Physiol. Genomics Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 4: 35-42, 2000;
1094-8341/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by WONG, V. Y.
Right arrow Articles by BROOKS, D. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by WONG, V. Y.
Right arrow Articles by BROOKS, D. P.
Received 23 March 2000; accepted in final form 29 August 2000.
Physiological Genomics 4:35-42 (2000)
1094-8341/00 $5.00 © 2000 American Physiological Society

Gene expression in rats with renal disease treated with the angiotensin II receptor antagonist, eprosartan

VICTORIA Y. WONG, NICHOLAS J. LAPING, LISA C. CONTINO, BARBARA A. OLSON, EUGENE GRYGIELKO and DAVID P. BROOKS

Department of Renal Pharmacology, SmithKline Beecham Pharmaceuticals, King of Prussia, Pennsylvania 19406


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The role of ANG II on renal and cardiac gene expression of matrix proteins was studied in rats with progressive renal disease. Induction of renal failure by five-sixths nephrectomy of Sprague-Dawley rats resulted in hypertension (163 ± 19 vs. control pressures of 108 ± 6 mmHg), proteinuria (83 ± 47 vs. 14 ± 2 mg/day), and increased renal expression of fibronectin, thrombospondin, collagen I and III, transforming growth factor-ß (TGF-ß), and plasminogen activator inhibitor-1 (PAI-1) mRNA. Treatment with the ANG II receptor antagonist, eprosartan (60 mg·kg-1·day-1), lowered blood pressure (95 ± 5 mmHg) and proteinuria (19 ± 8 mg/d) and abrogated the increased TGF-ß, fibronectin, thrombospondin, collagens I and III, and PAI-1 mRNA expression. An increase in left ventricular weight was observed in five-sixths nephrectomized rats (0.13 ± 0.01 vs. 0.08 ± 0.01 g/100 g body wt), a response that was inhibited by eprosartan treatment (0.10 ± 0.01 g/100 g). Left ventricular expression of TGF-ß and fibronectin was also increased in rats with renal disease; however, the small decreases in expression observed in eprosartan-treated rats did not reach statistical significance. These data suggest that eprosartan may be beneficial in progressive renal disease and that the mechanism of action includes inhibition of cytokine production in addition to antihypertensive activity.

transforming growth factor-ß; renal disease; plasminogen activator inhibitor-1


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
ANGIOTENSIN II plays an important role in the long-term regulation of blood pressure; however, activation of the renin-angiotensin system and generation of the effector peptide ANG II has also been implicated in the progression of renal and cardiac diseases. There is growing evidence that the mechanisms by which the renin-angiotensin system contributes to disease progression involve organ and vascular remodeling in addition to the well-known vasoconstrictor activity. One of the main features of renal and cardiac remodeling is fibrosis, which is a complex process involving a number of different matrix proteins. In addition, there are cytokines involved in promoting matrix production, most notably transforming growth factor-ß (TGF-ß) (29), as well as genes involved in inhibiting the breakdown of matrix, for example, plasminogen activator inhibitor-1 (PAI-1). There is evidence that angiotensin can stimulate the production of both TGF-ß (11, 18) and PAI-1 (14); however, it is unclear whether ANG IV or ANG II is more important in the PAI-1 response (20).

The present study was performed to determine whether a selective ANG II receptor antagonist, administered at a dose effective in attenuating renal disease-induced hypertension and proteinuria, would alter the expression of genes associated with renal and cardiac fibrosis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
All procedures conformed to National Institutes of Health guidelines and were approved by the institutional Animal Care and Use Committee. Male Sprague-Dawley rats with initial body weights of ~250 g were used. Five-sixths nephrectomy was performed under pentobarbital anesthesia and sterile conditions. Via a midline incision, the right kidney was removed, and two of the three blood vessels supplying the left kidney were ligated, leaving approximately one-sixth of functioning kidney. Sham surgery was performed by making a midline incision but leaving both kidneys intact. Three weeks following surgery, rats were placed in the metabolism cages to collect 24-h urine samples. Following collection, urine was stored at -20°C prior to assay. Urinary protein concentration was determined using the sulfosalicylic acid method (7), and 24-h urinary protein excretion was calculated. Systolic blood pressure was determined using tail plethysmography.

Starting 3 wk after 5/6 nephrectomy, eprosartan was administered for 4 wk intraperitoneally (~60 mg·kg-1·day-1) using two Alzet model 2 ML4 osmotic mini-pumps (Alza, Palo Alto, CA). Pumps containing vehicle were installed in control animals. Urinary protein excretion and systolic blood pressure were determined weekly for 3 wk following initiation of eprosartan treatment, at which time animals were killed and the kidneys and left ventricle were harvested. Tissues were dissected, weighed, frozen in liquid nitrogen, and stored at -80°C until RNA extraction. Total RNA was prepared from frozen tissues by guanidinium thiocyanate denaturation. RNA, 10 µg, was electrophoresed on 1% agarose gel after glyoxalation for 1 h at 55°C. RNA was transferred to BrightStar-plus nylon membrane (Ambion). Radiolabeled probes were synthesized using the random-primed DECAprime II (Ambion). Hybridization was performed with the radiolabeled probe at 42°C overnight in 50% formamide, 5x SSPE, 2.5x Denhardt, 0.1% SDS, 100 µg/ml salmon sperm DNA, and 10 g dextran sulfate. Membranes were washed with 0.1x SSPE/0.1% SDS at 65°C and were exposed to a phosphor imaging plate. Data were quantified with ImageQuant software (Molecular Dynamics).

The probe for ribosomal protein L32 (RPL32) was generated by PCR as described by Wang et al. in 1995 (34). The probe for thrombospondin (TSP1) was generated from a 450-bp PCR fragment of TSP1 cDNA (26) and was cloned into the PCR II vector using the TA cloning kit (Invitrogen). The probe for fibronectin was generated from a 500-bp PCR fragment of fibronectin cDNA and was cloned similarly. The 450-bp rat PAI-1 probe was purchased from ATCC (Manassas, VA). The 728-bp PCR fragment of TGF-ß1 cDNA was generated from the TGF-ß1 full-length clone provided by Dr. Nancy Nichols.

The expression of collagen I and collagen III was evaluated by quantitative RT-PCR using the Taqman Realtime PCR 7700 system (PE Applied Biosystems, Foster City, CA). cDNA was synthesized from 2 µg of total RNA and diluted 20-fold. A 25-µl reaction volume containing 200 nM primers, 200 nM probe, and Master Mix (PE Applied Biosystems) was mixed with 2 µl diluted cDNA and amplified by PCR. The thermal cycle conditions consisted of initial incubation steps of 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, and 60°C for 1 min. The primer sequences for rat collagen I were as follows: probe, FAM-TTGCATAGCTCGCCATCGCACA-TAMRA; forward, TATGCTTGATCTGTATGTGCCACAAT; and reverse, TCGCCCTCCCGTTTTTG. The primer sequences for rat collagen III were as follows: probe, FAM-CTTTCCAGCCGGGCCTCCCAG-TAMRA; forward, CAGCTGGCCTTCCTCAGACT; and reverse, TGCTGTTTTTGCACTGGTATGTAA. The primer sequences for rat RPL 32 were as follows: probe, TET-AGGCATCGACAACAGGGTGCGG-TAMRA; forward, GAAACTGGCGGAAACCGA; and reverse, GGATCTGGCCCTTGAATCTTC.

Data are expressed as means ± SE, throughout. Statistical analysis was conducted using an ANOVA of repeated measures and subsequently a Scheffé F test. Expression data were analyzed using a one-way ANOVA and subsequently a Scheffé F test.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Partial renal ablation resulted in the development of hypertension and proteinuria (Fig. 1). Thus mean systolic blood pressure was over 160 mmHg in rats 3 wk following surgery compared with control values of ~100 mmHg. Urinary protein excretion, which was ~10 mg/day in control animals, increased to over 60 mg/day in rats with renal disease. Treatment with eprosartan resulted in a significant reduction in proteinuria and systolic blood pressure such that after 3 wk of treatment, both parameters were close to those observed in sham animals (Fig. 1). Five-sixths nephrectomy resulted in a 60% increase in left ventricular weight, a response that was abrogated but not abolished by eprosartan treatment (Table 1).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. Effect of eprosartan (EPRO, 60 mg·kg-1·day-1) on systolic blood pressure (SBP, top) and urinary protein excretion (UPROTV, bottom) in rats following 5/6 nephrectomy (NX) or sham surgery (n = 5–6 rats/group). *P < 0.05 vs. time 0. {dagger}P < 0.05 vs. vehicle.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Body weight and left ventricular weight of 5/6 nephrectomized rats or control rats treated with eprosartan

 
Renal expressions of TGF-ß (Fig. 2) and fibronectin (Fig. 3) were significantly elevated in 5/6 nephrectomized rats, and this response was abolished by eprosartan treatment (Fig. 2). Renal TGF-ß and fibronectin expression also appeared to be slightly lower in sham-operated rats treated with eprosartan (Figs. 2 and 3). Renal thrombospondin (Fig. 4), PAI-1 (Fig. 5), clusterin (Fig. 6), and collagens I and III (Fig. 7) mRNA levels were all significantly higher in rats following 5/6 nephrectomy. Eprosartan treatment resulted in significantly lower expression of all three.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 2. Effect of eprosartan (60 mg·kg-1·day-1) on transforming growth factor-ß (TGF-ß) mRNA expression following 5/6 nephrectomy or sham surgery. Equal loading of gels was determined using expression of ribosomal protein L32 (RPL32). *P < 0.05 vs. sham. {dagger}P < 0.05 vs. vehicle (VEH).

 


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 3. Effect of eprosartan (60 mg·kg-1·day-1) on fibronectin (FN) expression following 5/6 nephrectomy or sham surgery. Equal loading of gels was determined using expression of ribosomal protein L32. *P < 0.05 vs. sham. {dagger}P < 0.05 vs. vehicle.

 


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 4. Effect of eprosartan (60 mg·kg-1·day-1) on thrombospondin (TSN) expression following 5/6 nephrectomy or sham surgery. Equal loading of gels was determined using expression of ribosomal protein L32. *P < 0.05 vs. sham. {dagger}P < 0.05 vs. vehicle.

 


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 5. Effect of eprosartan (60 mg·kg-1·day-1) on plasminogen activator inhibitor-1 (PAI-1) expression following 5/6 nephrectomy or sham surgery. Equal loading of gels was determined using expression of ribosomal protein L32. *P < 0.05 vs. sham. {dagger}P < 0.05 vs. vehicle.

 


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 6. Effect of eprosartan (60 mg·kg-1·day-1) on clusterin expression following 5/6 nephrectomy or sham surgery. Equal loading of gels was determined using expression of ribosomal protein L32. *P < 0.05 vs. SHAM. {dagger}P < 0.05 vs. vehicle.

 


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 7. Effect of eprosartan (60 mg·kg-1·day-1) on collagen I (top) and collagen III (bottom) following 5/6 nephrectomy or sham surgery as determined using quantitative polymerase chain reaction. *P < 0.05 vs. sham. {dagger}P < 0.05 vs. vehicle.

 
Cardiac changes in gene expression were not as dramatic as the renal changes. There were significant increases of TGF-ß and fibronectin in the left ventricle (Figs. 8 and 9); however, these responses were not altered by eprosartan to a degree that reached statistical significance (Figs. 8 and 9).



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 8. Effect of eprosartan (60 mg·kg-1·day-1) on cardiac gene expression following 5/6 nephrectomy (right) or sham surgery (left).

 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 9. Quantification of cardiac gene expression (factored by RPL32 expression) in rats following 5/6 nephrectomy or sham surgery. *P < 0.05 vs. sham.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the present study we have observed that progressive renal disease and hypertension induced by 5/6 nephrectomy was associated with increased cardiac and/or renal expression of TGF-ß, fibronectin, thrombospondin, PAI-1, clusterin, and collagens I and III mRNA and that treatment with the ANG II receptor antagonist, eprosartan (5, 9), at a dose that attenuated the hypertension and proteinuria, resulted in a significant reduction in the renal expression of these genes.

It is becoming apparent that the mechanisms involved in the progression of renal disease may not be solely due to the increased glomerular hypertension that is secondary to ANG II-induced preferential efferent arteriolar vasoconstriction. This is an attractive hypothesis supported by a number of different studies (2, 8); however, others have suggested that increased matrix production rather than glomerular hypertension may be important (38). Thus ANG II, in addition to its powerful vasoconstrictor effects, is able to stimulate the expression and/or production of a number of important profibrotic factors including TGF-ß and PAI-1 (11, 18). TGF-ß may be the single most important cytokine involved in enhanced matrix formation, because it is able to enhance both matrix protein synthesis and lead to inhibition of matrix breakdown (29). Our observation that blockade of the renin-angiotensin system with an AT1 receptor antagonist can attenuate the enhanced TGF-ß and matrix protein expression in renal disease is consistent with previous reports in a number of models of renal disease including partial nephrectomy (1, 17, 24, 36), immune-mediated renal injury (15, 37), mesangioproliferative glomerulonephritis (22, 39), hypertension-induced renal disease (25, 27, 35), unilateral ureteral obstruction (16), and cyclosporine nephrotoxicity (31). The possible role of ANG II in regulating PAI-1 expression in renal disease, however, is less well characterized. PAI-1 is a serine protease inhibitor involved in the fast inhibition of tissue plasminogen activator and is produced by vascular endothelial cells and to a lesser extent by hepatocytes and platelets. In addition to being a prothrombotic factor, PAI-1, by virtue of its ability to inhibit matrix breakdown, is a potential mediator of fibrosis. The increased expression of PAI-1 observed in the present study is consistent with glomerular fibrosis observed in this model (4) as well as the presence of proteinuria. Indeed, it has been observed that circulating PAI-1 is increased in diabetic patients with albuminuria and that this is secondary to endothelial damage (13). The increased renal expression of PAI-1 following 5/6 nephrectomy suggests that it may play a role in glomerulosclerosis associated with progressive renal disease. Such a role is supported by our observation that the ANG II receptor antagonist, eprosartan, attenuated PAI-1 expression in addition to reducing proteinuria.

Inhibition of PAI-1 expression by an angiotensin type 1 (AT1) receptor antagonist provides further evidence for a role of the renin-angiotensin system in the regulation of the plasminogen/plasmin system. It has previously been demonstrated that ANG IV stimulates PAI-1 expression in mesangial cells (19) and induces both PAI-1 expression and PAI-1 production in cultured endothelial cells (32). It has been proposed, however, that angiotensin-induced PAI-1 production and expression in vitro may be mediated by a receptor distinct from the AT1 receptor, because the response cannot be inhibited by the AT1-selective antagonist Dup-753 (losartan) (32). Furthermore, the hexapeptide ANG IV has been shown to induce PAI-1 expression in endothelial cells (20) and proximal tubule epithelial cells (10). This response may involve the putative AT4 receptor, which has been identified using ANG IV binding activity in rat kidneys (14) and rabbit cardiac fibroblasts (33). Our data, however, do not support a major role for ANG IV in inducing cardiac or renal PAI-1 expression in vivo. Thus the increased PAI-1 expression induced in the kidney by 5/6 nephrectomy was abolished by treatment with eprosartan. Eprosartan is a selective AT1 receptor antagonist with no affinity for the putative AT4 ANG IV receptor (R. M. Edwards, unpublished observations).

It is unclear from the present study whether the inhibition of PAI-1 expression by eprosartan is an effect involving blockade of ANG II on PAI-1 expression or an indirect effect involving TGF-ß expression. In vitro, ANG II can result in both a rapid and prolonged increased in PAI-1 expression (19). The prolonged, but not the rapid, increase in PAI-1 expression can be blocked by a neutralizing antibody to TGF-ß (19). It is possible, therefore, that the reduction in PAI-1 expression observed in the present study may be mediated, in part, by an indirect effect involving reduced TGF-ß expression. Similarly, thrombospondin and TGF-ß have been shown to enhance each other’s synthesis or activation (6, 12, 23, 28, 30), suggesting that the effect of ANG II blockade on thrombospondin expression is secondary to the effect on TGF-ß. Nonetheless, this interaction highlights the feed-forward system that magnifies profibrotic mechanisms and how they can be interrupted using appropriate reagents.

In the present study, we observed a significant cardiac hypertrophy as evidenced by a 60% increase in left ventricular weight 4 wk following 5/6 nephrectomy. Our observation that eprosartan treatment prevented this supports the important role that the renin-angiotensin system plays in cardiac hypertrophy. Our data are consistent with a previous report evaluating an angiotensin receptor antagonist in rats with renal failure (24) and the observation that ANG II-selective antagonism can inhibit TGF-ß gene expression and extracellular matrix in cardiac and vascular tissues of stroke-prone spontaneously hypertensive rats (21). It should be noted, however, that the changes in gene expression in the heart were less dramatic than the ones observed in the kidney and that the effects of eprosartan were modest; indeed, they did not reach statistical significance with the exception of PAI-1 mRNA, which was actually highest in the eprosartan-treated group. The reason for this is unclear. The reason for a greater response to eprosartan in the kidney may be due to higher local ANG II levels and thus a greater local effect. It is possible that a longer period of observation may have revealed a greater cardiac response; however, in the short term, the renin-angiotensin system appears to have a greater effect on renal remodeling than cardiac remodeling.

It is unclear from the present study what contribution the lowering of blood pressure had toward the reduction in expression of TGF-ß, PAI-1, and the matrix proteins. If the effects of ANG II on these components are indeed receptor mediated, then it is unlikely that they can be separated from the blood pressure lowering effects. The observation that cardiac gene expression was reduced to a lesser extent than the renal expression suggests that mechanisms other than a reduction in blood pressure are indeed involved. Consistent with this is the observation that carvedilol can reduce the renal damage in the spontaneously hypertensive stroke-prone rat without lowering blood pressure (3), indicating that a decrease in blood pressure is not necessary for renal protection. It is interesting that we have recently observed that carvedilol reduces renal TGF-ß mRNA expression in spontaneously hypertensive stroke-prone rats treated with carvedilol (Wong et al., unpublished observations).

In summary, the data provided in this study provide further evidence that the beneficial effects of blocking the renin-angiotensin system involve effects on extracellular matrix components as well as cytokines that modulate extracellular matrix.


    ACKNOWLEDGMENTS
 
We are grateful to Maria McDevitt for preparing this manuscript.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: D. P. Brooks, SmithKline Beecham Pharmaceuticals, 709 Swedeland Road, PO Box 1539, King of Prussia, PA 19406-0939.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Ali SM, Laping NJ, Fredrickson TA, Contino LC, Olson BA, Anderson K, and Brooks DP. Angiotensin-converting enzyme inhibition attenuates proteinuria and renal TGF-ß1 mRNA expression in rats with chronic renal disease. Pharmacology 57: 20–27, 1998.[ISI][Medline]
  2. Anderson S, Rennke HG, and Brenner BM. Therapeutic advantage of converting enzyme inhibitors in arresting progressive renal disease associated with systemic hypertension in the rat. J Clin Invest 7: 1993–2000, 1986.
  3. Barone FC, Nelson AH, Ohlstein EH, Willette RN, Sealey JE, Laragh JH, Campbell WG Jr, and Feuerstein GZ. Chronic carvedilol reduces mortality and renal damage in hypertensive stroke-prone rats. J Pharmacol Exp Ther 270: 948–955, 1996.
  4. Brenner BM. Nephron adaptation to renal injury or ablation. Am J Physiol Renal Fluid Electrolyte Physiol 249: F324–F337, 1985.[Abstract/Free Full Text]
  5. Brooks DP, Fredrickson TA, Weinstock J, Ruffolo RR Jr, Edwards RM, and Gellai M. Antihypertensive activity of the nonpeptide angiotensin II receptor antagonist, SK&F 108566, in rats and dogs. Naunyn-Schmiedebergs Arch Pharmacol 345: 673–678, 1992.[Medline]
  6. Claisse D, Martiny I, Chaqour B, Wegrowski Y, Petitfrere E, Schneider C, Haye B, and Bellon G. Influence of transforming growth factor beta 1 (TGF-beta 1) on the behaviour of porcine thyroid epithelial cells in primary culture through thrombospondin-1 synthesis. J Cell Sci 112: 1405–1416, 1999.[Abstract]
  7. Davidsohn L and Henry JB. Clinical Diagnosis by Laboratory Methods (14th ed.). Philadelphia: Saunders, 1969, p. 48.
  8. Edwards RM. Segmental effects of norepinephrine and angiotensin II on isolated renal microvessels. Am J Physiol Renal Fluid Electrolyte Physiol 244: F526–F534, 1983.[Abstract/Free Full Text]
  9. Edwards RM, Aiyar N, Ohlstein EH, Weidley EF, Griffin E, Ezekiel M, Keenan RM, Ruffolo RR, and Weinstock J. Pharmacological characterization of the nonpeptide angiotensin II receptor agonist, SK&F 108566. J Pharmacol Exp Ther 260: 175–181, 1992.[Abstract/Free Full Text]
  10. Gesualdo L, Ranieri E, Monno R, Rossiello MR, Colucci M, Semeraro N, Grandaliano G, and Schena FP. Angiotensin IV stimulates plasminogen activator inhibitor-1 expression in proximal tubular epithelial cells. Kidney Int 56: 461–470, 1999.[ISI][Medline]
  11. Gibbons GH, Pratt RE, and Dzau VJ. Vascular smooth muscle cell hypertrophy vs. hyperplasia: autocrine transforming growth factor-ß1 expression determines growth response to angiotensin II. J Clin Invest 90: 456–461, 1992.
  12. Go C, Li P, and Wang XJ. Blocking transforming growth factor beta signaling in transgenic epidermis accelerates chemical carcinogenesis: a mechanism associated with increased angiogenesis. Cancer Res 59: 2861–2868, 1999.[Abstract/Free Full Text]
  13. Gruden G, Cavallo-Perin P, Bazzan M, Stella S, Vuolo A, and Pagano G. PAI-1 and factor VII activity are higher in IDDM patients with microalbuminuria. Diabetes 43: 426–429, 1994.[Abstract]
  14. Handa RK, Krebs LT, Harding JW, and Handa SE. Angiotensin IV AT4-receptor system in the rat kidney. Am J Physiol Renal Physiol 274: F290–F299, 1998.[Abstract/Free Full Text]
  15. Hisada Y, Sugaya T, Yamanouchi M, Uchida H, Fujimura H, Sakurai H, Fukamizu A, and Murakami K. Angiotensin II plays a pathogenic role in immune-mediated renal injury in mice. J Clin Invest 103: 627–635, 1999.[ISI][Medline]
  16. Ishidoya S, Morrissey J, McCracken R, Reyes A, and Klahr S. Angiotensin II receptor antagonist ameliorates renal tubulointerstitial fibrosis caused by unilateral ureteral obstruction. Kidney Int 47: 1285–1294, 1995.[ISI][Medline]
  17. Junaid A, Rosenberg ME, and Hostetter TH. Interaction of angiotensin II and TGF-ß1 in the rat remnant kidney. J Am Soc Nephrol 8: 1732–1738, 1997.[Abstract]
  18. Kagami S, Border WA, Miller DE, and Noble NA. Angiotensin II stimulates extracellular matrix protein synthesis through induction of transforming growth factor-ß expression in rat glomerular mesangial cells. J Clin Invest 93: 2431–2437, 1994.
  19. Kagami S, Kuhara T, Okada K, Kuroda Y, Border WA, and Noble NA. Dual effects of angiotensin II on the plasminogen/plasmin system in rat mesangial cells. Kidney Int 51: 664–671, 1997.[ISI][Medline]
  20. Kerins DM, Hao Q, and Vaughan DE. Angiotensin induction of PAI-1 expression in endothelial cells is mediated by the hexapeptide angiotensin IV. J Clin Invest 96: 2515–2520, 1995.
  21. Kim S, Ohta K, Hamaguchi A, Omura T, Yukimura T, Miura K, Inada Y, Ishimura Y, Chatani F, and Iwao H. Angiotensin II type I receptor antagonist inhibits the gene expression of transforming growth factor-ß1 and extracellular matrix in cardiac and vascular tissues of hypertensive rats. J Pharmacol Exp Ther 273: 509–515, 1995.[Abstract/Free Full Text]
  22. Nakamura T, Obata J, Onizuka M, Kimura H, Ohno S, Yoshida Y, Kawachi H, and Shimizu F. Candesartan prevents the progression of mesangioproliferative nephritis in rats. Kidney Int 63: S226–S228, 1997.
  23. Negoescu A, Lafeuillade B, Pellerin S, Chambaz EM, and Feige JJ. Transforming growth factors beta stimulate both thrombospondin-1 and CISP/thrombospondin-2 synthesis by bovine adrenocortical cells. Exp Cell Res 217: 404–409, 1995.[ISI][Medline]
  24. Noda M, Matsuo T, Fukuda R, Ohta M, Nagano H, Shibouta Y, Naka T, Nishikawa K, and Imura Y. Effect of candesartan cilexetil (TCV-116) in rats with chronic renal failure. Kidney Int 56: 898–909, 1999.[ISI][Medline]
  25. Obata J, Nakamura T, Kuroyanagi R, Yoshida Y, Guo DF, and Inagami T. Candesartan prevents the progression of glomerulosclerosis in genetic hypertensive rats. Kidney Int 63: S229–S231, 1997.
  26. Olson BA, Day JR, and Laping NJ. Age-related expression of renal thrombospondin 1 mRNA in F344 rats: Resemblance to diabetes-induced expression in obese Zucker rats. Pharmacology 58: 200–208, 1999.[ISI][Medline]
  27. Otsuka F, Yamauchi T, Kataoka H, Mimura Y, Ogura T, and Makino H. Effects of chronic inhibition of ACE and AT1 receptors on glomerular injury in Dahl salt-sensitive rats. Am J Physiol Regulatory Integrative Comp Physiol 274: R1797–R1806, 1998.[Abstract/Free Full Text]
  28. Ribeiro SMF, Poczatek M, Schultz-Cherry S, Villain M, and Murphy-Ullrich JE. The activation sequence of thrombospondin-1 interacts with the latency-associated peptide to regulate activation of latent transforming growth factor-beta. J Biol Chem 274: 13586–13593, 1999.[Abstract/Free Full Text]
  29. Roberts AM, McCune BK, and Sporn MB. Transforming growth factor ß: regulation of extracellular matrix. Kidney Int 41: 557–559, 1992.[ISI][Medline]
  30. Schultz-Cherry S, Chen H, Mosher DF, Misenheimer TM, Krutzsch HC, Roberts DD, and Murphy-Ullrich JE. Regulation of transforming growth factor-ß activation by discrete sequences of thrombospondin 1. J Biol Chem 270: 7304–7310, 1995.[Abstract/Free Full Text]
  31. Shihab FS, Bennett WM, Tanner AM, and Andoh TF. Angiotensin II blockade decreases TGF-ß1 and matrix proteins in cyclosporine nephropathy. Kidney Int 52: 660–673, 1997.[ISI][Medline]
  32. Vaughan DE, Lazos SA, and Tong K. Angiotensin II regulates the expression of plasminogen activator inhibitor-1 in cultured endothelial cells. J Clin Invest 95: 995–1001, 1995.
  33. Wang L, Eberhard M, and Erne P. Stimulation of DNA and RNA synthesis in cultured rabbit cardiac fibroblasts by angiotensin IV. Clin Sci (Colch) 88: 557–562, 1995.[Medline]
  34. Wang X, Yue TL, Barone FC, and Feuerstein GZ. Demonstration of increased endothelial-leukocyte adhesion molecule-1 mRNA expression in rat ischemic cortex. Stroke 26: 1665–1669, 1995.[Abstract/Free Full Text]
  35. Wolf G, Schneider A, Wenzel U, Helmchen U, and Stahl RA. Regulation of glomerular TGF-beta expression in the contralateral kidney of two-kidney, one-clip hypertensive rats. J Am Soc Nephrol 9: 763–772, 1998.[Abstract]
  36. Wu LL, Cox A, Roe CJ, Dziadek M, Cooper ME, and Gilbert RE. Transforming growth factor beta 1 and renal injury following subtotal nephrectomy in the rat: role of the renin-angiotensin system. Kidney Int 51: 1553–1567, 1997.[ISI][Medline]
  37. Yayama K, Makino J, Takano M, and Okamoto H. Role of angiotensin II in the transforming growth factor-beta 1 expression of rat kidney in anti-glomerular basement membrane antiserum-induced glomerulonephritis. Biol Pharm Bull 18: 687–690, 1995.[Medline]
  38. Yoshida Y, Kawamura T, Ikoma M, Fogo A, and Ichikawa I. Effects of antihypertensive drugs on glomerular morphology. Kidney Int 36: 626–635, 1989.[ISI][Medline]
  39. Zoja C, Abbate M, Corna D, Capitanio M, Donadelli R, Bruzzi I, Oldroyd S, Benigni A, and Remuzzi G. Pharmacologic control of angiotensin II ameliorates renal disease while reducing renal TGF-ß in experimental mesangioproliferative glomerulonephritis. Am J Kidney Dis 31: 453–463, 1998.[ISI][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
D. Bertram, N. Blanc-Brunat, J. Sassard, and M. Lo
Differential evolution of blood pressure and renal lesions after RAS blockade in Lyon hypertensive rats
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2002; 283(5): R1041 - R1045.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. T. Abrahamsen, F. C. Barone, W. G. Campbell Jr., A. H. Nelson, L. C. Contino, M. A. Pullen, E. T. Grygielko, R. M. Edwards, N. J. Laping, and D. P. Brooks
The Angiotensin Type 1 Receptor Antagonist, Eprosartan, Attenuates the Progression of Renal Disease in Spontaneously Hypertensive Stroke-Prone Rats with Accelerated Hypertension
J. Pharmacol. Exp. Ther., April 1, 2002; 301(1): 21 - 28.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by WONG, V. Y.
Right arrow Articles by BROOKS, D. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by WONG, V. Y.
Right arrow Articles by BROOKS, D. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online