Physiol. Genomics 35: 30-35, 2008.
First published July 22, 2008; doi:10.1152/physiolgenomics.90270.2008
1094-8341/08 $8.00
Received 10 June 2008;
accepted in final form 16 July 2008.
Physiological Genomics 35:30-35 (2008)
1094-8341/08 $8.00 © 2008 American Physiological Society
Call For Papers: Comparative Genomics
Nephron deficit is not required for progressive proteinuria development in the Munich Wistar Frömter rat
Angela Schulz
1,
Jonna Hänsch
1,
Kristina Kuhn
1,
Maria Schlesener
1,
Peter Kossmehl
1,
Jens R. Nyengaard
2,
Norbert Wendt
1,
Matthias Huber
1 and
Reinhold Kreutz
1
1 Department of Clinical Pharmacology and Toxicology, CharitéCentrum für Therapieforschung, Charité - Universitätsmedizin Berlin, Berlin, Germany
2 Stereology and Electron Microscopy Research Laboratory and MIND Center, University of Aarhus, Aarhus, Denmark
 |
ABSTRACT
|
|---|
The Munich Wistar Frömter (MWF) rat represents a genetic model with an inherited nephron deficit and exhibits mild hypertension and progressive albuminuria, which is more pronounced in males than females. Previously, we demonstrated in a consomic strain that replacement of a quantitative trait locus on chromosome 6 normalized the nephron deficit and suppressed albuminuria development, suggesting a link between the two findings. Here we tested the role of a second major locus linked to albuminuria in MWF on chromosome 8 and generated the consomic strain MWF-8SHR by transfer of chromosome 8 from spontaneously hypertensive rats (SHR) into MWF. The early onset of albuminuria at 8 wk of age in MWF (>50-fold increase compared with SHR) was significantly suppressed in consomic animals, and the development of marked proteinuria at 32 wk significantly diminished. Total nephron number in consomic rats (23,771 ± 1,352) and MWF (27,028 ± 1,322) were similar and significantly lower (–36%) compared with SHR (36,979 ± 1,352, P < 0.0001). The development of mild albuminuria in female MWF was also significantly diminished in MWF-8SHR. Thus, the development of overt and mild albuminuria in male and female MWF rats is not a mandatory consequence of the inherited nephron deficit. The locus on chromosome 8 appears of interest, because its exchange between MWF and SHR protects against the development of albuminuria in MWF-8SHR animals despite their inherited nephron deficit and higher systolic blood pressure.
genetics; kidney; albuminuria; gender; consomic rat
 |
INTRODUCTION
|
|---|
ARTERIAL HYPERTENSION AND chronic kidney disease in adulthood may result from adverse environmental stimuli disturbing normal fetal development in utero, i.e., a phenomenon termed developmental or fetal programming (1, 11, 19). Fetal programming has been also linked to a congenital deficit in nephron number, which may represent a common basis for the predisposition to arterial hypertension and chronic kidney disease in adult life (19, 31). As early as two decades ago Brenner et al. (2) proposed that a congenital deficit in nephron number would cause a predisposition to the development of hypertension and salt sensitivity. In addition, functional and structural kidney damage with albuminuria and glomerulosclerosis have been attributed to maladaptive mechanisms that occur as a response to the reduction of the total glomerular filtration surface in states with congenital nephron (glomeruli) deficit (2, 31). The Munich Wistar Frömter (MWF) rat represents a genetic model that supports this concept (4, 14). Hence, MWF rats demonstrate a congenital reduction of nephron number in the order of 30–50% (4, 26) and develop salt-sensitive spontaneous hypertension (14). In addition, MWF develop an early increase in albuminuria and progressive proteinuria as well as glomerulosclerosis with age (4, 26). Interestingly, despite the fact that the nephron deficit is similar in male and female MWF animals (4) they demonstrate a sex-specific difference in the development of progressive albuminuria and glomerulosclerosis, which is much more pronounced in males (4, 24). In previous work we showed that the development of overt and mild albuminuria in males and females is markedly suppressed in the consomic MWF-6SHR strain (26). In this consomic strain we replaced a major albuminuria quantitative trait locus (QTL) by transfer of rat chromosome (RNO) 6 from albuminuria-resistant spontaneously hypertensive rat (SHR) into the MWF genetic background (24, 26). Importantly, the congenital nephron deficit of MWF was also abolished by transfer of RNO6, which thus provided further evidence for a pathophysiological link between the inherited nephron deficit and albuminuria development in MWF. These findings might implicate that the manifestation of progressive albuminuria in adult MWF rats may involve the perinatal programming of low nephron number (1, 11, 19, 31).
However, in previous linkage studies we identified another important QTL on RNO8 linked to albuminuria in MWF (25). We therefore set out to analyze the role of this second major locus for the development of the congenital nephron deficit and progressive albuminuria in MWF.
 |
MATERIALS AND METHODS
|
|---|
Animals.
All rats were obtained from our MWF/Rkb and SHR/Rkb colonies (laboratory code Rkb, http://dels.nas.edu/ilar/) at the Charité, Campus Benjamin Franklin, Germany. Rats were grouped under conditions of regular 12 h diurnal cycles using an automated light switching device and climate-controlled conditions at a room temperature of 22°C. The rats were fed a normal diet containing 0.2% NaCl and had free access to food and water.
Development of the consomic strain MWF-8SHR and F1 (MWF x MWF-8SHR) hybrids.
The consomic strain MWF-8SHR was generated by sequential marker assisted backcrossing in accordance with our linkage results (25) introgressing the whole RNO8 from SHR into the isogenic MWF background as previously described (26). The purity of the consomic MWF-8SHR strain was confirmed by total genome screen analysis with 240 microsatellite markers (23).
F1 (MWF x MWF-8SHR) hybrid animals were derived from an intercross between male MWF and female consomic MWF-8SHR rats. These animals carry a heterozygous genotype on RNO8, i.e., one allele derived from SHR and one from MWF rats, whereas all other chromosomes showed homozygosity for the MWF allele.
Blood pressure measurements.
Systolic blood pressure (SBP) was measured in male and female parental MWF (n = 18–19, each) and SHR (n = 10, each) animals, and data were compared with male and female consomic MWF-8SHR (n = 20, each), respectively. SBP was determined by a tail-cuff method in awake animals at 14 and 24 wk of age, respectively, using a computer-assisted oscillatory detection device (TSE, Bad Homburg, Germany) (14). In brief, training sessions were carried out for 2 days at each occasion and followed by measurements on three consecutive days. Each session included three sets of two measurements, so that a minimum of 12 and maximum of 18 measurements were used for the determination of the SBP of each rat.
Time course analysis for urinary albumin excretion.
To analyze the role of RNO8 for the development of albuminuria in male and female MWF-8SHR (n = 20, each) and F1 (MWF x MWF-8SHR) hybrid rats (n = 10, each) we performed time-course analysis for urinary albumin excretion (UAE) at 8, 14, 18, and 24 wk of age compared with the UAE development of male and female MWF (n = 18–19, each) and SHR (n = 10, each) animals (26). All SHR and 10 animals of the MWF and consomic MWF-8SHR strain of either sex, respectively, were killed at 24 wk of age for further laboratory analyses. The remaining MWF-8SHR, MWF, and F1 were followed to 32 wk of age for a final UAE determination. For urine analysis animals were placed in metabolic cages for 2 days. The first day was used for adaptation and urine was collected for the last 24 h for UAE and biochemistry analysis. UAE was measured with a rat-specific ELISA-technique as previously described (14).
Further laboratory analyses.
Blood, heart, and kidney were harvested from animals at 24 wk for biochemistry and histological analyses for the determination of glomerular damage index (GSI), tubulointerstitial damage index (TDI), renal interstitial fibrosis (RIF), and numbers of superficial and surface glomeruli as reported (25).
For the determination of glomerular number in consomic MWF-8SHR one kidney of seven male animals at 4 wk of age were used after perfusion fixation with 4% phosphate-buffered formaldehyde. The kidney was dehydrated in graded ethanol and embedded in glycolmethacrylate (Technovite 7100; Hereus Kulzer, Wehrheim, Germany). Histological sections were performed as previously described (26), and the number of glomeruli was estimated by the physical fractionator (10) as reported (26). The total number of glomeruli in consomic animals was compared with the numbers recently obtained in age-matched MWF and SHR, respectively (26).
RNA was isolated from kidneys by the TRIzol reagent (Invitrogen, Karlsruhe, Germany) according to the manufacturer's instructions and was resuspended in DEPC-treated H2O. First strand cDNA synthesis was carried out on 2 µg of total RNA in a 20 µl reaction using the First Strand cDNA Synthesis Kit (Fermentas Life Sciences, St. Leon-Rot, Germany) following the manufacturer's recommendations. In parallel, samples without the reverse transcriptase were performed as RT-PCR minus controls. To quantify mRNA expression in kidney we employed real-time quantitative RT PCR. Collagen III was analyzed as previously described (26). In addition, we determined mRNA expression of renal neutrophil gelatinase-associated lipocalin (NGAL; GenBank accession number NM_130741) as a molecular marker reflecting renal tubular injury (22). For NGAL mRNA quantification real-time PCR reactions (SYBR Green PCR Master Mix, Applied Biosystems, Foster City, CA) were completed with the following primer sets in a concentration of 100 nM (TIB Molbiol, Berlin, Germany): 18S forward: GGAGCCTGCGGCTTAATTT, 18S reverse: CAACTAAGAACGGCCATGCA, NGAL forward: GGCCGACACTGACTACGACC, NGAL reverse: GCCCCTTGGTTCTTCCGTAC. All qRT-PCR were performed in triplicate and cycling conditions were the same for all primer sets: 95°C for 10 min and 40 cycles of 95°C for 15 s, 60°C for 1 min. No template controls and RT-PCR minus controls did not show relevant fluorescent signals. 18S RNA served as the endogenous control to normalize the amount of cDNA added to each reaction and the comparative Ct method was employed for further analysis.
Statistical analysis.
Statistical analysis was performed using one-way ANOVA followed by Bonferroni's adjustment and by nonparametric Mann-Whitney U-test. Data are presented as means ± SE and P values <0.05 were considered significant.
 |
RESULTS
|
|---|
Time-course effects.
Already, the early >50-fold increase in UAE detected in male MWF at 8 wk of age was significantly suppressed in male MWF-8SHR (18.1 ± 2.0 vs. 2.6 ± 0.6 mg/24h, P < 0.0001), while the SHR reference strain still demonstrated lower UAE levels (0.3 ± 0.1 mg/24 h, P < 0.0001; Fig. 1A) compared with MWF-8SHR. Further time-course analysis between weeks 8 and 32 revealed a significantly attenuated increase of UAE in male consomic animals in contrast to the progressive increase in albuminuria of MWF (Fig. 1A). Between 18 and 32 wk of age male consomic animals reached a plateau in UAE of
20 mg/24 h, while male MWF demonstrated a markedly elevated UAE at 32 wk, which was about
15-fold higher compared with male MWF-8SHR (P < 0.0001, Fig. 1A).

View larger version (8K):
[in this window]
[in a new window]
|
Fig. 1. Time-course analysis of urinary albumin excretion (UAE) in male (A) and female (B) in SHR (white bars), MWF (black bars), consomic MWF-8SHR (gray bars), and F1 (MWF x MWF-8SHR, slashed bars) at 8, 14, 18, 24, and 32 wk of age. *P < 0.0001 compared with MWF-8SHR and SHR, respectively, #P < 0.001 compared with SHR, ##P < 0.05 compared with MWF-8SHR, respectively; n. d., not determined.
|
|
The early onset of increased UAE observed at 8 wk of age in female MWF compared with SHR (5.2 ± 0.9 vs. 0.1 ± 0.01 mg/24 h; P < 0.0001; Fig. 1B) was fully suppressed in female consomic animals (0.4 ± 0.1 mg/24 h). Time-course analysis demonstrated that the progressive increase of UAE with age was also significantly diminished compared with female MWF at all time points investigated (P < 0.0001, respectively; Fig. 1B).
Heterozygotes vs. homozygotes.
The analysis of F1 hybrids of either sex demonstrated significantly higher UAE levels in male F1 hybrids at all time points except at 8 wk of age compared with male consomic animals (P < 0.05, respectively), while no significant differences were observed between female F1 and female MWF-8SHR animals (Fig. 1, A and B).
Sexual dimorphisms.
No significant differences in body weight were observed between strains and sex (Table 1). Overall, relative kidney weight in relation to body weight was lower in male MWF and consomic MWF-8SHR compared with SHR (Table 1). In male animals no significant strain differences in serum creatinine and creatinine clearance were observed (Table 1). In female animals serum creatinine concentrations were similar between MWF and consomic MWF-8SHR and significantly higher than in SHR (P < 0.002), while creatinine clearance was higher in consomic MWF-8SHR compared with MWF (Table 1). Serum urea concentrations were higher in both male and female MWF and consomic MWF-8SHR animals compared with SHR; a significant difference between MWF and MWF-8SHR was only observed in males (Table 1).
View this table:
[in this window]
[in a new window]
|
Table 1. Overall characteristics of parental male and female MWF, SHR, and consomic MWF-8SHR rats at 24 wk of age
|
|
SBP was significantly higher in both male and female consomic MWF-8SHR compared with sex-matched MWF (P < 0.05, respectively) with the exception that SBP values obtained at 24 wk of age were similar in females of both strains (Fig. 2, A and B). No significant SBP differences were detected between male and female MWF, while a sexual dimorphism was observed with a significant elevation of SBP values in male SHR and consomic MWF-8SHR (P < 0.0001, respectively) compared with the corresponding female rats (Fig. 2, A and B). In agreement with the SBP data, male MWF-8SHR demonstrated also a significantly elevated left ventricular weight to body weight ratio (P = 0.02, Table 1).

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 2. Systolic blood pressure (SBP) in male (A) and female (B) spontaneously hypertensive rats (SHR), Munich Wistar Frömter rats (MWF), and consomic MWF-8SHR rats at 14 (white bars) and 24 wk (black bars) of age. *P < 0.0001 vs. age-matched SHR; #P < 0.05 compared with age-matched SHR and MWF, respectively.
|
|
The determination of the mean total glomerular number per kidney in young male consomic MWF-8SHR at 4 wk of age revealed an even somewhat lower number of 23,771 ± 1,352 compared with the recently characterized MWF (27,028 ± 1,322) (26); however, this difference was not significant (P = 0.57). Thus, both MWF and consomic animals exhibit a significant nephron deficit compared with SHR (36,979 ± 1,352, P < 0.0001).
The data for histology analysis in adult male and female animals obtained at 24 wk of age are summarized in Table 2. GSI as well as the amount of RIF were similar between male MWF and male consomic animals (Table 2) and thus significantly more pronounced than in SHR. MWF and MWF-8SHR exhibited a significant sexual dimorphism with regard to the renal injury parameters with significantly lower values in female animals (P < 0.05, respectively). While glomerular injury score was similar between female MWF and MWF-8SHR, the percentage of RIF was significantly lower in the consomic strain (Table 2, P < 0.005). The TDI was not significantly different between male MWF and consomic animals and thus significantly more pronounced than in SHR (P < 0.01; Fig. 3A). Accordingly, the expression of NGAL was also similar in MWF and consomic MWF-8SHR animals and thus significantly elevated compared with SHR (P < 0.01; Fig. 3B). Furthermore, the mRNA expression of collagen III was overall significantly higher in males compared with female animals (P < 0.05, Table 2). The increase in collagen III mRNA expression observed in both male and female MWF was significantly attenuated in consomic animals, respectively (Table 2).

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 3. Tubulointerstitial damage index (TDI; A) and renal neutrophil gelatinase-associated lipocalin (NGAL) mRNA expression in kidney (B) of male SHR, MWF, and consomic MWF-8SHR rats at 24 wk of age. *P < 0.01 vs. other groups, respectively.
|
|
 |
DISCUSSION
|
|---|
In a previous study we documented a profound effect of a QTL on RNO6 for the development of progressive albuminuria in the MWF model (26). This finding and particularly the fact that the early increase in albuminuria in young animals at 8 wk of age was completely suppressed were somewhat surprising in light of the polygenetic determination of albuminuria in MWF (23, 25). Nevertheless, the fact that replacement of the QTL on RNO6 eliminated at the same time the inherited nephron deficit of MWF provided a plausible functional explanation for the strong protective effect observed by targeting the QTL on this chromosome (26). This observation supported the concept that the adaptation to the inherited nephron deficit represents an important prerequisite for albuminuria development in MWF.
In this report we show in adult animals at 24 wk of age, that replacement of RNO8 in the MWF-8SHR consomic strain induced a comparable relative albuminuria reduction of 87 and 90% in male and female animals compared with parental MWF, respectively. This effect was similar to the reduction of 90 and 93% previously observed after transfer of RNO6 in male and female consomic MWF-6SHR in which the nephron number was, however, normalized to SHR levels (26). Although small blood pressure differences obtained by tail cuff measurements should be judged with caution (16) we detected higher SBP values in MWF-8SHR consomic animals, particularly in males, compared with MWF. This may be attributable to blood pressure increasing SHR alleles of a QTL on RNO8 that has been introgressed in the MWF genome by transfer of this chromosome. Therefore, the reduction of UAE in MWF-8SHR compared with the parental MWF strain cannot be explained by a blood pressure-lowering effect of RNO8 from SHR. This finding provides, however, further support for the important functional role of the albuminuria QTL on RNO8, because its replacement with SHR alleles protects against progressive albuminuria development despite the nephron deficit and higher blood pressures. The role of genetic factors affecting the course of renal damage in states with low nephron number has been also supported by the observation that inbred mouse strains show varying susceptibilities to the development of kidney injury after subtotal nephrectomy (21).
Unlike albuminuria, the development of the moderate glomerular and tubulointerstitial injury as well as interstitial fibrosis in male MWF animals was not significantly affected by transfer of RNO8. This was supported by the finding obtained for NGAL expression, which is significantly upregulated in MWF-8SHR compared with SHR, but similar to MWF, indicating renal injury in the both the MWF and consomic strain (22). Only collagen III mRNA expression was somewhat reduced in both male and female MWF-8SHR compared with MWF, respectively. The lack of effect on glomerular and tubulointerstitial kidney damage is at variance with the MWF-6SHR strain in which both glomerulosclerosis and tubulointerstitial damage were significantly lowered in male consomic animals by transfer of RNO6 compared with MWF (26). The protective effect of RNO6 transfer on renal structural damage in male animals may therefore be related to the normalization of the nephron deficit rather than the suppression of albuminuria, since the latter was also achieved by transfer of RNO8 while the former was not.
To investigate the mode of inheritance, i.e., a gene dosage effect of the SHR allele at a single albuminuria QTL, we analyzed F1 hybrid animals derived from MWF and consomic MWF-8SHR animals. Interestingly, F1 hybrids revealed a significant gene dosage effect in male but not in female rats. The F1 hybrids carry a heterozygous genotype on RNO8, i.e., they carry one allele from SHR and one from MWF. In young male animals at 8 wk of age no significant difference in albuminuria between F1 hybrids and consomic animals was observed. In contrast, starting from 14 wk of age, male F1 animals exhibited albuminuria levels that were significantly higher than in MWF-8SHR, indicating that replacement of both MWF alleles on RNO8 confers a stronger protection in aging animals with nephron deficit than replacement of only one allele. In female animals with mild albuminuria, however, replacement of one allele in F1 or two alleles in consomic MWF-8SHR animals resulted in an overall similar protection at all time points. The finding in female F1 animals and the data observed in young males are therefore compatible with previous data demonstrating overall recessive effects of albuminuria susceptibility genes (5, 9, 18, 23, 25, 27, 28). However, the data in older males demonstrate that gene dosing effects on albuminuria are context dependent and are possibly influenced by factors related to aging and sex status.
Via linkage analysis or more recently genome-wide association studies, multiple chromosomal regions and some candidate genes have been linked to albuminuria in arterial hypertension and most frequently in Type 2 diabetes mellitus (6–8, 12, 13, 15, 17). In a multiethnic family study on the genetic basis of diabetic nephropathy, a suggestive linkage was found to albuminuria (measured as urinary albumin to creatinine ratio) on human chromosome 15q26.3 (13), which maps, however, outside the 15q22–15q25 region that corresponds to the albuminuria QTL on RNO8 (25). Nevertheless, as recently demonstrated in the polygenetic Fawn-hooded rat model with spontaneous hypertension and kidney disease, experimental studies in the rat can lead to the identification of new targets for albuminuria such as Rab38 (20) and stimulate the analysis of the corresponding gene in human (29).
Consomic strains are important for the confirmation of QTL effects detected by mapping studies, but their power for gene identification is limited (3). The latter has to be achieved by further narrowing of the QTL region in congenic substrains in subsequent studies. Nevertheless, our current results highlight the complexity of the genetic basis of albuminuria and the potential of experimental work to elucidate important common disease pathways for albuminuria. Due to the fact that the QTL region on RNO6 and RNO8 is large, as expected from our QTL mapping studies, this implies for us a rationale to develop congenic rats carrying smaller intervals, thereby reducing the number of genes within the QTL on RNO6 and RNO8 for the identification of the most important underlying causative genetic factors.
Taken together with our previous work on RNO6 (26), these results demonstrate that targeting either of two major albuminuria QTL on RNO6 or RNO8 results in similar profound and exchangeable beneficial effects on albuminuria development in adult animals with hypertension. We also show that the manifestation of albuminuria in adult life may or may not involve the perinatal programming of low nephron number. We hypothesize that the two identified QTL may work through a common or complementary disease pathway affecting albuminuria development in hypertension. The characterization of the latter may lead to the identification of potential diagnostic and therapeutic targets for the protection of albuminuria and associated cardiovascular disease (30).
 |
GRANTS
|
|---|
This study was supported by Deutsche Forschungsgemeinschaft Grant KR1152-3-1.
 |
ACKNOWLEDGMENTS
|
|---|
We acknowledge the contributions of Sabine Wunderlich and Claudia Plum for laboratory assistance, of Norbert Hinz for histological assistance, and of Bettina Bublath for support in animal breeding.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: A. Schulz, Dept. of Clinical Pharmacology and Toxicology, Charité - Universitätsmedizin Berlin, Garystr. 5, 14195 Berlin, Germany (e-mail: angela.schulz{at}charite.de).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- BarkerDJ, Osmond C, Golding J, Kuh D, Wadsworth ME. Growth in utero, blood pressure in childhood and adult life, and mortality from cardiovascular disease. BMJ 298: 564–567, 1989.[Abstract/Free Full Text]
- BrennerBM, Garcia DL, Anderson S. Glomeruli and blood pressure. Less of one, more the other? Am J Hypertens 1: 335–347, 1988.[Web of Science][Medline]
- CowleyAW Jr, Liang M, Roman RJ, Greene AS, Jacob HJ. Consomic rat model systems for physiological genomics. Acta Physiol Scand 181: 585–592, 2004.[CrossRef][Web of Science][Medline]
- FassiA, Sangalli F, Maffi R, Colombi F, Mohamed EI, Brenner BM, Remuzzi G, Remuzzi A. Progressive glomerular injury in the MWF rat is predicted by inborn nephron deficit. J Am Soc Nephrol 9: 1399–1406, 1998.[Abstract]
- FogartyDG, Hanna LS, Wantman M, Warram JH, Krolewski AS, Rich SS. Segregation analysis of urinary albumin excretion in families with type 2 diabetes. Diabetes 49: 1057–1063, 2000.[Abstract]
- FoxCS, Yang Q, Guo CY, Cupples LA, Wilson PW, Levy D, Meigs JB. Genome-wide linkage analysis to urinary microalbuminuria in a community-based sample: the Framingham Heart Study. Kidney Int 67: 70–74, 2005.[CrossRef][Web of Science][Medline]
- FreedmanBI, Beck SR, Rich SS, Heiss G, Lewis CE, Turner S, Province MA, Schwander KL, Arnett DK, Mellen BG. A genome-wide scan for urinary albumin excretion in hypertensive families. Hypertension 42: 291–296, 2003.[Abstract/Free Full Text]
- FreedmanBI, Bowden DW, Rich SS, Xu J, Wagenknecht LE, Ziegler J, Hicks PJ, Langefeld CD. Genome-wide linkage scans for renal function and albuminuria in Type 2 diabetes mellitus: the Diabetes Heart Study. Diabet Med 25: 268–276, 2008.[CrossRef][Web of Science][Medline]
- GarrettMR, Dene H, Rapp JP. Time-course genetic analysis of albuminuria in Dahl salt-sensitive rats on low-salt diet. J Am Soc Nephrol 14: 1175–1187, 2003.[Abstract/Free Full Text]
- GundersenHJ. Stereology of arbitrary particles. A review of unbiased number and size estimators and the presentation of some new ones, in memory of William R Thompson. J Microsc 143: 3–45, 1986.[Medline]
- HershkovitzD, Burbea Z, Skorecki K, Brenner BM. Fetal programming of adult kidney disease: cellular and molecular mechanisms. Clin J Am Soc Nephrol 2: 334–342, 2007.[Free Full Text]
- HwangSJ, Yang Q, Meigs JB, Pearce EN, Fox CS. A genome-wide association for kidney function and endocrine-related traits in the NHLBI's Framingham Heart Study. BMC Med Genet 8, Suppl 1: S10, 2007.[CrossRef][Medline]
- IyengarSK, Abboud HE, Goddard KA, Saad MF, Adler SG, Arar NH, Bowden DW, Duggirala R, Elston RC, Hanson RL, Ipp E, Kao WH, Kimmel PL, Klag MJ, Knowler WC, Meoni LA, Nelson RG, Nicholas SB, Pahl MV, Parekh RS, Quade SR, Rich SS, Rotter JI, Scavini M, Schelling JR, Sedor JR, Sehgal AR, Shah VO, Smith MW, Taylor KD, Winkler CA, Zager PG, Freedman BI. Genome-wide scans for diabetic nephropathy and albuminuria in multiethnic populations: the family investigation of nephropathy and diabetes (FIND). Diabetes 56: 1577–1585, 2007.[Abstract/Free Full Text]
- KreutzR, Kovacevic L, Schulz A, Rothermund L, Ketteler M, Paul M. Effect of high NaCl diet on spontaneous hypertension in a genetic rat model with reduced nephron number. J Hypertens 18: 777–782, 2000.[CrossRef][Web of Science][Medline]
- KrolewskiAS, Poznik GD, Placha G, Canani L, Dunn J, Walker W, Smiles A, Krolewski B, Fogarty DG, Moczulski D, Araki S, Makita Y, Ng DP, Rogus J, Duggirala R, Rich SS, Warram JH. A genome-wide linkage scan for genes controlling variation in urinary albumin excretion in type II diabetes. Kidney Int 69: 129–136, 2006.[CrossRef][Web of Science][Medline]
- KurtzTW, Griffin KA, Bidani AK, Davisson RL, Hall JE. Recommendations for blood pressure measurement in humans and experimental animals: part 2: blood pressure measurement in experimental animals: a statement for professionals from the Subcommittee of Professional and Public Education of the American Heart Association Council on High Blood Pressure Research. Arterioscler Thromb Vasc Biol 25: e22–e33, 2005.[Abstract/Free Full Text]
- LeonJM, Freedman BI, Miller MB, North KE, Hunt SC, Eckfeldt JH, Lewis CE, Kraja AT, Djousse L, Arnett DK. Genome scan of glomerular filtration rate and albuminuria: the HyperGEN study. Nephrol Dial Transplant 22: 763–771, 2007.[Abstract/Free Full Text]
- MatsuyamaM, Ogiu T, Kontani K, Yamada C, Kawai M, Hiai H, Nakamura T, Shimizu F, Toyokawa T, Kinoshita Y. Genetic regulation of the development of glomerular sclerotic lesions in the BUF/Mna rat. Nephron 54: 334–337, 1990.[Web of Science][Medline]
- NuytAM. Mechanisms underlying developmental programming of elevated blood pressure and vascular dysfunction: evidence from human studies and experimental animal models. Clin Sci (Lond) 114: 1–17, 2008.[Medline]
- Rangel-FilhoA, Sharma M, Datta YH, Moreno C, Roman RJ, Iwamoto Y, Provoost AP, Lazar J, Jacob HJ. RF-2 gene modulates proteinuria and albuminuria independently of changes in glomerular permeability in the fawn-hooded hypertensive rat. J Am Soc Nephrol 16: 852–856, 2005.[Free Full Text]
- SalzlerHR, Griffiths R, Ruiz P, Chi L, Frey C, Marchuk DA, Rockman HA, Le TH. Hypertension and albuminuria in chronic kidney disease mapped to a mouse chromosome 11 locus. Kidney Int 72: 1226–1232, 2007.[CrossRef][Web of Science][Medline]
- Schmidt-OttKM, Mori K, Li JY, Kalandadze A, Cohen DJ, Devarajan P, Barasch J. Dual action of neutrophil gelatinase-associated lipocalin. J Am Soc Nephrol 18: 407–413, 2007.[Abstract/Free Full Text]
- SchulzA, Litfin A, Kossmehl P, Kreutz R. Genetic dissection of increased urinary albumin excretion in the Munich Wistar Fromter rat. J Am Soc Nephrol 13: 2706–2714, 2002.[Abstract/Free Full Text]
- SchulzA, Schlesener M, Weiss J, Hansch J, Wendt N, Kossmehl P, Grimm D, Vetter R, Kreutz R. Protective effect of female gender on the development of albuminuria in a polygenetic rat model is enhanced further by replacement of a major autosomal QTL. Clin Sci (Lond) 114: 305–311, 2008.[Medline]
- SchulzA, Standke D, Kovacevic L, Mostler M, Kossmehl P, Stoll M, Kreutz R. A major gene locus links early onset albuminuria with renal interstitial fibrosis in the MWF rat with polygenetic albuminuria. J Am Soc Nephrol 14: 3081–3089, 2003.[Abstract/Free Full Text]
- SchulzA, Weiss J, Schlesener M, Hansch J, Wehland M, Wendt N, Kossmehl P, Sietmann A, Grimm D, Stoll M, Nyengaard JR, Kreutz R. Development of overt proteinuria in the Munich Wistar Fromter rat is suppressed by replacement of chromosome 6 in a consomic rat strain. J Am Soc Nephrol 18: 113–121, 2007.[Abstract/Free Full Text]
- ShiozawaM, Provoost AP, van Dokkum RP, Majewski RR, Jacob HJ. Evidence of gene-gene interactions in the genetic susceptibility to renal impairment after unilateral nephrectomy. J Am Soc Nephrol 11: 2068–2078, 2000.[Abstract/Free Full Text]
- StellaP, Cusi D, Duzzi L, Bianchi G. Relations between hypertension and glomerulosclerosis in first-generation hybrid rats of the Milan strains. Child Nephrol Urol 11: 6–9, 1991.[Web of Science][Medline]
- StollM, Kwitek-Black AE, Cowley AWJ, Harris EL, Harrap SB, Krieger JE, Printz MP, Provoost AP, Sassard J, Jacob HJ. New target regions for human hypertension via comparative genomics. Genome Res 10: 473–482, 2000.[Abstract/Free Full Text]
- WeirMR. Microalbuminuria and cardiovascular disease. Clin J Am Soc Nephrol 2: 581–590, 2007.[Abstract/Free Full Text]
- Zandi-NejadK, Luyckx VA, Brenner BM. Adult hypertension and kidney disease: the role of fetal programming. Hypertension 47: 502–508, 2006.[Abstract/Free Full Text]
Copyright © 2008 by the American Physiological Society.