT1 expression in 293WT1(+/-) cells. Induction of WT1 protein was assessed with the anti-WT1 C-19 antibody after electrophoresis on a 10% SDS polyacrylamide gel (top). The blot was stripped and VDR protein expression was detected with the anti-VDR C-20 antibody (middle). Expression of Sp1 protein was measured to confirm that the equal amounts of total protein were loaded in each lane (bottom). D: nuclear run-on assays demonstrating the transcriptional response of the VDR promoter to WT1(+/-). The nature of the immobilized plasmid on the filter paper is indicated to the right. Following hybridization and washing, the blot was exposed to X-Omat film for 48 h at -70°C with an intensifying screen. The nature of the cell line and growth conditions (with or without doxycycline) from which nuclei were isolated are indicated at top.

 
Western blotting was performed to determine VDR protein levels in WT1(+/-)-induced cells (Fig. 2C). Our results indicate that expression of VDR and WT1 was activated only in 293/WT1(+/-) cells grown in the absence of doxycycline and not in 293/WT1(+/-) cells grown in the presence of doxycycline, nor in control 293 cells grown under both conditions (Fig. 2C). The low levels of endogenous WT1 in 293 cells (33) are below the detectable limits of our S1 and Western blot assay. Blotting with an anti-Sp1 antibody demonstrated equivalent amounts of protein in all samples (Fig. 2C).

To demonstrate that WT1 was exerting its effect directly at the transcriptional level on the VDR promoter, we performed nuclear run-on analysis (Fig. 2D). Nuclei were isolated from 293 control cells or from 293/WT1(+/-) cells grown in the presence or absence of doxycycline, then allowed to continue transcription in the presence of [{alpha}-32P]UTP. RNA was isolated and hybridized to a series of immobilized cDNA probes. In this experiment, low levels of WT1(+/-) and VDR mRNA were detectable when hybridized to RNA from 293/WT1(+/-) cells grown in the presence of doxycycline [WT1(+/-) is repressed under these conditions] or to 293 control RNA (Fig. 2D). A sixfold increase of WT1 mRNA and a fourfold induction of VDR mRNA are observed in 293/WT1(+/-) cells grown in the absence of doxycycline [WT1(+/-) is activated under these conditions] (Fig. 2D). Human ß-actin was used as an internal standard in these experiments, and M13mp19 served as a negative control (Fig. 2D). Taken together, these results directly demonstrate transcriptional activation of the endogenous human VDR promoter in response to induction of WT1(+/-) expression.

Identification of the WT1-responsive sites in the human VDR promoter.
The sequence of the human VDR promoter has been previously reported (27). Inspection of the 960 nucleotides upstream of the transcription start site revealed the presence of four putative WT1 binding sites (5' GXGXGGGXG 3') (reviewed in Ref. 35). These elements were at position -701 to -601 (B1; 5' GG 3', two overlapping putative WT1 binding sites are shown, one underscored and the other in italics), -369 to -361 (B2; 5' GTGGGGGTG 3'), and -308 to -300 (B3; 5' GGGTGGGGG 3'). To determine whether any of these sites could form specific complexes with WT1, a series of gel shift experiments were performed with synthetic oligonucleotides containing the B1, B2, or B3 sequence and recombinant WTZF(-KTS) protein. A single protein-DNA complex was obtained with oligonucleotides harboring the wild-type B1, B2, or B3 sequence (Fig. 3, A–C). When the core motifs of B1, B2, and B3 were mutated, complex formation was abrogated with these mutant putative WT1 binding sites, indicating that sequence-specific WT1/DNA complexes can form at the B1, B2, and B3 sites (Fig. 3, DF).



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 3. Identification of WT1 binding sites within the VDR promoter. A schematic representation of the VDR promoter showing the relative position of the three WT1 binding sites (B1, B2, and B3) is presented. AF: WTZF(-KTS) recombinant protein was used in electrophoretic mobility shift assay (EMSAs) with oligonucleotides containing the sequences corresponding to regions B1 (A), B2 (B), B3 (C), B1(m) (D), B2(m) (E), and B3(m) (F). The nucleotide sequences of the oligonucleotides are presented in MATERIALS AND METHODS. The amount of recombinant WTZF protein used in the EMSAs was titrated and is indicated above each lane. GL: competition experiments were performed in the presence of increasing amounts (the molar excess is indicated above each lane) of an unlabeled oligonucleotide harboring either the WTE recognition site (GI) or a mutant version of WTE (JL). Protein-DNA complexes were resolved on nondenaturing 4% polyacrylamide gels electrophoresed at 4°C in 0.5x TBE. Complexes were visualized by drying the gel and exposing to X-Omat film (Kodak) at room temperature for 12 h. The positions of migration of free probe and protein-DNA complexes are indicated.

 
The specificity of WT1 binding was also examined in competition assays with excess unlabeled oligonucleotide WTE (5' GAGTAGAA 3', the WT1 binding site is underscored) containing a 10-bp optimized WT1 binding site, originally identified by using a whole-genome PCR selection assay and full-length WT1 protein (29). WT1 has 20-fold higher affinity for this site than for the consensus EGR-1 site (29). Binding of WT1 to the B1, B2, or B3 was abolished by increasing amounts of unlabeled WTE (Fig. 3, G–I). In contrast, no competition was observed with up to 200-fold molar excess of a mutant WTE site, WTE(m) (5' GAGTAGAA 3', the substitution is in boldface) (Fig. 3, JL). These observations indicate that WT1 can recognize the three sites within the human VDR promoter in a sequence-specific fashion. The next series of experiments were performed to determine which of these sites were functional in vivo.

Transcriptional activation of the VDR promoter by WT1.
During the course of these studies, Maurer et al. (24) reported that WT1 can activate the VDR gene. They identified a site (5' TGTGGGCG 3') within the murine VDR promoter that resides immediately upstream of four Sp1 sites and confers responsiveness to WT1 (24). This site, however, is not conserved in the human VDR promoter (which instead has 5' CTGTGGGCG 3' at position -77 to -71) and overlaps with one of the Sp1 sites (24). Considering that the murine site is not conserved in the human promoter and that the WT1 binding sites in our EMSAs differed from the one that Maurer et al. (24) reported for the murine promoter, we sought to better characterize activation of the human VDR gene by WT1.

To investigate whether all the WT1 binding sites within the human VDR promoter could equally mediate a transcriptional response to WT1, the human VDR promoter region was positioned upstream of the luciferase gene (Fig. 4A). A series of expression vectors driving the synthesis of four alternatively spliced WT1 isoforms and two Denys-Drash mutant alleles (harboring a missense mutation in zinc finger III, converting 394Arg to 394Trp) were also generated (Fig. 4A). Reporter and expression vectors were then introduced into 293 cells and assayed for luciferase activity. When -960 phVDR/Luc was transfected with the empty expression vector pcDNA3, very little luciferase activity was observed (Fig. 4B, "pcDNA3" lane). Transfection with CMV/WT1(-KTS) isoforms resulted in a 3.5-fold activation in luciferase activity (Fig. 4B). CMV/WT1(+KTS) isoforms or Denys-Drash mutants did not significantly affect transcription of the human VDR promoter (Fig. 4B). WT1(+/-) and WT1(-/-) did not activate transcription of the parental luciferase reporter vector lacking the human VDR promoter (Lee T and Pelletier J, data not shown). Thus activation by WT1(+/-) and WT1(-/-) was dependent on elements within the human VDR promoter. Cotransfection of increasing amounts of CMV/WT1(-/-) expression vector produced a dose-dependent increase in luciferase activity from the human VDR promoter (Fig. 4C). Western blotting of nuclear extracts from the transfected cells demonstrated that increasing amounts of CMV/WT1(-/-) were synthesized in response to increasing amounts of transfected plasmid (Fig. 4D). These results demonstrate that activation of VDR gene expression by WT1 is restricted to the -KTS isoforms.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4. Transactivation of the human VDR promoter by WT1. A: schematic representation of the VDR reporter plasmid and WT1 expression vectors. The -960 phVDR/Luc reporter plasmid contains genomic VDR sequence from nucleotides -960 to -1, relative to the predicted start of transcription initiation (27). Expression vectors driving the production of murine isoforms are also represented and have been previously described (31). The first alternative splice site (exon V) consists of 17 amino acids (VAAGSSSSVKWTEGDSN), and the second alternative splice site consists of three amino acids (KTS). 394R->394W indicates a missense mutation in WT1 zinc finger III converting an 394Arg residue to a 394Trp and is represented by a star. The WT1 zinc fingers are denoted by open boxes. B: effect of various WT1 isoforms on transcription of the human VDR promoter. The 293 cells were transfected with 5 µg of indicated WT1 expression vector, 1 µg of -960 phVDR/Luc reporter plasmid, and 1 µg of RSV/ß-gal. Luciferase activities (in relative light units, RLU) were determined after 48 h from cell extracts and normalized to ß-galactosidase activity. Luciferase activity of each transfection was set relative to the activity obtained by transfecting pcDNA3, -960 phVDR/Luc, and RSV/ß-gal (which was set at 1). The error bars represent the standard deviation of three separate experiments, with each sample transfected in duplicate. C: dose-dependent activation of the human VDR promoter by WT1(-/-). For these experiments, 1 µg of -960 phVDR/Luc reporter plasmid was cotransfected with the indicated amounts of WT1(-/-) expression vector. The total transfected DNA concentration was kept constant by the addition of the empty expression vector, pcDNA3, to make up for differences in amounts between transfections. D: analysis of WT1(-/-) in transfected cells. Extracts used for luciferase assays in C above, were resolved on a 10% SDS-PAGE, transferred to polyvinylidene difluoride membrane, and immunoblotted with anti-WT1 antibody (C-19). The blot was preblocked in PBST (80 mM Na2HPO4, 20 mM NaH2PO4, 100 mM NaCl, and 0.1% Tween-20) containing 5% skim milk for 1 h at 4°C and probed with anti-WT1 (C-19) antibody (Santa Cruz) (1:1,000). Following extensive washing with PBST, the blot was incubated with a horseradish peroxidase-conjugated anti-rabbit antibody (1:5,000) (Amersham). The immune complexes were visualized using an ECL kit from Amersham. E: Denys-Drash syndrome (DDS) alleles inhibit transcriptional activation of VDR by WT1(-/-) in a dose-dependent fashion. The 293 cells were transfected with 1 µg of -960 phVDR/Luc reporter plasmid, 5 µg of CMV/WT1(-/-), and the indicated amounts of WT1(-/-, 394R->394W). The total transfected DNA concentration was kept constant by the addition of empty expression vector, pcDNA3, to make up for differences in amounts between transfections. Luciferase activity was determined from whole cell extracts prepared 48 h after transfection. The error bars represent the standard deviations of two separate experiments, where each sample was transfected in duplicate.

 
Several studies have documented that the transcriptional activity of WT1 can be modulated by interaction with a number of proteins. Among these are products of Denys-Drash syndrome (DDS) alleles of wt1, which behave as dominant negatives by interacting with wild-type WT1 via an NTD, thus sequestering functional WT1 protein in inactive complexes (2, 28, 36). Introduction of increasing amounts of CMV/WT1 (-/-,394R->394W) to a transfection containing constant amounts of CMV/WT1(-/-) resulted in progressive reduction in luciferase activity (Fig. 4E). Since WT1(-/-, 394R->394W) cannot bind to WT1 recognition elements and does not by itself affect VDR expression (Fig. 4B), the observed interference on transcriptional activation is likely mediated by sequestration of wild-type WT1(-/-) (2).

To identify the WT1 binding site(s) within the VDR promoter that mediate transcriptional activation, deletion analyses of the promoter region was performed. We generated reporter constructs in which luciferase expression is driven by 436 bp of the human VDR promoter (-436 phVDR/Luc, which contains two putative WT1 binding sites from transcription start site), i.e., 354 bp (-354 phVDR/Luc, which contains one putative WT1 binding site) or 270 bp (-270 phVDR/Luc, which does not contain any putative WT1 binding sites). As shown in Fig. 5A, cotransfection of CMV/WT1(-/-) with -436 phVDR/Luc or -354 phVDR/Luc into 293 or NIH 3T3 cells produced the same levels of activation as when -960 phVDR/Luc was used as the reporter. However, when -270 phVDR/Luc was cotransfected with CMV/WT1(-/-), no activation of the human VDR promoter was observed. These results indicate that WT1 activates VDR transcription through sequences present in the VDR promoter residing between -354 and -270.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5. WT1 activates VDR through the B3 site. A: mutational analysis of the VDR promoter. The VDR promoter is denoted by a thin line, the luciferase open-reading frame is denoted by an open box, and putative WT1 recognition elements are represented by shaded ovals. The position of two primers, TB3F and TB3R, which were used in the chromatin immunoprecipitation (ChIP) assay, are shown. The 293 and NIH 3T3 cells were cotransfected with 1 µg of reporter plasmid, 20 µg of CMV/WT1(-/-) expression vector, and 1 µg of RSV/ß-gal. The activities of these constructs were determined 48 h after transfection and normalized to the activity of ß-galactosidase. The values represent the average fold activation of at least two experiments performed in duplicate. B: ChIP assay performed with anti-WT1 antibody. PCR products (VDR or ß-actin) amplified with two sets of primers from total cellular DNA without immunoprecipitation ("No I.P.", lanes 1–3) or from immunoprecipitated DNA (lanes 4–7) were analyzed by agarose gel electrophoresis. The samples were prepared from 293/WT1(+/-) cells grown in the presence of doxycycline (lanes 1 and 4) or from 293/WT1(+/-) cells grown in the absence of doxycycline (lanes 2, 3, and 5–7). Cells were either cross-linked with formaldehyde (lanes 1, 3, 4, 6, and 7) or not cross-linked (lanes 2 and 5). Extracts were incubated with protein G-Sepharose beads preloaded with anti-WT1 antibody (lanes 4, 5, and 7) or with the beads not containing an antibody (lane 6). The nature of the PCR products is indicated to the left.

 
To determine whether WT1 was directly associated with the this region of the human VDR promoter region in vivo, we employed a chromatin immunoprecipitation (ChIP) assay. In this experiment, WT1(+/-)-expressing 293 cells were cross-linked with formaldehyde, and chromosomal DNA was fragmented by sonication and restriction enzyme digestion. The isolated DNA was used directly in a PCR (Fig. 5B, lanes 1–3), immunoprecipitated with an anti-WT1 antibody (lanes 4, 5, and 7), or immunoprecipitated with protein G-Sepharose beads (lane 6), followed by PCR analysis. As shown in Fig. 5B, primers directed against actin revealed the presence of this gene in total, nonimmunoprecipitated genomic DNA (Fig. 5B, bottom, lanes 1–3). However, no actin DNA was present in samples which had been processed for immunoprecipitation (lanes 4–7). Oligonucleotides targeting nucleotides -357 to -93 of the VDR promoter revealed the presence of VDR sequences in total genomic DNA (Fig. 5B, top, lanes 1–3). The ChIP assay revealed that VDR sequences were detected only when WT1(+/-) was present (compare lane 4 with lane 7), only when protein/DNA cross-linking was performed with formaldehyde (compare lane 5 with lane 7), and only when specific anti-WT1 antibodies were present in the immunoprecipitation (compare lane 6 with lane 7). These results demonstrate that WT1(+/-) interacts with the VDR promoter in vivo.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Two other studies have reported on the use of expression profiling to identify WT1 downstream targets. Lee et al. (17) used poly(A)+ RNA from U2OS (an osteosarcoma cell line) cells harboring a tetracycline-regulated WT1 expression vector, to probe oligonucleotide arrays from Affymetrix (containing 6,800 oligonucleotides of known genes and expressed sequence tags) and identified amphiregulin as a downstream target of WT1 (17). In this thorough study, they also reported that hsp70, p21CIP1, acidic fibroblast growth factor, and cystatin A levels changed in response to induction of WT1 expression. Since none of these genes was present on our array, we do not know whether their expression is also altered in our cell line. Stanhope-Baker and Williams (39) used the Affymetrix Hu 6800 chip to compare the expression profile of a cell line (Wit49, derived from a primary lung metastasis of an aggressive Wilms’ tumor) with the expression profile from the same cell line expressing a dominant-negative version of WT1, used to abrogate the activity of the endogenous protein. Their study identified the CTGF as a downstream target of WT1. Although Stanhope-Baker and Williams (39) used the same array as Lee et al. (17), they found different gene sets responding to WT1. We note that our array contained the CTGF gene, and no changes in its expression level were detected in our cell line under the growth conditions used. Also present on our array were cDNAs encoding EGFR, Ki-ras, and E-cadherin, putative downstream targets of WT1, none of which showed a response to induction of WT1 (Lee T and J Pelletier J, data not shown). The fact that different profiling approaches identified different WT1 downstream targets argues for the need to use multiple cell lines and inducible systems when attempting to identify downstream targets of given genes, since cell-specific transcriptional silencing, activation, and/or processing of genes may limit the number of targets identified.

In this report, we have identified the human VDR gene as a downstream target of the WT1 tumor suppressor gene (Table 1 and Fig. 1). We confirmed this by RT-PCR, S1 analysis, and nuclear run-ons of VDR transcripts in 293 cells expressing or lacking WT1 (Figs. 1 and 2). Although the initial expression profiling experiment we performed identified 46 putatively differentially expressed transcripts (Table 1), RT-PCR analysis of several of these (GenBank accession nos. AA598508, T69522, H01030, H90855, and T52435) failed to confirm a difference in expression levels in 293 cells following induction of WT1 expression (Lee T and Pelletier J, data not shown). These discrepancies highlight the need for a second robust screen to confirm initial expression profiling results, as previously indicated (17).

Our results extend the initial findings of Maurer et al. (24), who defined a WT1 binding site within the murine and human VDR promoters. The site identified by Maurer et al. (24) is not conserved in the human VDR promoter. Although we functionally characterized three WT1-responsive elements within the human VDR promoter by EMSA, only one of these was found to be functional in transient transfection experiments (Figs. 35). Additionally, the ChIP assay indicated that WT1(+/-) was associated with the VDR promoter B3 (Fig. 5B). Taken together, these results suggest that WT1(-KTS) isoforms activate VDR transcription by binding to the B3 element at -308 to -300. The B3 element is distinct from the WT1-responsive element defined for the murine promoter (24). These results suggest that not all wt1 regulatory pathways may be conserved among species and may provide a molecular basis for the phenotypic differences between mice and humans heterozygous for the WT1 gene. Mice lacking one WT1 allele are not predisposed to Wilms’ tumors and have no urogenital defects (13), unlike humans with only one WT1 allele, who are predisposed to WTs and frequently have genital system anomalies (26). Although the basic mechanism for urogenital development has been conserved between mice and humans, specific pathways must have evolved to give rise to species-specific phenotypes. For example, human nephrogenesis is complete by ~36 wk gestation, whereas new nephron formation continues in rodents into postnatal life. There is precedence for species-specific downstream targets of WT1, since we have previously reported that the human retinoic acid receptor-{alpha} is repressed by WT1, whereas the murine counterpart is not (9).

During the course of this work, Wagner et al. (41) reported that expression of the murine VDR promoter can be activated by both the WT1(-KTS) and WT1(+KTS) isoforms through a site (5' GTGGGCGTG 3') residing 115 bp upstream of exon 1. In our hands, WT1(+KTS) does not activate the human VDR promoter (Fig. 4B). This is consistent with a postulated role for the WT1(+KTS) isoforms in posttranscriptional regulation (15). We also found that a DDS allele of wt1 decreased WT1-mediated activation of the human VDR promoter (Fig. 4E). These results suggest that under certain conditions, these proteins may act as possible antagonists of WT1 function.

WT1 has an essential role in the development of the kidney. WT1 knockout mice result in embryonic lethality and fail to develop kidneys (13). Although WT1 and VDR are coexpressed in the same region of the kidney such as the ureteric bud, mesenchyme, S-shaped body, and glomerular epithelium in the embryonic stage, it is unlikely that VDR plays an critical role in differentiation and development during nephrogenesis, since VDR null mice do not have abnormal kidney development (5, 45).

The biological actions of 1,25-dihydroxyvitamin D3 [1,25(OH)2D3], the active form of the vitamin D, are mediated through its receptor. VDR is a ligand-activated transcriptional regulator belonging to the nuclear receptor superfamily (1). Activated VDR binds cooperatively to vitamin D response elements (VDREs) as a heterodimer with another member of the family, the retinoid X receptor (1, 4). VDREs have been identified in several genes regulated by 1,25(OH)2D3 that are involved in calcium and phosphorus homeostasis or bone metabolism. To date, 1,25(OH)2D3 has been found to inhibit proliferation, and induce differentiation of, leukemia cells. Vitamin D can also inhibit the proliferation of a number of other malignant cells, including breast, prostate, and colon cancer cells (4). In addition, known target genes of VDR regulation include the cell cycle inhibitor p21 (19) and p27 (38), perhaps accounting in part for the anti-proliferative effects of the VDR on some types of cells. It remains to be established whether VDR is deregulated in Wilms’ tumors harboring WT1 mutations. The high level of WT1 expression in most human acute leukemia raises the possibility that this tumor suppressor may also contribute to hematopoietic malignancies and, by implication, with normal hematopoiesis itself. A subset of acute leukemia, ~10%, have inactivating mutations in WT1, whereas the majority express high levels of the wild-type transcripts (16). This discrepancy is similar to that observed with sporadic Wilms’ tumor. Thus the tumor suppressor action of WT1 could, in part, result from its maintenance of VDR expression. It remains to be established whether altered VDR expression may contribute to the etiology of Wilms’ tumors and/or acute leukemia.


    ACKNOWLEDGMENTS
 
T. Lee was supported by a Canadian Institute of Health Research studentship. J. Pelletier is a Canadian Institutes of Health Research Senior Investigator. This work was supported by a grant from the National Cancer Institute of Canada to J. Pelletier.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: J. Pelletier, Dept. of Biochemistry, McIntyre Medical Sciences Bldg., McGill Univ., Rm. 810, 3655 Drummond St., Montreal, Quebec, Canada H3G 1Y6 (jerry@medcor.mcgill.ca).

physiolgenomics.00046.2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Brown AJ, Dusso A, and Slatopolsky E. Vitamin D. Am J Physiol Renal Physiol 277: F157–F175, 1999.[Abstract/Free Full Text]
  2. Bruening W, Moffett P, Chia S, Heinrich G, and Pelletier J. Identification of nuclear localization signals within the zinc fingers of the WT1 tumor suppressor gene product. FEBS Lett 393: 41–47, 1996.[Medline]
  3. Call KM, Glaser T, Ito CY, Buckler AJ, Pelletier J, Haber DA, Rose EA, Kral A, Yeger H, Lewis WH, Jones C, and Housman DE. Isolation and characterization of a zinc finger polypeptide gene at the human chromosome 11 Wilms’ tumor locus. Cell 60: 509–520, 1990.[ISI][Medline]
  4. Christakos S, Raval-Pandya M, Wernyi RP, and Yang W. Genomic mechanisms involved in the pleiotropic actions of 1,25-dihydroxyvitamin D3. Biochem J 316: 361–371, 1996.
  5. Chun LY, Pirro AE, Amling M, Delling G, Baron R, Bronson R, and Demay MB. Targeted ablation of the vitamin D receptor: an animal model of vitamin D-dependent rickets type II with alopecia. Proc Natl Acad Sci USA 94: 9831–9835, 1997.[Abstract/Free Full Text]
  6. Coppes MJ, Liefers GJ, Paul P, Yeger H, and Williams BRG. Homozygous somatic Wt1 point mutations in sporadic unilateral Wilms tumor. Proc Natl Acad Sci USA 90: 1416–1419, 1993.[Abstract/Free Full Text]
  7. Davies RC, Calvio C, Bratt E, Larsson SH, Lamond AI, and Hastie ND. WT1 interacts with the splicing factor U2AF65 in an isoform-dependent manner and can be incorporated into spliceosomes. Genes Dev 12: 3217–3225, 1998.[Abstract/Free Full Text]
  8. Gessler M, Poustka A, Cavenee W, Neve RL, Orkin SH, and Bruns GAP. Homozygous deletion in Wilms tumours of a zinc-finger gene identified by chromosome jumping. Nature 343: 774–778, 1990.[Medline]
  9. Goodyer P, Dehbi M, Torban E, Bruening W, and Pelletier P. Repression of the retinoic acid receptor-{alpha} gene by the Wilms’ tumor suppressor gene product, wt1. Oncogene 10: 1125–1129, 1995.[ISI][Medline]
  10. Johnstone RW, See RH, Sells SF, Wang J, Muthukkumar S, Englert C, Haber DA, Licht JD, Sugrue SP, Roberts T, Rangnekar VM, and Shi Y. A novel repressor, par-4, modulates transcription and growth suppression functions of the Wilms’ tumor suppressor WT1. Mol Cell Biol 16: 6945–6956, 1996.[Abstract]
  11. Johnstone RW, Wang J, Tommerup N, Vissing H, Roberts T, and Shi Y. Ciao 1 is a novel WD40 protein that interacts with the tumor suppressor protein WT1. J Biol Chem 273: 10880–10887, 1998.[Abstract/Free Full Text]
  12. Kim J, Prawitt D, Bardeesy N, Torban E, Vicaner C, Goodyer P, Zabel B, and Pelletier J. The Wilms tumor suppressor gene (wt1) product regulates Dax-1 gene expression during gonadal differentiation. Mol Cell Biol 19: 2289–2299, 1999.[Abstract/Free Full Text]
  13. Kreidberg JA, Sariola H, Loring JM, Maeda M, Pelletier J, Housman D, and Jaenisch R. WT-1 is required for early kidney development. Cell 74: 679–691, 1993.[ISI][Medline]
  14. Laity JH, Dyson HJ, and Wright PE. Molecular basis for modulation of biological function by alternate splicing of the Wilms’ tumor suppressor protein. Proc Natl Acad Sci USA 97: 11932–11935, 2000.[Abstract/Free Full Text]
  15. Larsson SH, Charlieu JP, Miyagawa K, Engelkamp D, Rassoulzadegan M, Ross A, Cuzin F, van Heyningen V, and Hastie N. Subnuclear localization of WT1 in splicing or transcription factor domains is regulated by alternative splicing. Cell 81: 391–401, 1995.[ISI][Medline]
  16. Lee SB and Haber DA. Wilms tumor and the WT1 gene. Exp Cell Res 264: 74–99, 2001.[ISI][Medline]
  17. Lee SB, Huang K, Palmer R, Truong VB, Herzlinger D, Kolquist KA, Wong J, Paulding C, Yoon SK, Gerald W, Oliner JD, and Haber DA. The Wilms suppressor WT1 encodes a transcriptional activator of amphiregulin. Cell 98: 663–673, 1999.[ISI][Medline]
  18. Little MH, Prosser J, Condie A, Smith PJ, van Heyningen V, and Hastie ND. Zinc finger point mutations within the WT1 gene in Wilms tumor patients. Proc Natl Acad Sci USA 89: 4791–4795, 1992.[Abstract/Free Full Text]
  19. Liu M, Lee MH, Cohen M, Bommakanti M, and Freedman LP. Transcriptional activation of the Cdk inhibitor p21 by vitamin D3 leads to the induced differentiation of the myelomonocytic cell line U937. Genes Dev 10: 142–153, 1996.[Abstract/Free Full Text]
  20. Madden SL, Cook DM, Morris JF, Gashler A, Sukhatme VP, and Rauscher FJ III. Transcriptional repression mediated by the WT1 Wilms tumor gene product. Science 253: 1550–1553, 1991.[Abstract/Free Full Text]
  21. Maheswaran S, Englert C, Zheng G, Lee SB, Wong J, Harkin DP, Bean J, Ezzell R, Garvin AJ, McCluskey RT, DeCaprio JA, and Haber DA. Inhibition of cellular proliferation by the Wilms tumor suppressor WT1 requires association with the inducible chaperone Hsp70. Genes Dev 12: 1108–1120, 1998.[Abstract/Free Full Text]
  22. Maheswaran S, Park S, Bernard A, Morris JF, Rauscher FJ, Hill DE, and Haber DA. Physical and functional interaction between WT1 and p53 proteins. Proc Natl Acad Sci USA 90: 5100–5104, 1993.[Abstract/Free Full Text]
  23. Matsunaga E. Genetics of Wilms’ tumor. Hum Genet 57: 231–246, 1981.[ISI][Medline]
  24. Maurer U, Jehan F, Englert C, Hübinger G, Weidmann E, DeLucas HF, and Bergmann L. The Wilms’ tumor gene product (WT1) modulates the response to 1,25-dihydroxyvitamin D3 by induction of the vitamin D receptor (VDR). J Biol Chem 276: 3727–3732, 2001.[Abstract/Free Full Text]
  25. Mayo MW, Wang CY, Drouin SS, Madrid LV, Marshall AF, Reed JC, Weissman BE, and Baldwin AS. WT1 modulates apoptosis by transcriptionally upregulating the bcl-2 proto-oncogene. EMBO J 18: 3990–4003, 1999.[ISI][Medline]
  26. Miller RW, Fraumeni JF Jr, and Manning MD. Association of Wilms’ tumor with aniridia, hemihypertrophy and other congenital malformation. N Engl J Med 270: 922–927, 1964.
  27. Miyamoto KI, Kesterson RA, Yamamoto H, Taketani Y, Nishiwaki E, Tatsumi S, Inoue Y, Morita K, Takeda E, and Pike JW. Structural organization of the human vitamin D receptor chromosomal gene and its promoter. Mol Endocrinol 11: 1165–1179, 1997.[Abstract/Free Full Text]
  28. Moffett P, Bruening W, Nakagama H, Bardeesy N, Housman D, Housman DE, and Pelletier J. Antagonism of WT1 activity by protein self-association. Proc Natl Acad Sci USA 92: 11105–11109, 1995.[Abstract/Free Full Text]
  29. Nakagama H, Heinrich G, Pelletier J, and Housman D. Sequence and structural requirements for high-affinity DNA binding by the WT1 gene product. Mol Cell Biol 15: 1489–1498, 1995.[Abstract]
  30. Park S, Bernard A, Bove K, Sens DA, Hazen-Martin DJ, Julian Garvin A, and Haber DA. Inactivation of WT1 in nephrogenic rests, genetic precursors to Wilms’ tumour. Nat Genet 5: 363–367, 1993.[Medline]
  31. Pelletier J, Bruening W, Kashtan CE, Mauer SM, Manivel JC, Striegel JE, Houghton DC, Junien C, Habib R, Fouser L, Fine RN, Silverman BL, Haber DA, and Housman D. Germline mutations in the Wilms’ tumor suppressor gene are associated with abnormal urogenital development in Denys-Drash syndrome. Cell 67: 437–447, 1991.[ISI][Medline]
  32. Pelletier J, Bruening W, Li FP, Haber DA, Glaser T, and Housman DE. WT1 mutations contribute to abnormal genital system development and hereditary Wilms’ tumour. Nature 353: 431–434, 1991.[Medline]
  33. Rackley RR, Flenniken AM, Kuriyan NP, Kessler PM, Stoler MH, and Williams BRG. Expression of the Wilms’ tumor suppressor gene wt1 during mouse embryogenesis. Cell Growth Differ 4: 1023–1031, 1993.[Abstract]
  34. Rauscher FJ III, Morris JF, Tournay OE, Cook D, M, and Curran T. Binding of the Wilms’ tumor locus zinc finger protein to the EGR-1 consensus sequence. Science 250: 1259–1262, 1990.[Abstract/Free Full Text]
  35. Reddy JC and Licht JD. The WT1 Wilms’ tumor suppressor gene: how much do we really know? Biochim Biophys Acta 1287: 1–28, 1996.[Medline]
  36. Reddy JC, Morris JC, Wang J, English MA, Haber DA, Shi Y, and Licht JD. WT1-mediated transcriptional activation is inhibited by dominant negative mutant proteins. J Biol Chem 270: 10878–10884, 1995.[Abstract/Free Full Text]
  37. Sambrook J, Fritsch EF, and Maniatis T. Molecular Cloning: a Laboratory Manual (2nd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.
  38. Silberstein GB and Daniel CW. Reversible inhibition of mammary gland growth by transforming growth factor-beta. Science 237: 291–293, 1987.[Abstract/Free Full Text]
  39. Stanhope-Baker P and Williams BRG. Identification of connective tissue growth factor as a target of WT1 transcriptional regulation. J Biol Chem 275: 38139–38150, 2000.[Abstract/Free Full Text]
  40. Varanasi R, Bardeesy N, Ghahremani M, Petruzzi MJ, Nowak N, Adam MA, Grundy P, Shows T, and Pelletier J. Fine structure analysis of the WT1 gene in sporadic Wilms tumors. Proc Natl Acad Sci USA 91: 3554–3558, 1994.[Abstract/Free Full Text]
  41. Wagner KD, Wagner N, Sukhatme VP, and Scholz H. Activation of vitamin D receptor by the Wilms’ tumor gene product mediates apoptosis of renal cells. J Am Soc Nephrol 12: 1188–1196, 2001.[Abstract/Free Full Text]
  42. Wang ZY, Qiu QQ, Huang J, Gurrieri M, and Deuel TF. Products of alternatively spliced transcripts of the Wilms’ tumor suppressor gene, wt1, have altered DNA binding specificity and regulate transcription in different ways. Oncogene 10: 415–422, 1995.[ISI][Medline]
  43. Wang ZY, Qui QQ, and Deuel TF. The Wilms’ tumor gene product WT1 activates or suppresses transcription through separate functional domains. J Biol Chem 268: 9172–9175, 1993.[Abstract/Free Full Text]
  44. Wang ZY, Qui QQ, Enger KT, and Deuel TF. A second transcriptionally active DNA-binding site for the Wilms tumor gene product, WT1. Proc Natl Acad Sci USA 90: 8896–8900, 1993.[Abstract/Free Full Text]
  45. Yoshizawa T, Handa Y, Uematsu Y, Takeda S, Sekine K, Yoshihara Y, Kawakami A, Matsumoto T, and Kato M. Mice lacking the vitamin D receptor exhibit impaired bone formation, uterine hypoplasia and growth retardation after weaning. Nat Genet 16: 391–396, 1997.[ISI][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
H.-S. Kim, M. S. Kim, A. L. Hancock, J. C. P. Harper, J. Y. Park, G. Poy, A. O. Perantoni, M. Cam, K. Malik, and S. B. Lee
Identification of Novel Wilms' Tumor Suppressor Gene Target Genes Implicated in Kidney Development
J. Biol. Chem., June 1, 2007; 282(22): 16278 - 16287.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
Y. Bor, J. Swartz, A. Morrison, D. Rekosh, M. Ladomery, and M.-L. Hammarskjold
The Wilms' tumor 1 (WT1) gene (+KTS isoform) functions with a CTE to enhance translation from an unspliced RNA with a retained intron
Genes & Dev., June 15, 2006; 20(12): 1597 - 1608.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. A. Simpson, E. A. Burwell, K. A. Thompson, S. Shahnaz, A. R. Chen, and D. M. Loeb
The antiapoptotic gene A1/BFL1 is a WT1 target gene that mediates granulocytic differentiation and resistance to chemotherapy
Blood, June 15, 2006; 107(12): 4695 - 4702.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Kuhlmann, C. S. Haas, M.-L. Gross, U. Reulbach, M. Holzinger, U. Schwarz, E. Ritz, and K. Amann
1,25-Dihydroxyvitamin D3 decreases podocyte loss and podocyte hypertrophy in the subtotally nephrectomized rat
Am J Physiol Renal Physiol, March 1, 2004; 286(3): F526 - F533.
[Abstract] [Full Text]


Home page
Physiol. GenomicsHome page
M. T. Discenza and J. Pelletier
Insights into the physiological role of WT1 from studies of genetically modified mice
Physiol Genomics, February 13, 2004; 16(3): 287 - 300.
[Abstract]