Physiol. Genomics 5: 161-170, 2001;
Monitoring expression of genes involved in drug metabolism and toxicology using DNA microarrays
The sequences for twelve PM 25mer probes which yielded gene-specific hybridization for human CYP3A5 are listed in the table below. The corresponding MM oligonucleotides substitute the 13th base in each sequence with its complementary base. Bases in each CYP3A5 PM oligonucleotide which do not match the corresponding sequences in CYP3A4 or CYP3A7 are shown bolded or underlined, respectively.
CYP3A5
Probe |
Probe sequence |
| 3 |
GGTGGTGATTCCAACTTATGCTCTT
|
| 4 |
GGTGATTCCAACTTATGCTCTTCAC
|
| 5 |
GATTCCAACTTATGCTCTTCACCAT
|
| 6 |
AACTTATGCTCTTCACCATGACCCA
|
| 8 |
TGCTCTTCACCATGACCCAAAGTAC
|
| 15 |
AGAGCCTGAGGAGTTCCGCCCTGAA
|
| 16 |
TGAGGAGTTCCGCCCTGAAAGGTTC
|
| 25 |
CTTTGGAACTGGACCCAGAAACTGC
|
| 48 |
ACAGATCCCCTTGAAATTAGACACG
|
| 49 |
GATCCCCTTGAAATTAGACACGCAA
|
| 52 |
CACGCAAGGACTTCTTCAACCAGAA
|
| 53 |
GCAAGGACTTCTTCAACCAGAAAAA
|
"The following probe sequence information (the "Information") is available for internal research use only and not for commercial use. By using the Information, you agree to only use the Information for analysis of your gene expression experiments for your normal internal research purposes. You agree not to reverse engineer, deconstruct or otherwise attempt to discover any know-how embodied in the Information including without limitation probe design algorithms or probe array manufacturing, layout or sequence selection know-how. Except as expressly stated above or to the extent permitted by applicable law (but solely for the purpose(s) contemplated by such law), you may not copy (except to the extent necessary for your use of the Information as permitted above), modify, make derivative works of, reverse engineer, publicly display, distribute this Information to any person, firm, corporation or other entity, or use this Information in any other manner without prior written approval from Affymetrix, Inc. The Information is protected by copyright laws and international treaty provisions and may be protected by patent law(s) as well. No title to intellectual property is being transferred and, except for the limited right to use the Information as expressly stated above, you are not being granted any intellectual property rights in the Information or any know-how embodied therein. The Information is provided "as is." Affymetrix does not warrant that the Information will meet your requirements. The entire risk as to the quality and usefulness of the Information is borne by you. Except to the extent required by applicable law, Affymetrix makes no representations, warranties or conditions, express or implied, including but not limited to non-infringement, conformity to any representation or description, merchantability, satisfactory quality or fitness for a particular purpose. EXCEPT TO THE EXTENT REQUIRED BY APPLICABLE LAW, AFFYMETRIX WILL NOT BE LIABLE WITH RESPECT TO THE INFORMATION UNDER ANY CONTRACT, TORT (INCLUDING NEGLIGENCE), STRICT LIABILITY OR OTHER THEORY FOR INTERRUPTION OF USE OR FOR LOSS OR INACCURACY OR CORRUPTION OF DATA OR COST OF PROCUREMENT OF SUBSTITUTE GOODS, SERVICES OR TECHNOLOGY, OR FOR INDIRECT, INCIDENTAL, SPECIAL OR CONSEQUENTIAL DAMAGES, INCLUDING BUT NOT LIMITED TO LOST DATA OR LOST PROFITS, HOWEVER ARISING, EVEN IF AFFYMETRIX HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES.
Use of the Information Indicates your acknowledgment and acceptance of the foregoing terms."
Copyright © 2008 by the American Physiological Society.