|
|
||||||||
1 Department of Biochemistry
2 McGill Cancer Center, McGill University, Montreal, Quebec, Canada H3G 1Y6
| ABSTRACT |
|---|
|
|
|---|
vitamin D receptor; gene regulation; Wilms tumor
| INTRODUCTION |
|---|
|
|
|---|
The WT1 gene spans
50 kbp of genomic DNA consisting of 10 exons, the last 4 of which encode individual zinc fingers. The WT1 product is a
50-kDa transcription factor with a proline-glutamine-rich amino terminus and four carboxy-terminal zinc fingers of the Krüppel C2-H2 class. The mRNA contains two alternatively spliced exons (reviewed in Ref. 35). The function of the first alternative splicing event (exon V) has not been well defined, although exon V can repress transcription when fused to a heterologous DNA binding domain (42). Alternative splicing of exon IX inserts or removes three amino acids (+/-KTS) [referred to as WT1(+KTS) or WT1(-KTS)] between zinc fingers III and IV and changes the DNA binding specificity of WT1 (34). The WT1(-KTS) isoforms can bind to two DNA motifs: 1) a GC-rich motif, 5' GXGXGGGXG 3', related to the EGR-1 binding site (34); and 2) a (5' TCC 3')n-containing sequence (44). Recently nuclear magnetic resonance (NMR) relaxation studies have indicated that the KTS insertion increases the flexibility of the linker between fingers III and IV and abrogates binding of the fourth zinc finger to its cognate site in the DNA major groove (14). A role for WT1 in splicing is also postulated based on the subnuclear localization of WT1(+KTS) isoforms and the interaction of these isoforms with a splicing factor (7).
The wt1 gene product has been shown to mediate both transcriptional repression and activation (35). Experiments focusing on transcriptional regulation by WT1 mediated through Egr-1 consensus sites demonstrated that WT1 is capable of repressing transcription and that this effect is mediated by sequences within the amino-terminal domain (NTD) of WT1 (20). However, further characterization of the WT1 transcriptional properties and assessment of activity on putative cellular target genes revealed that WT1 may also activate transcription (43). Transcriptional regulation by WT1 appears complex, and a number of factors are known to influence WT1s ability to act as a repressor or activator (reviewed in Ref. 35). The transcriptional activity of WT1 can be modulated by interaction with several proteins: 1) the p53 tumor suppressor gene product (22); 2) the Par-4 (prostate apoptosis response-4) protein (10); 3) Ciao-1, a WD40 protein that decreases WT1s transcriptional activation properties but does not affect its repression activity (11); and 4) Hsp70, which may also play a role in the regulation of WT1 (21). The WT1 isoforms can also self-associate, and the domain required for this maps to the first 182 amino acids of WT1 (28, 36).
Candidate WT1 downstream targets (as determined by responsiveness of core promoter elements to exogenously supplied WT1 in transfection assays) include c-myc, epidermal growth factor receptor (EGFR), insulin-like growth factor-I receptor (IGF-IR), platelet-derived growth factor (PDGF-A), IGF-II, colony-stimulating factor (CSF-1), transforming growth factor-ß1 (TGF-ß1), epidermal growth receptor-1 (EGR1), Pax-2, c-myb, G-protein
i-2, Ki-ras, insulin receptor, p21, Nov-H, RAR-
, inhibin-
, syndecan-1, midkine, Dax-1, E-cadherin, wt1 (see Ref. 35 for a review on many of these targets), amphiregulin (17), bcl-2 (25), connective tissue growth factor (CTGF) (39), and the vitamin D receptor (VDR) (24). The activities of some of these gene products are associated with oncogenic potential (e.g., autocrine and paracrine growth factors), whereas others (e.g., Dax-1) are associated with development of the genital system. However, with the exception of a small number of these putative targets (bcl-2, EGFR, Dax-1, VDR, and amphiregulin), there are no supporting data that the endogenous promoters can be influenced by WT1, and one must regard the majority of these downstream targets with caution until these are better characterized.
In an attempt to identify endogenous WT1 target genes, we performed an expression array screen utilizing human embryonic kidney 293 cell lines expressing WT1 under control of tetracycline regulation. The major gene identified by our screen was the human VDR. During the course of these studies, Maurer et al. (24) identified the murine and human VDR as a downstream target of WT1. However, the WT1 binding site within the murine promoter is not present in the human counterpart. We therefore pursued detailed characterization of the human VDR promoter and found that activation of the human VDR gene is through a GC-rich binding site that significantly differs from the site identified upstream of the murine VDR gene by Maurer et al. (24). In addition, the presence of additional, nonfunctional WT1 binding sites within the VDR promoter suggests the existence of cis-regulatory factors/elements that provide additional selectivity. Our results also indicate that the human VDR gene represents a bona fide downstream target of the Wilms tumor suppressor gene and is activated differently than its murine counterpart.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-32P]ATP (6,000 Ci/mmol) and [
-32P]dCTP (3,000 Ci/mmol) were purchased from New England Nuclear. Preparation of plasmid DNA, restriction enzyme digestion, agarose gel electrophoresis of DNA, DNA ligation, and bacterial transformations were carried out using standard methods (Ref. 37 and references therein). Subclones of DNA PCR amplifications were always sequenced by the chain termination method using double-stranded DNA templates to ensure the absence of mutations.
Plasmid construction.
A portion of the human VDR promoter was cloned by PCR amplification from genomic DNA. The amplification primers used for this purpose were 1) 5'-th94 (5' GTTA
CTGCTGG-ATGATTTTGTGAGC 3'; XhoI site underscored) and 2) 3'-th95 (5' GTTA
AGA-CAGCCCAGCACCTGGCCC 3'; HindIII site underscored). The PCR product was digested with XhoI and HindIII and cloned into the same sites of the luciferase expression vector pGL-3 basic (Promega) to generate -960 phVDR/Luc.
Deletion constructs of the VDR promoter were prepared as follows. 1) For -436 phVDR/Luc, the corresponding fragment of the VDR promoter was generated by PCR using primers 5'-th96 (5' GTTA
CCGCCGGTGCCAGTCGCAGCG 3'; XhoI site underscored) and 3'-th95. The PCR product was digested with XhoI and HindIII, and introduced into the same sites of the luciferase expression vector pGL-3 basic. 2) For -354 phVDR/Luc, the corresponding fragment of the VDR promoter was generated by PCR using primers 5'-th97 (5' GTTA
CCTGGCTCAGGCGTCCGCAGC 3'; XhoI site underscored) and 3'-th95. The PCR product was introduced into the XhoI and HindIII sites of pGL-3 basic. 3) For -270 phVDR/Luc, the corresponding fragment of the VDR promoter was generated by PCR using primers 5'-th98 (5' GTTA
CGGGTATCCGCACCTATAATC 3'; XhoI site underscored) and 3'-th95. The fragment was digested with XhoI and HindIII and introduced into the same sites of pGL-3 basic. The VDR cDNA was cloned by RT-PCR amplification from 293 cell poly(A)+ RNA. The amplification primers used for this purpose were 1) 5'-th99 (5' GTTA
ATGGAGGCAATGGCGGCCAGC 3'; XhoI site underscored) and 2) 3'-th100 (5' GTTA
GGAGATCTCATTGCCAAACTCC 3'; HindIII site underscored). The PCR product was digested with XhoI and HindIII and cloned into the same sites of the pBluescript KS II+. WT1 expression vectors have already been described (32).
Cell culture, transfection, and luciferase assay.
293 and NIH 3T3 cell lines were maintained in DMEM supplemented with 10% heat-inactivated fetal calf serum (Life Technologies), penicillin, and streptomycin. For transient transfections, cells were plated at a density of 2 x 105 to 5 x 105 cells per 100-mm-diameter dish 24 h prior to transfection. The 293 cells were transfected by the calcium phosphate precipitation method (37), and NIH 3T3 cells were transfected using DMRIE-C reagent (Life Technologies). Unless stated otherwise, total DNA per plate of cells was 1 µg of pRSV/ß-gal vector, 1 µg of reporter plasmid, and 5 µg of expression vector. Individual DNA precipitates were adjusted to contain equal amounts of total DNA by the addition of the empty expression vector, pcDNA3. All transfections and subsequent luciferase assays were performed at least in duplicate. Cells were washed and refed 16 h posttransfection and harvested
48 h later. Luciferase activity was determined using the Promega luciferase assay kit. All luciferase activity values were normalized to ß-galactosidase values, which served as internal controls for the transfections.
cDNA array analysis.
An HEK293 cell line with WT1(+/-) under the regulation of the tetracycline-inducible expression system has been previously described (12). Differential hybridization analysis was performed utilizing Research Genetics cDNA array filters (GF200), containing 5,184 selected cDNAs spotted onto a nylon membrane. Poly(A)+ RNA was purified from 293/WT1(+/-) control cells or from 293/WT1(+/-) cells that had been exposed to 2 mM doxycycline for 36 h. cDNA probe preparation and hybridizations to filters were performed according to the manufacturers protocol (Research Genetics). Data was analyzed using Research Genetics Pathway software (version 2.01).
S1 nuclease analysis and Western blotting.
S1 nuclease analysis was used to assess the level of endogenous VDR mRNA produced upon induction of WT1 expression. Probes used in the S1 analysis were: 1) VDR-TH (5' CAGGGTCAGGCAGGGAAGTGCTGGCCGCCATTGCCTCCATAAAAAAA-AAA 3'), a 50-base oligonucleotide consisting of 40 nucleotides (+1 to +40 relative to the translation start site) complementary to the human VDR mRNA and 10 noncomplementary adenosine residues at the 3' end; 2) GAPDH-HIT(AS) (5' GGGGTCATTGATGGCAACAATATCCACTTTACCAGAGTTATTTTTTTTTT 3'), a 50-base probe containing 40 nucleotides complementary to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript (nucleotide +59 to +98 relative to the translation start site) and 10 noncomplementary thymidine residues at the 3' end; and 3) GAPDH-HIT(S) (5' GGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATAAAAAAAAA 3'), a 50-base oligonucleotide containing of 40 nucleotides from the sense strand of the GAPDH mRNA (nucleotide +59 to +98 relative to the translation start site) and 10 noncomplementary adenosine residues. Oligonucleotide probes were radiolabeled with [
-32P]ATP (6,000 Ci/mmol) and T4 polynucleotide kinase. S1 nuclease analyses with gel-purified probes were performed as described (37). Briefly, 10 µg (for human VDR) or 2.5 µg (for GAPDH control) of poly(A)+ RNA was ethanol precipitated with
30,000 cpm of radiolabeled probe, resuspended in 20 µl of S1 hybridization solution [80% deionized formamide, 40 mM PIPES (pH 6.4), 400 mM NaCl, and 1 mM EDTA (pH 8.0)], denatured at 90°C for 10 min, and hybridized at 30°C overnight. The samples were treated with 250 U of S1 nuclease (Boehringer) at 30°C for 60 min, ethanol precipitated, and analyzed on a 6% polyacrylamide (acrylamide/bisacrylamide ratio, 18:1)/8 M urea gel.
Total cell extracts for Western blot analysis were prepared by lysing 1.5 x 106 cells in 50 µl gel loading buffer [125 mM Tris·HCl (pH 6.8), 10% SDS, 20% glycerol, and 10% 2-mercaptoethanol]. Samples were boiled for 3 min, electrophoresed on SDS-10% polyacrylamide gels, then electroblotted onto an Immobilon-P membrane (Millipore). After blocking with 5% skim milk in PBST (80 mM Na2HPO4, 20 mM NaH2PO4, 100 mM NaCl, and 0.1% Tween-20), the membrane was incubated for 1 h with anti-WT1 (C-19), anti-VDR (C-20), or anti-Sp1 (PEP2) antibodies (1:1,000) (Santa Cruz Biotechnology). The membrane was washed in PBST, and antibody binding was visualized with peroxidase-conjugated donkey anti-rabbit secondary antibody (1:5,000) (Amersham) utilizing enhanced chemiluminescent (ECL) reagents (Amersham).
Electrophoretic mobility shift assays.
A truncated domain of the WT1 protein consisting of zinc fingers I to IV fused to a His6 tag has been previously described (12). Probes for electrophoretic mobility shift assays (EMSAs) were prepared from synthetically generated oligonucleotides. The sequences of the probes are as follows: 1) B1, 5' TCGATTACGCGA-TGCACG
GGGAAGGCGGAACTCGG 3' (two overlapping putative WT1 binding sites are shown, one underscored and the other in italics); 2) B2, 5' TCGAGGCCTGGTCAGCCCAG
ACGCACCTGGCTCAG 3' (the putative WT1 binding site is underscored); 3) B3, 5' TCGAGAACCACGGCAGGAA
GCTGCAT-CCCCGATTA 3'; 4) B1(m), 5' TCGATTACGCGATGCACG
GGGAAGGCGGAACTCGG 3' (the mutation introduced into the putative WT1 binding site is in boldface); 5) B2(m), 5' TCGAGGCCTGGTCAGCCCAG-
ACGCACCTGGCTCAG 3'; 6) B3(m), 5' TCGAGAACCACGGCAGGAA
GCTGCATCC-CCGATTA 3'; 7) WTE, 5' GAG
TAGAA 3' (the WT1 recognition site is underscored); and 8) WTE(m), 5' GAGT
TAGAA 3' (the altered nucleotide is indicated in boldface). Synthetic oligonucleotide probes to the VDR promoter region were labeled by back-filling with the Klenow fragment of DNA polymerase I using [
-32P]dCTP (New England Nuclear; 3,000 Ci/mmol). EMSAs were performed with recombinant WT1 zinc finger (WTZF) protein (-KTS isoform) for 20 min at room temperature in the presence of 50 mM HEPES (pH 7.5), 50 mM KCl, 5 mM MgCl2, 10 mM ZnSO4, 1 mM dithiothreitol (DTT), 12% glycerol, 2 µg poly[(dI·dC)·(dI·dC)], 100 ng pBluescript KS II+, and 20 mM spermidine. For competition experiments, reaction mixtures were preincubated for 15 min with unlabeled oligonucleotide prior to the addition of radiolabeled probes. Following binding, the reaction mixtures were electrophoresed on a 4% polyacrylamide gel (acrylamide/bisacrylamide ratio, 29:1) in 0.5x TBE (44.5 mM Tris·HCl, 44.5 mM boric acid, and 1 mM EDTA) buffer at 92 V for 1 h at 4°C. The gels were dried and exposed to Kodak X-Omat film at room temperature.
Nuclear run-on analysis.
Nuclei from 293 or 293/WT1(+/-) cells grown in the presence or absence of doxycycline were prepared by lysis in buffer A [0.3 M sucrose, 60 mM KCl, 15 mM NaCl, 15 mM HEPES (pH 7.5), 2 mM EDTA, 0.5 mM EGTA, 0.5 mM spermidine, 0.15 mM spermine, and 0.1% Nonidet P-40] and pelleted at 1,500 g. The nuclei (2 x 107) were frozen in 100 µl of storage buffer [50% glycerol, 20 mM Tris (pH 7.9), 75 mM NaCl, 0.5 mM EDTA, 0.85 mM DTT, 0.125 mM phenylmethylsulfonyl fluoride (PMSF), and 100 U/ml RNasin] at -70°C until ready for use. The elongation reaction was carried out in reaction buffer {0.3 M (NH4)2SO4, 100 mM Tris (pH 7.9), 4 mM MgCl2, 4 mM MnCl2, 50 mM NaCl, 0.4 mM EDTA, 0.1 mM PMSF, 1.2 mM dithiothreitol, 1 mM GTP, ATP, and CTP, 10 mM creatine-kinase, 20 U/ml RNasin, and 150 µCi [
-32P]UTP} for 30 min at 27°C, at which point 100 µg of carrier tRNA was added. The RNA was purified by DNase I and proteinase K digestion, phenol-chloroform extracted, and passed over a Sephadex G-50 spin column. To remove unincorporated [
-32P]UTP, 10% trichloroacetic acid (TCA) and 60 mM sodium pyrophosphate was added for 10 min, and the precipitate was collected by centrifugation. The RNA pellet was resuspended in 250 µl of 20 mM HEPES (pH 7.5)/5 mM EDTA, and 62.5 µl of 1 M NaOH was added followed by incubation on ice for 13 min, and then the hydrolysis reaction was stopped by adding 125 µl of 1 M HEPES (pH 5.5), followed by ethanol precipitation. Prehybridization of nitrocellulose filters were performed at 42°C overnight, then hybridized at 42°C for 40 h. Prehybridization and hybridization solutions consisted of 50 mM HEPES (pH 7.0), 0.75 M NaCl, 50% formamide, 0.5% SDS, 2 mM EDTA, 10x Denhardts solution, 500 µg/ml salmon sperm DNA, and 10 µg/ml poly(rA). Five washes with 0.1x SSC/0.1% SDS were performed at 65°C for 20 min each, and filters were exposed to X-ray film (X-OMAT, Kodak) with an intensifying screen.
Chromatin immunoprecipitation.
293/WT1(+/-) cells grown in the presence or absence of doxycycline were washed in PBS, and fixed in DMEM without serum containing 1% paraformaldehyde for 10 min at 37°C. The fixed cells were lysed in lysis buffer [25 mM HEPES (pH 7.4), 137 mM NaCl, 1% Triton X-100, 10% glycerol, 2.5 mM EDTA, 2.5 mM EGTA, 5 mM ß-glycerol phosphate, 1 mM Na3VO4, 1 µg/ml of aprotinin, 1 µg/ml of leupeptin, 1 µg/ml of prefaBloc, 1 µg/ml of pepstatin A, 1 µg/ml of 1-chloro-3-(4-tosylamido)-4-phenyl-2-butanone (TPCK), 1 µg/ml of 1-chloro-3-tosylamido-7-amino-L-2-heptanone (TLCK), 5 mM NaF, and 5 mM sodium pyrophosphate] and forcefully drawn into and out of a 21-gauge hypodermic needle three times. The chromatin was sonicated 10 times for 30 s, which sheared the chromatin into smaller fragments of 1.53.5 kb by digesting with SphI, HindIII, PstI, and EcoRI at 37°C for 6 h. Sheared chromatin lysed extracts were incubated with WT1 antibody (C19; Santa Cruz Biotechnology) overnight, and immune complex were collected with protein G-Sepharose beads at 4°C for 1 h. The collected precipitates were incubated at 42°C for 1 h with 100 µg of proteinase K. Finally, the samples were processed for DNA purification by passing them through QIAquick PCR purification columns (Qiagen). PCR amplification by Platinum High Fidelity Taq DNA polymerase was performed in 50 µl of supplemented buffer with either the immunoselected DNA or total genomic DNA. The nucleotide sequences of the primers used were as follows: 1) TB3F, 5' CACCTGGCTCAGGCGTCC 3'; 2) TB3R, 5' GCCAGGAGCTCCGTTGGC 3'; 3) ActinF, 5' CCCGCCCCCAATCCTCTTG 3'; and 4) ActinR, 5' AAGACCAGGCCTGGGGCG 3'. These primers were used at a final concentration of 0.8 µM. An initial incubation for 5 min at 94°C was followed by 30 cycles of denaturation for 1 min at 94°C, annealing for 1 min at 62°C , and elongation for 90 s at 68°C, with a final extension for 10 min at 68°C. PCR products were separated in 1.6% agarose gels and visualized by staining with ethidium bromide.
| RESULTS |
|---|
|
|
|---|
5,200 PCR products from selected IMAGE clones amplified using vector primers (Research Genetics). To test the reproducibility of the screen, the entire procedure was carried out on a second independently obtained poly(A)+ RNA preparation. Overall, we found that the expression of most genes assayed was not altered in response to WT1(+/-) (Fig. 1A). Approximately 1% of the cDNAs examined showed a change in expression of approximately threefold. Of the 46 putative differentially expressed genes, 28 were repressed by WT1(+/-) and 16 displayed activation (Table 1). No obvious alteration in expression profile of specific gene families by WT1(+/-) could be identified from the small gene set used in this experiment.
|
|
To more accurately measure the induction of endogenous VDR gene expression by WT1(+/-), S1 nuclease analyses were performed with complementary synthetic oligonucleotides targeting the VDR mRNA. To distinguish between undigested probe and protected probe, a 50-mer oligonucleotide containing 10 noncomplementary nucleotides (adenosine residues at the 3' end) was synthesized. Protection with this probe was observed only when it was hybridized to poly(A)+ RNA isolated from 293/WT1(+/-) cells grown in the absence of doxycycline [WT1(+/-) is induced under these conditions], but not when it was hybridized to poly(A)+ RNA from 293/WT1(+/-) cells grown in the presence of doxycycline, or when incubated with control tRNA (Fig. 2A). Sense and antisense probes against GAPDH were used as controls in these experiments, and this indicated that both samples contained equivalent amounts of GAPDH mRNA (Fig. 2B). The observed GAPDH signal was not due to DNA contamination of the RNA preparation, since it was not observed when a sense GAPDH oligonucleotide was utilized (Fig. 2B).
|
To demonstrate that WT1 was exerting its effect directly at the transcriptional level on the VDR promoter, we performed nuclear run-on analysis (Fig. 2D). Nuclei were isolated from 293 control cells or from 293/WT1(+/-) cells grown in the presence or absence of doxycycline, then allowed to continue transcription in the presence of [
-32P]UTP. RNA was isolated and hybridized to a series of immobilized cDNA probes. In this experiment, low levels of WT1(+/-) and VDR mRNA were detectable when hybridized to RNA from 293/WT1(+/-) cells grown in the presence of doxycycline [WT1(+/-) is repressed under these conditions] or to 293 control RNA (Fig. 2D). A sixfold increase of WT1 mRNA and a fourfold induction of VDR mRNA are observed in 293/WT1(+/-) cells grown in the absence of doxycycline [WT1(+/-) is activated under these conditions] (Fig. 2D). Human ß-actin was used as an internal standard in these experiments, and M13mp19 served as a negative control (Fig. 2D). Taken together, these results directly demonstrate transcriptional activation of the endogenous human VDR promoter in response to induction of WT1(+/-) expression.
Identification of the WT1-responsive sites in the human VDR promoter.
The sequence of the human VDR promoter has been previously reported (27). Inspection of the 960 nucleotides upstream of the transcription start site revealed the presence of four putative WT1 binding sites (5' GXGXGGGXG 3') (reviewed in Ref. 35). These elements were at position -701 to -601 (B1; 5'
GG 3', two overlapping putative WT1 binding sites are shown, one underscored and the other in italics), -369 to -361 (B2; 5' GTGGGGGTG 3'), and -308 to -300 (B3; 5' GGGTGGGGG 3'). To determine whether any of these sites could form specific complexes with WT1, a series of gel shift experiments were performed with synthetic oligonucleotides containing the B1, B2, or B3 sequence and recombinant WTZF(-KTS) protein. A single protein-DNA complex was obtained with oligonucleotides harboring the wild-type B1, B2, or B3 sequence (Fig. 3, AC). When the core motifs of B1, B2, and B3 were mutated, complex formation was abrogated with these mutant putative WT1 binding sites, indicating that sequence-specific WT1/DNA complexes can form at the B1, B2, and B3 sites (Fig. 3, DF).
|
AGAA 3', the WT1 binding site is underscored) containing a 10-bp optimized WT1 binding site, originally identified by using a whole-genome PCR selection assay and full-length WT1 protein (29). WT1 has 20-fold higher affinity for this site than for the consensus EGR-1 site (29). Binding of WT1 to the B1, B2, or B3 was abolished by increasing amounts of unlabeled WTE (Fig. 3, GI). In contrast, no competition was observed with up to 200-fold molar excess of a mutant WTE site, WTE(m) (5' GAGT
AGAA 3', the substitution is in boldface) (Fig. 3, JL). These observations indicate that WT1 can recognize the three sites within the human VDR promoter in a sequence-specific fashion. The next series of experiments were performed to determine which of these sites were functional in vivo.
Transcriptional activation of the VDR promoter by WT1.
During the course of these studies, Maurer et al. (24) reported that WT1 can activate the VDR gene. They identified a site (5' TGTGGGCG 3') within the murine VDR promoter that resides immediately upstream of four Sp1 sites and confers responsiveness to WT1 (24). This site, however, is not conserved in the human VDR promoter (which instead has 5' CTGTGGGCG 3' at position -77 to -71) and overlaps with one of the Sp1 sites (24). Considering that the murine site is not conserved in the human promoter and that the WT1 binding sites in our EMSAs differed from the one that Maurer et al. (24) reported for the murine promoter, we sought to better characterize activation of the human VDR gene by WT1.
To investigate whether all the WT1 binding sites within the human VDR promoter could equally mediate a transcriptional response to WT1, the human VDR promoter region was positioned upstream of the luciferase gene (Fig. 4A). A series of expression vectors driving the synthesis of four alternatively spliced WT1 isoforms and two Denys-Drash mutant alleles (harboring a missense mutation in zinc finger III, converting 394Arg to 394Trp) were also generated (Fig. 4A). Reporter and expression vectors were then introduced into 293 cells and assayed for luciferase activity. When -960 phVDR/Luc was transfected with the empty expression vector pcDNA3, very little luciferase activity was observed (Fig. 4B, "pcDNA3" lane). Transfection with CMV/WT1(-KTS) isoforms resulted in a 3.5-fold activation in luciferase activity (Fig. 4B). CMV/WT1(+KTS) isoforms or Denys-Drash mutants did not significantly affect transcription of the human VDR promoter (Fig. 4B). WT1(+/-) and WT1(-/-) did not activate transcription of the parental luciferase reporter vector lacking the human VDR promoter (Lee T and Pelletier J, data not shown). Thus activation by WT1(+/-) and WT1(-/-) was dependent on elements within the human VDR promoter. Cotransfection of increasing amounts of CMV/WT1(-/-) expression vector produced a dose-dependent increase in luciferase activity from the human VDR promoter (Fig. 4C). Western blotting of nuclear extracts from the transfected cells demonstrated that increasing amounts of CMV/WT1(-/-) were synthesized in response to increasing amounts of transfected plasmid (Fig. 4D). These results demonstrate that activation of VDR gene expression by WT1 is restricted to the -KTS isoforms.
|
394W) to a transfection containing constant amounts of CMV/WT1(-/-) resulted in progressive reduction in luciferase activity (Fig. 4E). Since WT1(-/-, 394R
394W) cannot bind to WT1 recognition elements and does not by itself affect VDR expression (Fig. 4B), the observed interference on transcriptional activation is likely mediated by sequestration of wild-type WT1(-/-) (2). To identify the WT1 binding site(s) within the VDR promoter that mediate transcriptional activation, deletion analyses of the promoter region was performed. We generated reporter constructs in which luciferase expression is driven by 436 bp of the human VDR promoter (-436 phVDR/Luc, which contains two putative WT1 binding sites from transcription start site), i.e., 354 bp (-354 phVDR/Luc, which contains one putative WT1 binding site) or 270 bp (-270 phVDR/Luc, which does not contain any putative WT1 binding sites). As shown in Fig. 5A, cotransfection of CMV/WT1(-/-) with -436 phVDR/Luc or -354 phVDR/Luc into 293 or NIH 3T3 cells produced the same levels of activation as when -960 phVDR/Luc was used as the reporter. However, when -270 phVDR/Luc was cotransfected with CMV/WT1(-/-), no activation of the human VDR promoter was observed. These results indicate that WT1 activates VDR transcription through sequences present in the VDR promoter residing between -354 and -270.
|
| DISCUSSION |
|---|
|
|
|---|
In this report, we have identified the human VDR gene as a downstream target of the WT1 tumor suppressor gene (Table 1 and Fig. 1). We confirmed this by RT-PCR, S1 analysis, and nuclear run-ons of VDR transcripts in 293 cells expressing or lacking WT1 (Figs. 1 and 2). Although the initial expression profiling experiment we performed identified 46 putatively differentially expressed transcripts (Table 1), RT-PCR analysis of several of these (GenBank accession nos. AA598508, T69522, H01030, H90855, and T52435) failed to confirm a difference in expression levels in 293 cells following induction of WT1 expression (Lee T and Pelletier J, data not shown). These discrepancies highlight the need for a second robust screen to confirm initial expression profiling results, as previously indicated (17).
Our results extend the initial findings of Maurer et al. (24), who defined a WT1 binding site within the murine and human VDR promoters. The site identified by Maurer et al. (24) is not conserved in the human VDR promoter. Although we functionally characterized three WT1-responsive elements within the human VDR promoter by EMSA, only one of these was found to be functional in transient transfection experiments (Figs. 35). Additionally, the ChIP assay indicated that WT1(+/-) was associated with the VDR promoter B3 (Fig. 5B). Taken together, these results suggest that WT1(-KTS) isoforms activate VDR transcription by binding to the B3 element at -308 to -300. The B3 element is distinct from the WT1-responsive element defined for the murine promoter (24). These results suggest that not all wt1 regulatory pathways may be conserved among species and may provide a molecular basis for the phenotypic differences between mice and humans heterozygous for the WT1 gene. Mice lacking one WT1 allele are not predisposed to Wilms tumors and have no urogenital defects (13), unlike humans with only one WT1 allele, who are predisposed to WTs and frequently have genital system anomalies (26). Although the basic mechanism for urogenital development has been conserved between mice and humans, specific pathways must have evolved to give rise to species-specific phenotypes. For example, human nephrogenesis is complete by
36 wk gestation, whereas new nephron formation continues in rodents into postnatal life. There is precedence for species-specific downstream targets of WT1, since we have previously reported that the human retinoic acid receptor-
is repressed by WT1, whereas the murine counterpart is not (9).
During the course of this work, Wagner et al. (41) reported that expression of the murine VDR promoter can be activated by both the WT1(-KTS) and WT1(+KTS) isoforms through a site (5' GTGGGCGTG 3') residing 115 bp upstream of exon 1. In our hands, WT1(+KTS) does not activate the human VDR promoter (Fig. 4B). This is consistent with a postulated role for the WT1(+KTS) isoforms in posttranscriptional regulation (15). We also found that a DDS allele of wt1 decreased WT1-mediated activation of the human VDR promoter (Fig. 4E). These results suggest that under certain conditions, these proteins may act as possible antagonists of WT1 function.
WT1 has an essential role in the development of the kidney. WT1 knockout mice result in embryonic lethality and fail to develop kidneys (13). Although WT1 and VDR are coexpressed in the same region of the kidney such as the ureteric bud, mesenchyme, S-shaped body, and glomerular epithelium in the embryonic stage, it is unlikely that VDR plays an critical role in differentiation and development during nephrogenesis, since VDR null mice do not have abnormal kidney development (5, 45).
The biological actions of 1,25-dihydroxyvitamin D3 [1,25(OH)2D3], the active form of the vitamin D, are mediated through its receptor. VDR is a ligand-activated transcriptional regulator belonging to the nuclear receptor superfamily (1). Activated VDR binds cooperatively to vitamin D response elements (VDREs) as a heterodimer with another member of the family, the retinoid X receptor (1, 4). VDREs have been identified in several genes regulated by 1,25(OH)2D3 that are involved in calcium and phosphorus homeostasis or bone metabolism. To date, 1,25(OH)2D3 has been found to inhibit proliferation, and induce differentiation of, leukemia cells. Vitamin D can also inhibit the proliferation of a number of other malignant cells, including breast, prostate, and colon cancer cells (4). In addition, known target genes of VDR regulation include the cell cycle inhibitor p21 (19) and p27 (38), perhaps accounting in part for the anti-proliferative effects of the VDR on some types of cells. It remains to be established whether VDR is deregulated in Wilms tumors harboring WT1 mutations. The high level of WT1 expression in most human acute leukemia raises the possibility that this tumor suppressor may also contribute to hematopoietic malignancies and, by implication, with normal hematopoiesis itself. A subset of acute leukemia,
10%, have inactivating mutations in WT1, whereas the majority express high levels of the wild-type transcripts (16). This discrepancy is similar to that observed with sporadic Wilms tumor. Thus the tumor suppressor action of WT1 could, in part, result from its maintenance of VDR expression. It remains to be established whether altered VDR expression may contribute to the etiology of Wilms tumors and/or acute leukemia.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Address for reprint requests and other correspondence: J. Pelletier, Dept. of Biochemistry, McIntyre Medical Sciences Bldg., McGill Univ., Rm. 810, 3655 Drummond St., Montreal, Quebec, Canada H3G 1Y6 (jerry@medcor.mcgill.ca).
physiolgenomics.00046.2001.
| REFERENCES |
|---|
|
|
|---|
gene by the Wilms tumor suppressor gene product, wt1. Oncogene 10: 11251129, 1995.[ISI][Medline]
This article has been cited by other articles:
![]() |
H.-S. Kim, M. S. Kim, A. L. Hancock, J. C. P. Harper, J. Y. Park, G. Poy, A. O. Perantoni, M. Cam, K. Malik, and S. B. Lee Identification of Novel Wilms' Tumor Suppressor Gene Target Genes Implicated in Kidney Development J. Biol. Chem., June 1, 2007; 282(22): 16278 - 16287. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Bor, J. Swartz, A. Morrison, D. Rekosh, M. Ladomery, and M.-L. Hammarskjold The Wilms' tumor 1 (WT1) gene (+KTS isoform) functions with a CTE to enhance translation from an unspliced RNA with a retained intron Genes & Dev., June 15, 2006; 20(12): 1597 - 1608. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Simpson, E. A. Burwell, K. A. Thompson, S. Shahnaz, A. R. Chen, and D. M. Loeb The antiapoptotic gene A1/BFL1 is a WT1 target gene that mediates granulocytic differentiation and resistance to chemotherapy Blood, June 15, 2006; 107(12): 4695 - 4702. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kuhlmann, C. S. Haas, M.-L. Gross, U. Reulbach, M. Holzinger, U. Schwarz, E. Ritz, and K. Amann 1,25-Dihydroxyvitamin D3 decreases podocyte loss and podocyte hypertrophy in the subtotally nephrectomized rat Am J Physiol Renal Physiol, March 1, 2004; 286(3): F526 - F533. [Abstract] [Full Text] |
||||
![]() |
M. T. Discenza and J. Pelletier Insights into the physiological role of WT1 from studies of genetically modified mice Physiol Genomics, February 13, 2004; 16(3): 287 - 300. [Abstract] |