Physiol. Genomics Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 34: 277-284, 2008. First published June 3, 2008; doi:10.1152/physiolgenomics.90236.2008
1094-8341/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
34/3/277    most recent
90236.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Patterson, E. S.
Right arrow Articles by Gearhart, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Patterson, E. S.
Right arrow Articles by Gearhart, J. D.
Received 30 April 2008; accepted in final form 30 May 2008.
Physiological Genomics 34:277-284 (2008)
1094-8341/08 $8.00 © 2008 American Physiological Society

SOX17 directly activates Zfp202 transcription during in vitro endoderm differentiation

Ethan S. Patterson 1,2, Russell C. Addis 1,2, Michael J. Shamblott 1 and John D. Gearhart 1,2

1 Institute for Cell Engineering, Johns Hopkins University School of Medicine, Baltimore, Maryland
2 McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
SOX17 is a SRY-related high-mobility group (HMG) box transcription factor that is necessary for endoderm formation in multiple species. Despite its essential function during endoderm formation and differentiation, few direct targets of SOX17 are known. To identify targets of SOX17, we isolated SOX17 binding sites with a chromatin immunoprecipitation (ChIP)-cloning screen. SOX17-ChIP identified zinc finger protein 202 (Zfp202) as a direct target of SOX17 during endoderm differentiation of F9 embryonal carcinoma cells. A sequence in the first intron of Zfp202 activated transcription in differentiated F9 cells, and overexpression of Sox17 increased the transcriptional activity of this sequence. SOX17 binds to a site within this sequence in electrophoretic mobility shift assays, and mutation of this site decreases the transcriptional activation. Zfp202 is induced concomitantly with Sox17 during endoderm differentiation of F9 cells. We also show that ZFP202 represses Hnf4a, which has been reported for the human ortholog ZNF202. Identifying targets of SOX17 will help to elucidate the molecular basis of endoderm differentiation and may provide a better understanding of the role of endoderm in patterning the other germ layers.

Sox17; chromatin immunoprecipitation; Hnf4a


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
MEMBERS OF THE SOX FAMILY of transcription factors were originally defined by the presence of a single high-mobility group (HMG) box DNA binding domain with >50% homology to the SRY HMG box (8). With the discovery of new SOX sequences (21, 25), non-SRY SOX proteins can be best defined by conservation of a 9-amino acid sequence within the HMG box (3). SOX proteins can be divided into 10 groups, although 3 groups contain a single member (3). They are necessary for many developmental processes including gastrulation and organogenesis (13, 28, 32, 43). Sox2 is required for epiblast and extraembryonic ectoderm formation in the mouse embryo (1). Sry and Sox9 are required for testis formation (2, 17, 40), and Sox18 has been shown to be necessary for cardiogenesis and angiogenesis (19, 31, 47).

Sox17 has been found to be necessary for the formation of endoderm in several species including Mus musculus, Xenopus laevis, and Danio rerio (35). In frogs, ectopic expression of Sox17 can direct expression of endodermal markers (11). In addition, a fusion of the Sox17 HMG box to the Drosophila Engrailed repressor domain demonstrated the necessity of Sox17 for endoderm formation in frogs (11). The requirement for Sox17 in endoderm formation was confirmed in another study using morpholinos (4). In mice, targeted disruption of Sox17 results in embryonic lethality due to a lack of definitive endoderm formation (14). Expression of Sox17 is limited to the primitive and definitive endoderm in early mouse embryos (14). Sox17 expression is first detected in the extraembryonic endoderm at embryonic day (E)6 and in the anterior primitive streak, which gives rise to the definitive endoderm, by E7.

Despite the important and specific role of SOX17 in endoderm formation and differentiation, few direct targets are known. Previous studies have identified Lama1, Fn1, Foxj1, Sftpc, and Fgf3 as direct targets of SOX17 in the mouse (23, 24, 26, 34). Other genes including Hnf1β, Foxa1, Foxa2, Edd, and Sox17{alpha} have been identified as direct targets of Sox17β in X. laevis (10, 11, 36), and uteroglobin (ug) has been identified as a SOX17 target in rabbit (7). Identification of direct targets of SOX17 during mammalian endoderm differentiation is critical to understanding the molecular basis of endoderm differentiation.

Chromatin immunoprecipitation (ChIP) is a useful tool to identify transcription factor binding sites. It identifies in vivo binding of proteins to native chromatin structures and has been used to quantify this binding (45, 46). By cloning DNA isolated after ChIP, novel target sequences of a transcription factor can be identified that can then be evaluated in downstream assays to assess their transcriptional activity. ChIP-cloning strategies have been used successfully to identify direct target genes for E2F, BARX2, and RUNX1 (12, 37, 44).

To better understand the function of SOX17 during endoderm differentiation in the mouse, we sought to identify targets of SOX17 by using a ChIP-cloning approach. The in vitro differentiation potential of F9 embryonal carcinoma cells has been well studied over the past 30 years, and simple protocols for visceral and parietal endoderm differentiation have been developed (9, 38). We used the in vitro parietal endoderm differentiation of F9 cells, during which SOX17 expression is induced, to avoid using overexpression constructs that may isolate DNA that would not be bound by SOX17 in a normal physiological context.

Here we report the identification of 30 unique targets of SOX17 in differentiated F9 cells and present detailed characterization of one of these sequences. The majority of sequences isolated from SOX17-ChIP contain putative SOX17 binding sites, and genes associated with sequences that enhance transcription are induced during F9 differentiation. Finally, genes regulated by SOX17 that are induced during F9 differentiation are coexpressed with Sox17 in embryos.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture.
F9 and HepG2 cells were obtained from the American Type Culture Collection (ATCC) and grown in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) with 10% fetal bovine serum (FBS, Atlanta Biologicals) and 1% penicillin-streptomycin (Invitrogen). F9 cells were grown on gelatin-coated plates and differentiated by growing in medium consisting of DMEM + 10% FBS supplemented with 100 nM all-trans retinoic acid (Sigma) and 1 mM dibutyryl cAMP (Sigma) for 4 days.

Immunocytochemistry.
Cells were fixed in 4% paraformaldehyde-PBS for 5 min at room temperature and blocked in PBS containing 0.1% Triton X-100 and 10% donkey serum for 15 min at room temperature. Cells were incubated with primary antibodies diluted in PBS containing 0.1% Triton X-100 and 1% donkey serum for 1 h at room temperature. Goat anti-SOX17 (R&D Systems) was used at a 1:250 dilution, and donkey anti-goat IgG 488 (Molecular Probes) was diluted 1:1,000. Nuclei were stained with DAPI in PBS for 5 min at room temperature.

Immunoblots.
Nuclear lysate was prepared with NE-PER (Pierce Biotechnology) per manufacturer's instructions. Ten micrograms of nuclear lysate was separated on a 7.5% SDS-PAGE gel (Bio-Rad) and electroblotted onto polyvinylidene difluoride (PVDF) membrane (Millipore). Membranes were blocked with 5% nonfat milk in Tris-buffered saline + 0.1% Tween 20. The following antibodies were used: goat anti-SOX17 (1:1,000, R&D Systems), anti-SOX2 (1:1,000, Chemicon), rabbit anti-goat IgG HRP (1:10,000, Bethyl Labs), and sheep anti-rabbit IgG (1:200,000, GE Healthcare). ECL Plus (GE Healthcare) was used for detection per manufacturer's recommendations.

Chromatin immunoprecipitation.
F9 cells differentiated for 4 days in the presence of retinoic acid and dibutyryl cAMP were fixed for 10 min by addition of formaldehyde directly to the medium to a final concentration of 1% and shaking (all steps were done at room temperature unless otherwise stated). Glycine was added to a final concentration of 125 mM, and shaking was continued for 5 min. Cells were washed with PBS, trypsinized for 5 min, and pelleted at 200 g. Cells were washed with PBS containing 1 mM PMSF and resuspended in cell lysis buffer (5 mM PIPES pH 8, 85 mM KCl, 0.5% NP-40) including protease inhibitors (1 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin). Cells were incubated on ice for 10 min, and nuclei were pelleted at 4°C in a microcentrifuge for 5 min at 5,000 rpm. Nuclei were resuspended in nuclear lysis buffer (50 mM Tris-Cl pH 8.1, 10 mM EDTA, 1% SDS) plus protease inhibitors and incubated on ice for another 10 min. Chromatin was then sonicated with a Sonic Dismembranator 100 (Fisher Scientific) at a setting of 30% with four pulses of 15 s each. Chromatin was precleared with protein G agarose beads that were prepared by washing three times in dialysis buffer (50 mM Tris pH 8, 2 mM EDTA, 0.2% sarkosyl) and blocked with 1 µg of Escherichia coli DNA and 1 µg of BSA per 1 µl of 25% bead slurry overnight at 4°C. Beads were added to sheared chromatin from 108 cells. An antibody to SOX17 was added, and tubes were rotated overnight at 4°C. Protein G agarose beads were added, and tubes were rotated for 4 h at 4°C. Beads were pelleted and washed once in wash I (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris pH 8, 150 mM NaCl), wash II (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris pH 8, 500 mM NaCl), and wash III (0.25 M LiCl, 1% Igepal, 1% sodium deoxycholate, 1 mM EDTA, 10 mM Tris pH 8) and twice in Tris-EDTA pH 8. DNA was eluted twice in 150 µl of elution buffer (100 mM NaHCO3, 1% SDS). Nineteen microliters of 5 M NaCl and 10 µg of DNase-free RNase A were added to a final concentration of 300 mM, and samples were incubated at 67°C for 6 h. Proteinase K was added, and samples were incubated at 45°C for 1 h. Samples were then extracted with phenol-chloroform, and DNA was precipitated with ethanol at –20°C overnight. DNA was resuspended and incubated with T4 polymerase (NEB) for 30 min at 37°C to blunt DNA ends. To remove E. coli blocking DNA, samples were digested with DpnI (NEB), which selectively cuts E. coli DNA, for 60 min at 37°C and heat inactivated for 20 min at 80°C. DNA was then run over a SizeSep 400 column (GE Healthcare) to remove the digested E. coli DNA. Eluted DNA was extracted with phenol-chloroform and used for cloning.

Pilot experiments using herring sperm DNA revealed that blocking DNA was often cloned instead of actual SOX17 binding sites. To increase the percentage of mouse clones sequenced, we used E. coli DNA to block nonspecific DNA binding sites. After ChIP and DNA elution, DNA ends were blunted for cloning and the eluate was digested with DpnI. After cloning and transformation of DNA isolated from SOX17-ChIP, we picked bacterial clones for colony PCR. We then digested the PCR reactions with MboI to identify clones containing the sequence GATC to decrease sequencing of cloned E. coli DNA fragments. This strategy resulted in a 10-fold increase in the percentage of mouse clones sequenced.

Vector construction and cloning of ChIP DNA.
pGL3-Basic (Promega) was digested with BglII (NEB) and ligated with annealed oligos (single-stranded portion underlined) 5'-GATCTTGGGCCCTAGGAATTCAACTAGTGAAGGGGGGCTATAAAAGCGATGGATCC GAGCTCGGCCCTCATTCTGGAGACTCTAGAGGGATC-3' to create pGL3-MP containing a synthetic minimal promoter consisting of a TATA box and a transcription initiation start site for luciferase.

DNA fragments isolated by ChIP were ligated into EcoRV (NEB)-digested pZero2 (Invitrogen) with high-concentration T4 ligase (NEB) and transformed into TOP10 bacteria (Invitrogen). Colonies were analyzed by colony PCR, and selected colonies were sequenced. A subset of sequenced clones were digested and ligated in both orientations with NheI/XhoI or SpeI/XhoI into NheI/XhoI (NEB)-digested pGL3-MP for use in the luciferase assay. The P6G2 constructs contained the P6G2 clone inserted upstream of the minimal promoter in pGL3-MP in both the "+" (P6G2+) and "–" (P6G2–) orientations.

A portion of the Hnf4a promoter was amplified with primers 5'-GGCTCGAGATTAGCACCCCAGGTGTCAG-3' and 5'-GGACTAGTGTCCCTTCTCTGCCTTCCTC-3' and cloned into pGL3-Basic to create pGL3-Hnf4a.

Colony PCR.
Platinum Taq (Invitrogen) was used according to manufacturer's recommendations with M13F and M13R primers. Thermal cycling conditions were [93°C for 5 min, 35 cycles of (93°C for 60 s, 55°C for 60 s, 72°C for 90 s), 72°C for 5 min]. PCR reactions were then split into two tubes, and one tube was digested with MboI (NEB) for 1 h to identify putative mouse clones.

PCR and RT-PCR.
DNA from ChIP was used as a template for PCR. Platinum Taq (Invitrogen) was used as described by the manufacturer. Primers for the Lama1 enhancer were 5'-CCTCAGCTCCAAGAAAGGAG-3' and 5'-AGGATGCTTCCCTGAAATCC-3' (214 bp); Cps1 promoter 5'-CATGTCCATTGGAACATCTCTGGAC-3' and 5'-TAAAATTAAATCACAAATATCTCATGAG-3' (221 bp); and P6G2 5'-CTGCCTGATATTTGGTGCTG-3', 5'-AATGGCTCTCATGGAAGTGG-3' (183 bp).

Densitometric analysis was used to quantify fold enrichments of ChIP clones. ChIP clones were amplified from Sox17-ChIP or IgG-ChIP samples. PCR reactions were run on 1% agarose gels and stained with ethidium bromide. Gels were photographed, and band intensity was quantified with Quantity One software (Bio-Rad). Fold enrichment was expressed as background-subtracted band intensity for Sox17-ChIP/IgG-ChIP.

For RT-PCR, 2 µg of total RNA was incubated with RNase-free DNase for 30 min at 37°C and then for 10 min at 75°C. Three hundred nanograms of oligo(dT) or random decamers (Ambion) was added and incubated at 65°C for 5 min. Tubes were incubated on ice and 500 µM dNTPs, 40 U of RNase inhibitor, and 40 U of Moloney murine leukemia virus reverse transcriptase (MMLV-RT) (RT+) or H2O (RT–) were added. Reactions were incubated for 60 min at 42°C for cDNA synthesis. One hundred nanograms of cDNA was used per PCR reaction. Primers used for RT-PCR are available upon request.

SOX17 in vitro transcription/translation and electrophoretic mobility shift assay.
SOX17 protein was produced with the TNT T7 Coupled Wheat Germ Extract System (Promega) and XhoI (NEB)-digested pcDNA3.1 containing full-length Sox17 cDNA. Production of SOX17 protein was confirmed by Western blot. Reaction conditions for electrophoretic mobility shift assay (EMSA) were 1x binding buffer (10 mM Tris pH 7.5, 50 mM KCl, 1 mM DTT), 50 ng/µl poly(dG-dC) (GE Healthcare), 10% glycerol, 2 mM MgCl2, 1 mM EDTA, 0.1% Triton X-100, and 1 µl of TNT-SOX17. Reactions were incubated at room temperature for 5 min. Twenty femtomoles of biotinylated probe was added, and reactions were incubated for a further 30 min at room temperature. Reactions were separated on a 5% polyacrylamide-Tris-borate-EDTA gel (Bio-Rad) and electroblotted to Hybond N+ nylon membrane (GE Healthcare). A LightShift chemiluminescent EMSA kit was used for detection (Pierce Biotechnology).

Transfections and luciferase assays.
Differentiated F9 cells were transiently cotransfected with pGL3-MP firefly luciferase constructs and phRL-SV40 (Promega), using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. Cells were lysed at 24 h with Passive Lysis Buffer and assayed with the Dual Luciferase Kit (Promega). Each transfected well was read three times for firefly and Renilla luciferase activity, and each transfection was performed in triplicate. Each transfection was done on at least two different days to confirm results. Values were subjected to unpaired two-tailed t-tests.

pGL3-Hnf4a was transfected into HepG2 cells with Fugene6 (Roche Applied Science) and phRL-SV40. In certain experiments, a plasmid expressing Zfp202 (IMAGE Id 6334069) was cotransfected. Cells were lysed at 24 h and assayed with the Dual Luciferase Kit (Promega).

Site-directed mutagenesis.
A QuikChange Site-Directed Mutagenesis Kit (Stratagene) was used to mutate SOX17 binding sites in the P6G2 constructs. Primers used for P6G2 mutagenesis were site A 5'-GTCCCCCAAGAGATTTCCTTCTCACCAAAGAATTTC-3' and 5'-GAAATTCTTTGGTGAGAAGGAAATCTCTTGGGGGAC-3' and site B 5'-GTTCTTAACCACTCAACCTTCTTCCAGTCCCCCAAG-3' and 5'-CTTGGGGGACTGGAAGAAGGTTGAGTGGTTAAGAAC-3'. Putative SOX17 binding sites are underlined, and the introduced mutations are in bold.

Whole mount in situ hybridization.
In situ hybridizations were performed as previously described (29). The probe for Sox17 has been previously described (15). Collection of mouse embryos for in situ hybridization was performed under a protocol approved by the Johns Hopkins University Animal Care and Use Committee. Pregnant CD1 mice were killed by CO2 inhalation. The probe sequence for Zfp202 was designed to the 3'-untranslated region (UTR) with the following primers: 5'-TTTTGACAGGCTGCTCCTTT-3' and 5'-AGGCAGGGATACCAAGGACT-3'. The sequence was compared with the mouse expressed sequence tag (EST) database at NCBI and found to be specific to Zfp202. DIG-labeled probes were generated with the DIG RNA Labeling Kit (Roche Applied Science).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
SOX17 is induced during endoderm differentiation of F9 cells.
We prepared nuclear protein lysates from undifferentiated F9 cells and F9 cells differentiated to parietal endoderm to validate the F9 differentiation and investigate SOX17 protein abundance. Western blots (Fig. 1C) demonstrate an absence of SOX17 in undifferentiated F9 nuclear extract and a high level of SOX17 expression in differentiated F9 nuclear extract. Conversely, SOX2 is present at high levels in undifferentiated F9 cells and decreases during differentiation of F9 cells. SOX17 induction is consistent with previous studies of the differentiation of F9 cells (6). The antibody to SOX17 recognized one primary band of appropriate size in differentiated F9 nuclear extract.


Figure 1
View larger version (23K):
[in this window]
[in a new window]

 
Fig. 1. Chromatin immunoprecipitation (ChIP) strategy and validation of antibody to SOX17. A: strategy for cloning DNA isolated after ChIP. B: immunocytochemical staining for SOX17 demonstrating nuclear staining of paraformaldehyde-fixed differentiated F9 cells. Scale bars, 50 µm. C: Western blots of undifferentiated F9 (uF9) and differentiated F9 (dF9) nuclear extracts for SOX2 and SOX17 demonstrating induction of SOX17 protein during differentiation and concomitant with SOX2 reduction. D: PCR for Lama1 enhancer and Cps1 promoter from SOX17, IgG, or no-antibody (No Ab) ChIP eluates demonstrating specific precipitation of sequences bound by SOX17 (Lama1) and not sequences that are not bound by SOX17 (Cps1).

 
We performed immunocytochemistry to determine the percentage of cells expressing SOX17 after 4 days of endoderm differentiation. Immunocytochemistry showed SOX17 staining in the nucleus of differentiated F9 cells consistent with the role of SOX17 as a transcription factor (Fig. 1B). The percentage of SOX17-positive cells at day 4 of differentiation was between 50% and 80% of cells in four independent experiments.

Identification of SOX17 targets with ChIP cloning.
We prepared chromatin from differentiated F9 cells and used it for ChIP with a SOX17 antibody (SOX17-ChIP), IgG control (IgG-ChIP), or no antibody (NoAb-ChIP) to test for the specificity of SOX17-ChIP. In initial experiments, primers flanking the known SOX17 binding sites in the Lama1 enhancer (24) were used as a positive control and primers flanking the transcriptional start site of the Cps1 promoter, which is not known to be regulated by SOX17, were used as a negative control. Lama1 enhancer DNA was amplified from SOX17-ChIP samples but was not present in NoAb-ChIP or IgG-ChIP (Fig. 1D). In addition, Cps1 promoter was amplified in total input samples (data not shown) but only minimally in SOX17-ChIP, IgG-ChIP, or NoAb-ChIP (Fig. 1D). This demonstrated a high level of specificity for SOX17-ChIP, which is necessary for ChIP-cloning. On confirming the specificity of SOX17-ChIP, we repeated the ChIP and pooled the eluates to use for cloning.

We used PCR to amplify the insert DNA from 509 clones and sent 158 clones for sequencing. From these 158 sequenced clones, we found that 43 corresponded to mouse genomic sequence. There were 10 duplicate sequences, and 3 could not be mapped to a specific location in the mouse genome. This resulted in a final 30 unique mouse clones. Of these 30 clones, 14 were highly repetitive (contained >80% repeat sequence), and we focused on the remaining 16 clones. To determine whether these sequences were pulled down specifically, we designed PCR primers to flank the putative SOX17 binding sites. We used independent ChIPs as templates for PCR. Enrichment values (SOX17-ChIP/IgG-ChIP) were determined by densitometric analysis and were ~15-fold for all clones tested, suggesting that the cloned DNA fragments are indeed bound by SOX17 in differentiated F9 cells and are not a result of cloning nonspecific DNA (Fig. 2). We then associated SOX17-ChIP clones with a gene by using the BLAT (16) program at http://genome.ucsc.edu and identifying the nearest RefSeq gene, or mRNA that had supporting EST data (Table 1).


Figure 2
View larger version (7K):
[in this window]
[in a new window]

 
Fig. 2. ChIP clones are enriched in independent chromatin immunoprecipitations. Enrichment values for SOX17-ChIP clones were determined by densitometric analysis. PCR was done from 3 independent ChIP samples. Enrichment values shown are a representative experiment expressed as the intensity of SOX17-ChIP/IgG-ChIP. Enrichment values ranged from 15- to 100-fold for experimental samples. Cpsprom (negative control) ranged from 1- to 3-fold enrichment.

 

View this table:
[in this window]
[in a new window]

 
Table 1. SOX17 binding sites

 
Expression of Sox17 and Zfp202.
We assayed the expression of the 29 genes associated with the ChIP DNA fragments in both SOX17-negative undifferentiated F9 cells (uF9) and SOX17-positive differentiated F9 cells (dF9) (Table 1). Twenty-one genes were expressed during F9 differentiation, and 13 of these were induced >1.5-fold. Expression levels for five genes decreased >1.5-fold (dF9/uF9 < 0.67), and three showed no change in expression during differentiation. Zfp202 (zinc finger protein 202), associated with clone P6G2, was detected in undifferentiated F9 cells and was upregulated 2.8-fold during F9 differentiation (Table 1).

SOX17 binds to clone P6G2 in EMSA.
After confirming enrichment of the cloned DNA fragments in independent ChIPs, we performed EMSA for selected clones to identify functional SOX17 sites. Putative SOX17 binding sites were selected by using ESPSearch (42) with the consensus site (A/G)ACAA(A/T) derived from published SOX17 binding sites (15, 23, 24, 34). We focused on clone P6G2, which is located in the first intron of Zfp202 and has two putative SOX17 binding sites separated by 20 bp: GACAAT (site A) and GACAAA (site B) on the opposite strand (Fig. 3A). We designed separate 36-mer oligos to both of these sites that included the putative site and 15 bp of flanking sequence on either side. EMSA was performed with in vitro transcribed/translated (ivt) SOX17 protein or TnT extract only (lane 1). EMSA clearly demonstrates a shift for site A, which is due to SOX17 (lane 2), but not for site B (Fig. 3, B and C). In addition, the shift from SOX17 is effectively competed away by addition of excess wild-type unlabeled probe (lane 3), but not when excess mutant unlabeled probe was added, indicating a site-specific shift due to SOX17 (lane 4).


Figure 3
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 3. Electrophoretic mobility shift assays. A: Zfp202 genomic structure containing 7 exons. Boxes represent exons, and lines correspond to introns. Gray boxes represent noncoding sequence, and black boxes are coding regions. The ATG is located in the 2nd exon. SOX17-ChIP clone P6G2 is located within the 1st intron of Zfp202 upstream of the start codon and contains 2 putative SOX17 binding sites. B and C: SOX17 protein was produced by in vitro transcription/translation (ivt). Lane 1 is TnT extract only (TnT-ex), while lanes 24 contain full-length SOX17 as well (ivt-SOX17). Competimers (comp) were unlabeled probe (Wt) or unlabeled probe with the SOX17 site mutated (Mut). Site A shows a shift due to SOX17 in lane 2 that is not present in lane 1. This shift is competed away by excess Wt DNA, but not excess Mut DNA. Site B is not bound by SOX17 and does not show a specific shift in lane 2.

 
Full transcriptional activity of clone P6G2 is dependent on SOX17.
We cloned P6G2 into pGL3-MP (P6G2+ and P6G2– constructs) in both orientations to assess its transcriptional effect. We transfected these constructs into differentiated F9 cells and assayed for luciferase activity after 24 h. Transcriptional enhancement relative to pGL3-MP (minimal promoter construct) was seen when the P6G2+ construct was transfected into differentiated F9 cells, but not when P6G2– was transfected, suggesting that it may act as an alternative promoter (Fig. 4). This is supported by its location within intron 1 but upstream of the ATG start codon in exon 2.


Figure 4
View larger version (8K):
[in this window]
[in a new window]

 
Fig. 4. SOX17 site A is critical to P6G2 transcriptional activity. P6G2 was cloned into pGL3-MP in both orientations upstream of firefly luciferase. Differentiated F9 cells were transfected with designated constructs and phRL-SV40 and assayed for luciferase activity 24 h later. Values shown are firefly luciferase intensity/Renilla luciferase intensity made relative to a promoterless control vector (pGL3-MP). Transfections were done in triplicate. P6G2 activates transcription in an orientation-dependent manner (black bars). This activation is partially due to SOX17 site A, but not site B (white and dark gray bars). Neither site A nor site B affects transcription in the reverse (–) orientation. Values are means with SD. **P < 0.01 compared with wt.

 
To assess whether the putative SOX17 sites were responsible for the enhancing effect of P6G2 we mutated the core sequence (CAA) within the SOX17 binding sites, which is essential for many Sox binding sites (20). Mutated vectors were transfected into differentiated F9 cells. Mutation of site A within P6G2 caused a decrease in expression of luciferase of ~60% in the positive orientation (P = 0.0027, Fig. 4), while mutation of site B did not affect expression (Fig. 4). This is consistent with EMSA analysis demonstrating SOX17 binding to site A but not to site B. When sites A and B were mutated in combination, expression also decreased (P = 0.0033, Fig. 4).

Zfp202 and Sox17 colocalize during embryogenesis.
We next asked whether Zfp202 and Sox17 expression colocalize during embryogenesis. We performed whole mount in situ hybridization for Sox17 and Zfp202 on E7.75 mouse embryos. By E7.75, Sox17 expression is limited to the anterior definitive endoderm with a punctate staining pattern. Our in situ hybridizations for Sox17 are consistent with this pattern and also demonstrate staining in the foregut diverticulum and allantois (Fig. 5, DF).


Figure 5
View larger version (102K):
[in this window]
[in a new window]

 
Fig. 5. Sox17 and Zfp202 are colocalized during murine embryogenesis. AC: a probe designed to the 3'-untranslated region of Zfp202 was used for whole mount in situ hybridization. Zfp202 expression is limited to the anterior and posterior thirds of the embryonic day 8 mouse embryo. Expression is seen in the foregut (fg) (A), neural folds (nf) (B), and allantois (al) (C). Sox17 expression is seen in the developing foregut diverticulum (D) and allantois (F). Views are anterior (A and D), lateral (B and E), or posterior (C and F).

 
A probe designed to the 3'-UTR of Zfp202 was used for whole mount in situ hybridization. Zfp202 staining was only found in the anterior and posterior third of the E7.75 embryo. Zfp202 staining was seen in the neural folds as well as the foregut diverticulum and allantois (Fig. 5, AC).

ZFP202 represses transcription from the Hnf4a promoter.
The literature revealed no publications on Zfp202; however, the human ortholog of Zfp202, ZNF202, was reported to repress hepatocyte nuclear factor 4{alpha} (HNF4A) (41). Given that Sox17 and Zfp202 were both expressed in the anterior definitive endoderm just prior to Hnf4a expression, we tested whether ZFP202 could repress transcription from the Hnf4a promoter. We compared the activity of the mouse Hnf4a promoter in HepG2 cells with or without addition of a constitutive Zfp202 construct. Transcriptional activity was reduced ~40% in the presence of Zfp202 (P = 0.039, Fig. 6).


Figure 6
View larger version (8K):
[in this window]
[in a new window]

 
Fig. 6. ZFP202 represses transcription from the Hnf4a promoter. HepG2 cells were transfected with a construct containing a portion of the murine Hnf4a promoter regulating luciferase expression. Some cells were also transfected with a construct that constitutively expresses Zfp202. Addition of the construct containing Zfp202 reduced the activity of the Hnf4a promoter by 40%. Values shown are firefly luciferase intensity/Renilla luciferase intensity made relative to a promoterless control vector (pGL3-MP). Transfections were done in triplicate. Values are means with SD. *P < 0.05.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Here we have identified direct targets of SOX17 during in vitro endoderm differentiation. In particular, SOX17 binds to a site in the first intron of Zfp202 and activates transcription. We demonstrated that this sequence is specifically immunoprecipitated in independent ChIPs. Zfp202 expression is induced concomitantly with Sox17 during endoderm differentiation from F9 cells and colocalizes with Sox17 in embryos, suggesting that Zfp202 is regulated by SOX17. We further showed that SOX17 binds one of two putative SOX17 binding sites within clone P6G2 in EMSAs. Luciferase assays using this sequence demonstrate the orientation-dependent regulatory activity of clone P6G2. Furthermore, mutation of SOX17 site A decreases this enhancing activity by 60%. Zfp202 and Sox17 are coexpressed during murine embryogenesis in the anterior foregut and the allantois. Zfp202 is directly regulated by SOX17 through a binding site within the first intron of Zfp202 during mammalian endoderm differentiation in vitro.

Since P6G2 is located upstream of the ATG start codon and its enhancing activity is orientation dependent, it is possible that this sequence serves as an alternative promoter for Zfp202. The regulation of Zfp202 and its downstream target genes is largely unknown, but its human ortholog ZNF202 has been characterized. ZNF202 has been reported to have 6 (22) or 10 (33, 41) exons. Analysis of EST data suggests that most ZNF202 transcripts contain seven exons corresponding to the seven exons of Zfp202, while two ESTs contain two additional upstream exons.

ZNF202 is a transcriptional repressor and functions in the regulation of HDL metabolism (18, 30, 33, 41). The positive regulation of Zfp202 by SOX17 suggests that SOX17 may have indirect suppressive effects on genes of HDL metabolism. HNF4A has been shown to be a direct target of ZNF202 (41). We have shown that ZFP202 represses the activity of the murine Hnf4a promoter.

It is possible that SOX17 activation of Zfp202 and ZFP202 repression of Hnf4a is a mechanism to establish timing of hepatogenesis in embryos. Hnf4a expression is initiated in the anterior definitive endoderm shortly after Sox17 expression wanes (5, 14, 39). Zfp202 contains a PEST domain and therefore is rapidly degraded. This allows for a scenario in which SOX17 indirectly represses Hnf4a expression through ZFP202 activity and prevents hepatocyte differentiation until gastrulation is complete. Hnf4a is critical to hepatocyte differentiation and morphogenesis (27). The indirect repression of Hnf4a by Sox17 may be part of a mechanism involved in the timing of endodermal organogenesis. Interestingly, in the visceral endoderm, both Sox17 and Hnf4a are expressed (5, 14, 39) but Zfp202 is not detected by in situ hybridization. It is likely that ZFP202 has as yet unidentified targets that may better explain its regulation by SOX17 in early embryos.

We have demonstrated the utility of an unbiased approach to the identification of SOX17 regulatory sequences during mammalian endoderm differentiation. We have analyzed a sequence in the first intron of Zfp202 in detail. Further analysis of additional SOX17 target sequences and associated genes may provide a better understanding of the molecular events underlying endoderm formation and differentiation.


    GRANTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported through the Institute for Cell Engineering at Johns Hopkins University School of Medicine.


    FOOTNOTES
 
Address for reprint requests and other correspondence: E. S. Patterson, Washington Univ. School of Medicine, Dept. of Developmental Biology, 320 McDonnell Sciences, Campus Box 8103, 660 S. Euclid Ave., St. Louis, MO 63110 (e-mail: espatterson{at}wustl.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Avilion AA, Nicolis SK, Pevny LH, Perez L, Vivian N, Lovell-Badge R. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev 17: 126–140, 2003.[Abstract/Free Full Text]
  2. Barrionuevo F, Bagheri-Fam S, Klattig J, Kist R, Taketo MM, Englert C, Scherer G. Homozygous inactivation of Sox9 causes complete XY sex reversal in mice. Biol Reprod 74: 195–201, 2006.[Abstract/Free Full Text]
  3. Bowles J, Schepers G, Koopman P. Phylogeny of the SOX family of developmental transcription factors based on sequence and structural indicators. Dev Biol 227: 239–255, 2000.[CrossRef][Web of Science][Medline]
  4. Clements D, Cameleyre I, Woodland HR. Redundant early and overlapping larval roles of Xsox17 subgroup genes in Xenopus endoderm development. Mech Dev 120: 337–348, 2003.[CrossRef][Web of Science][Medline]
  5. Duncan SA, Manova K, Chen WS, Hoodless P, Weinstein DC, Bachvarova RF, Darnell JE Jr. Expression of transcription factor HNF-4 in the extraembryonic endoderm, gut, and nephrogenic tissue of the developing mouse embryo: HNF-4 is a marker for primary endoderm in the implanting blastocyst. Proc Natl Acad Sci USA 91: 7598–7602, 1994.[Abstract/Free Full Text]
  6. Futaki S, Hayashi Y, Yamashita M, Yagi K, Bono H, Hayashizaki Y, Okazaki Y, Sekiguchi K. Molecular basis of constitutive production of basement membrane components. Gene expression profiles of Engelbreth-Holm-Swarm tumor and F9 embryonal carcinoma cells. J Biol Chem 278: 50691–50701, 2003.[Abstract/Free Full Text]
  7. Garcia C, Calvo E, Nieto A. The transcription factor SOX17 is involved in the transcriptional control of the uteroglobin gene in rabbit endometrium. J Cell Biochem 102: 665–679, 2007.[CrossRef][Web of Science][Medline]
  8. Goodfellow PN, Lovell-Badge R. SRY and sex determination in mammals. Annu Rev Genet 27: 71–92, 1993.[CrossRef][Web of Science][Medline]
  9. Hogan BL, Taylor A, Adamson E. Cell interactions modulate embryonal carcinoma cell differentiation into parietal or visceral endoderm. Nature 291: 235–237, 1981.[CrossRef][Web of Science][Medline]
  10. Howard L, Rex M, Clements D, Woodland HR. Regulation of the Xenopus Xsox17{alpha}1 promoter by co-operating VegT and Sox17 sites. Dev Biol 310: 402–415, 2007.[CrossRef][Web of Science][Medline]
  11. Hudson C, Clements D, Friday RV, Stott D, Woodland HR. Xsox17alpha and -beta mediate endoderm formation in Xenopus. Cell 91: 397–405, 1997.[CrossRef][Web of Science][Medline]
  12. Hug BA, Ahmed N, Robbins JA, Lazar MA. A chromatin immunoprecipitation screen reveals protein kinase Cbeta as a direct RUNX1 target gene. J Biol Chem 279: 825–830, 2004.[Abstract/Free Full Text]
  13. Kamachi Y, Uchikawa M, Kondoh H. Pairing SOX off: with partners in the regulation of embryonic development. Trends Genet 16: 182–187, 2000.[CrossRef][Web of Science][Medline]
  14. Kanai-Azuma M, Kanai Y, Gad JM, Tajima Y, Taya C, Kurohmaru M, Sanai Y, Yonekawa H, Yazaki K, Tam PP, Hayashi Y. Depletion of definitive gut endoderm in Sox17-null mutant mice. Development 129: 2367–2379, 2002.[Web of Science][Medline]
  15. Kanai Y, Kanai-Azuma M, Noce T, Saido TC, Shiroishi T, Hayashi Y, Yazaki K. Identification of two Sox17 messenger RNA isoforms, with and without the high mobility group box region, and their differential expression in mouse spermatogenesis. J Cell Biol 133: 667–681, 1996.[Abstract/Free Full Text]
  16. Kent WJ. BLAT—the BLAST-like alignment tool. Genome Res 12: 656–664, 2002.[Abstract/Free Full Text]
  17. Koopman P, Gubbay J, Vivian N, Goodfellow P, Lovell-Badge R. Male development of chromosomally female mice transgenic for Sry. Nature 351: 117–121, 1991.[CrossRef][Web of Science][Medline]
  18. Langmann T, Schumacher C, Morham SG, Honer C, Heimerl S, Moehle C, Schmitz G. ZNF202 is inversely regulated with its target genes ABCA1 and apoE during macrophage differentiation and foam cell formation. J Lipid Res 44: 968–977, 2003.[Abstract/Free Full Text]
  19. Matsui T, Kanai-Azuma M, Hara K, Matoba S, Hiramatsu R, Kawakami H, Kurohmaru M, Koopman P, Kanai Y. Redundant roles of Sox17 and Sox18 in postnatal angiogenesis in mice. J Cell Sci 119: 3513–3526, 2006.[Abstract/Free Full Text]
  20. Mertin S, McDowall SG, Harley VR. The DNA-binding specificity of SOX9 and other SOX proteins. Nucleic Acids Res 27: 1359–1364, 1999.[Abstract/Free Full Text]
  21. Mizuseki K, Kishi M, Shiota K, Nakanishi S, Sasai Y. SoxD: an essential mediator of induction of anterior neural tissues in Xenopus embryos. Neuron 21: 77–85, 1998.[CrossRef][Web of Science][Medline]
  22. Monaco C, Helmer Citterich M, Caprini E, Vorechovsky I, Russo G, Croce CM, Barbanti-Brodano G, Negrini M. Molecular cloning and characterization of ZNF202: a new gene at 11q23.3 encoding testis-specific zinc finger proteins. Genomics 52: 358–362, 1998.[CrossRef][Web of Science][Medline]
  23. Murakami A, Shen H, Ishida S, Dickson C. SOX7 and GATA-4 are competitive activators of Fgf-3 transcription. J Biol Chem 279: 28564–28573, 2004.[Abstract/Free Full Text]
  24. Niimi T, Hayashi Y, Futaki S, Sekiguchi K. SOX7 and SOX17 regulate the parietal endoderm-specific enhancer activity of mouse laminin alpha1 gene. J Biol Chem 279: 38055–38061, 2004.[Abstract/Free Full Text]
  25. Osaki E, Nishina Y, Inazawa J, Copeland NG, Gilbert DJ, Jenkins NA, Ohsugi M, Tezuka T, Yoshida M, Semba K. Identification of a novel Sry-related gene and its germ cell-specific expression. Nucleic Acids Res 27: 2503–2510, 1999.[Abstract/Free Full Text]
  26. Park KS, Wells JM, Zorn AM, Wert SE, Whitsett JA. Sox17 influences the differentiation of respiratory epithelial cells. Dev Biol 294: 192–202, 2006.[CrossRef][Web of Science][Medline]
  27. Parviz F, Matullo C, Garrison WD, Savatski L, Adamson JW, Ning G, Kaestner KH, Rossi JM, Zaret KS, Duncan SA. Hepatocyte nuclear factor 4alpha controls the development of a hepatic epithelium and liver morphogenesis. Nat Genet 34: 292–296, 2003.[CrossRef][Web of Science][Medline]
  28. Pevny LH, Lovell-Badge R. Sox genes find their feet. Curr Opin Genet Dev 7: 338–344, 1997.[CrossRef][Web of Science][Medline]
  29. Pizard A, Haramis A, Carrasco AE, Franco P, Lopez S, Paganelli A. Whole-mount in situ hybridization and detection of RNAs in vertebrate embryos and isolated organs. In: Current Protocols in Molecular Biology, edited by Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. New York: Wiley, 2004, p. 14.19.11–14.19.24.
  30. Porsch-Ozcurumez M, Langmann T, Heimerl S, Borsukova H, Kaminski WE, Drobnik W, Honer C, Schumacher C, Schmitz G. The zinc finger protein 202 (ZNF202) is a transcriptional repressor of ATP binding cassette transporter A1 (ABCA1) and ABCG1 gene expression and a modulator of cellular lipid efflux. J Biol Chem 276: 12427–12433, 2001.[Abstract/Free Full Text]
  31. Sakamoto Y, Hara K, Kanai-Azuma M, Matsui T, Miura Y, Tsunekawa N, Kurohmaru M, Saijoh Y, Koopman P, Kanai Y. Redundant roles of Sox17 and Sox18 in early cardiovascular development of mouse embryos. Biochem Biophys Res Commun 360: 539–544, 2007.[CrossRef][Web of Science][Medline]
  32. Schepers GE, Teasdale RD, Koopman P. Twenty pairs of sox: extent, homology, and nomenclature of the mouse and human sox transcription factor gene families. Dev Cell 3: 167–170, 2002.[CrossRef][Web of Science][Medline]
  33. Schmitz G, Heimerl S, Langmann T. Zinc finger protein ZNF202 structure and function in transcriptional control of HDL metabolism. Curr Opin Lipidol 15: 199–208, 2004.[CrossRef][Web of Science][Medline]
  34. Shirai T, Miyagi S, Horiuchi D, Okuda-Katayanagi T, Nishimoto M, Muramatsu M, Sakamoto Y, Nagata M, Hagiwara K, Okuda A. Identification of an enhancer that controls up-regulation of fibronectin during differentiation of embryonic stem cells into extraembryonic endoderm. J Biol Chem 280: 7244–7252, 2005.[Abstract/Free Full Text]
  35. Shivdasani RA. Molecular regulation of vertebrate early endoderm development. Dev Biol 249: 191–203, 2002.[CrossRef][Web of Science][Medline]
  36. Sinner D, Rankin S, Lee M, Zorn AM. Sox17 and beta-catenin cooperate to regulate the transcription of endodermal genes. Development 131: 3069–3080, 2004.[Abstract/Free Full Text]
  37. Stevens TA, Iacovoni JS, Edelman DB, Meech R. Identification of novel binding elements and gene targets for the homeodomain protein BARX2. J Biol Chem 279: 14520–14530, 2004.[Abstract/Free Full Text]
  38. Strickland S, Smith KK, Marotti KR. Hormonal induction of differentiation in teratocarcinoma stem cells: generation of parietal endoderm by retinoic acid and dibutyryl cAMP. Cell 21: 347–355, 1980.[CrossRef][Web of Science][Medline]
  39. Taraviras S, Monaghan AP, Schutz G, Kelsey G. Characterization of the mouse HNF-4 gene and its expression during mouse embryogenesis. Mech Dev 48: 67–79, 1994.[CrossRef][Web of Science][Medline]
  40. Vidal VP, Chaboissier MC, de Rooij DG, Schedl A. Sox9 induces testis development in XX transgenic mice. Nat Genet 28: 216–217, 2001.[CrossRef][Web of Science][Medline]
  41. Wagner S, Hess MA, Ormonde-Hanson P, Malandro J, Hu H, Chen M, Kehrer R, Frodsham M, Schumacher C, Beluch M, Honer C, Skolnick M, Ballinger D, Bowen BR. A broad role for the zinc finger protein ZNF202 in human lipid metabolism. J Biol Chem 275: 15685–15690, 2000.[Abstract/Free Full Text]
  42. Watt TJ, Doyle DF. ESPSearch: a program for finding exact sequences and patterns in DNA, RNA, or protein. Biotechniques 38: 109–115, 2005.[Medline]
  43. Wegner M. From head to toes: the multiple facets of Sox proteins. Nucleic Acids Res 27: 1409–1420, 1999.[Abstract/Free Full Text]
  44. Weinmann AS, Bartley SM, Zhang T, Zhang MQ, Farnham PJ. Use of chromatin immunoprecipitation to clone novel E2F target promoters. Mol Cell Biol 21: 6820–6832, 2001.[Abstract/Free Full Text]
  45. Weinmann AS, Yan PS, Oberley MJ, Huang TH, Farnham PJ. Isolating human transcription factor targets by coupling chromatin immunoprecipitation and CpG island microarray analysis. Genes Dev 16: 235–244, 2002.[Abstract/Free Full Text]
  46. Wells J, Farnham PJ. Characterizing transcription factor binding sites using formaldehyde crosslinking and immunoprecipitation. Methods 26: 48–56, 2002.[CrossRef][Web of Science][Medline]
  47. Zhang C, Basta T, Klymkowsky MW. SOX7 and SOX18 are essential for cardiogenesis in Xenopus. Dev Dyn 234: 878–891, 2005.[CrossRef][Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
34/3/277    most recent
90236.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Patterson, E. S.
Right arrow Articles by Gearhart, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Patterson, E. S.
Right arrow Articles by Gearhart, J. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.