Physiol. Genomics 34: 144-148, 2008.
First published May 13, 2008; doi:10.1152/physiolgenomics.00043.2008
1094-8341/08 $8.00
Received 27 February 2008;
accepted in final form 7 May 2008.
Physiological Genomics 34:144-148 (2008)
1094-8341/08 $8.00 © 2008 American Physiological Society
The g.763G>C SNP of the bovine FASN gene affects its promoter activity via Sp-mediated regulation: implications for the bovine lactating mammary gland
Laura Ordovás
1,
Rosa Roy
2,
Sandra Pampín
3,
Pilar Zaragoza
1,
Rosario Osta
1,
Jose Carlos Rodríguez-Rey
3 and
Clementina Rodellar
1
1 Laboratorio de Genética Bioquímica (LAGENBIO), Facultad de Veterinaria, Universidad de Zaragoza, Zaragoza
2 Unidad de Genética, Facultad de Ciencias, Universidad Autónoma de Madrid, Madrid
3 Departamento de Biología Molecular, Facultad de Medicina, Universidad de Cantabria, Santander, Spain
 |
ABSTRACT
|
|---|
Fatty acid synthase (FASN) is an enzyme that catalyzes de novo synthesis of fatty acids in cells. The bovine FASN gene maps to BTA 19, where several quantitative trait loci for fat-related traits have been described. Our group recently reported the identification of a single nucleotide polymorphism (SNP), g.763G>C, in the bovine FASN 5' flanking region that was significantly associated with milk fat content in dairy cattle. The g.763G>C SNP was part of a GC-rich region that may constitute a cis element for members of the Sp transcription factor family. Thus the SNP could alter the transcription factor binding ability of the FASN promoter and consequently affect the promoter activity of the gene. However, the functional consequences of the SNP on FASN gene expression are unknown. The present study was therefore directed at elucidating the underlying molecular mechanism that could explain the association of the SNP with milk fat content. Three cellular lines (3T3L1, HepG2, and MCF-7) were used to test the promoter and the transcription factor binding activities by luciferase reporter assays and electrophoretic mobility shift assays, respectively. Band shift assays were also carried out with nuclear extracts from lactating mammary gland (LMG) to further investigate the role of the SNP in this tissue. Our results demonstrate that the SNP alters the bovine FASN promoter activity in vitro and the Sp1/Sp3 binding ability of the sequence. In bovine LMG, the specific binding of Sp3 may account for the association with milk fat content.
fatty acid synthase; Sp1; Sp3; transcription factor binding activity
 |
INTRODUCTION
|
|---|
FATTY ACID SYNTHASE (FASN) is a multifunctional protein that catalyzes de novo synthesis of fatty acids in cells. This is a key function in the lipid as well as the general metabolism of all living animals. Consequently, FASN has been studied as a functional candidate gene in different processes or traits in species. For example, FASN has been associated with obesity and type 2 diabetes (2) and with percentage of body fat and substrate oxidation (14) in humans. FASN inhibitors, originally developed to treat cancer, have been shown to produce dramatic weight loss and reduction in food intake in mice (15). Also, some single nucleotide polymorphisms (SNPs) in the FASN gene were shown to be partially responsible for fatness in turkeys (28).
In previous work, our group reported (23, 26) the structural and functional characterization of the bovine FASN gene, as well as its genomic localization on BTA 19. The bovine gene maps to a region where several quantitative trait loci affecting milk fat content and related traits have been described (3, 8, 30). More recently, we described (24) the identification of a polymorphism in the first noncoding exon (g.763G>C) that was significantly associated with milk fat content in dairy cattle. Additionally, two independent studies in cattle have detected FASN SNPs that are associated with variations in fat-related traits: the first, published in 2007, describes an association with the fatty acid composition of adipose fat and milk fat (16), while the second, published in 2008, associates FASN SNPs with beef fatty acid composition (34).
Apart from their value as genetic markers, some SNPs could have functional consequences. This is mostly true for those SNPs located in regulatory regions in which their presence could alter gene expression (21). Several recent surveys of SNPs have estimated that between 22% and 35% of SNPs located in regulatory regions (rSNPs) have functional consequences (4, 12, 21). The accumulation of several of these rSNPs could constitute the basis for the different gene expression profiles that define traits in a species- or breed-specific manner. For example, functional candidate genes for traits related to obesity and leanness have been revealed (FASN being one of these) by the comparison of mRNA expression profiles of two pig breeds differing in body composition, partitioning, and utilization of nutrients and energy (22). This could be also true for a trait such as milk fat.
The g.763G>C SNP is located within a GC-rich region that could constitute a binding element for some transcription factors (TFs) belonging to the Sp family. Two members of this family, Sp1 and Sp3, have been involved in the transcriptional regulation of the rat FASN gene (9, 10, 27, 29, 32). In addition, several GC boxes in the rat promoter were found to bind Sp1 and Sp3 in vitro (32). Therefore, the fact that one of the variants of the g.763G>C SNP could alter the TF-binding ability of the sequence and consequently affect promoter activity was an interesting possibility. For this reason, the present study was directed at elucidating the underlying molecular mechanism that could explain the association of the SNP with milk fat content (24), focusing on the analysis of the TF binding to the sequence surrounding the g.763G>C SNP.
 |
MATERIALS AND METHODS
|
|---|
Sequence analysis.
Sequence alignment of bovine, human, and rat FASN promoters (GenBank accession nos. AF285607, NT_010663, and X54671, respectively) was carried out with ClustalW software (http://www.ebi.ac.uk/clustalw/) included within the BioEdit program (11). The cis element prediction was done with the Patch software (http://www.gene-regulation.com/cgi-bin/pub/programs/patch/bin/patch.cgi).
Reporter plasmids.
A 840-bp fragment of the bovine FASN 5' flanking region (–570/+270) containing the promoter, the first untranslated exon, and a fragment of intron 1 was PCR amplified with forward (5'-GGTACCTAGCAACGCCCACTCGAG-3') and reverse (5'-AAGCTTGGCAGGCTGTGTGAGATGAG-3') primers modified to contain KpnI and HindIII restriction sites, respectively. One product for each allele was cloned into the PCR vector pMOSBlue (Amersham). After excision with the previous enzymes, the fragments were cloned into the pGL3 basic luciferase reporter vector (Promega). The pGL3 basic constructs were then bidirectionally sequenced to ensure that only the g763G>C SNP was present. A clone for each allele was chosen, and three independent DNA extractions were carried out for use in the luciferase reporter assays.
Gene reporter assays.
Luciferase reporter assays were carried out essentially as previously described (19). Briefly, on the day before transfection, cells were seeded in T6 plates at a density of 125,000 cells per well. The next day, transfections were carried out with 1 µg of each reporter construct and the FuGene transfection system (Roche) according to the manufacturer's instructions. Eight nanograms per well of the pRL-SV40 Renilla reporter plasmid was cotransfected in each experiment to control for transfection efficiency. The DNA-cell mixtures were then incubated for 48 h before luciferase activity quantification with the Dual Luciferase Report Assay System (Promega). Duplicate wells for each transfection condition were assayed, and three independent transfections were carried out. The normalized luciferase data (firefly/Renilla) were used in the statistical analysis and are expressed relative to the C allele construct. Comparisons of the luciferase activities between the constructs were done by t-test (P < 0.05).
Nuclear protein extraction.
Nuclear extracts from cells were obtained by vortexing HepG2 and MCF-7 cells (107) in 200 µl of cell membrane lysis buffer (10 mM HEPES pH 7.5, 10 mM KCl, 250 µM EDTA, 125 µM EGTA, 0.5 mM spermidine, 0.1% NP-40, 1 mM DTT, and an antiprotease cocktail) and incubating them on ice for 5–10 min. Nuclei were pelleted by centrifuging at 1,500 rpm for 5 min at 4°C. Cytosolic protein extract was removed with a pipette, and the pellet was lysed with 20 µl of nuclear membrane lysis buffer (20 mM HEPES pH 7.5, 0.4 M NaCl, 250 mM EDTA, 1.5 mM MgCl2, 0.5 mM DTT, and an antiprotease cocktail). Nuclei were incubated for 60 min in a roller agitator at 4°C. Nuclear extracts were centrifuged at 14,000 rpm for 20 min at 4°C, and the supernatant was frozen in aliquots at –70°C. The 3T3L1 nuclear extracts were purchased from Active Motif.
Mammary gland from a lactating cow was collected at the moment of death and immediately frozen in liquid nitrogen. Nuclear extracts were obtained with the Dignam et al. (6) protocol with some modifications. All steps were done at 4°C. Tissue was ground with liquid nitrogen, resuspended in 3 volumes of buffer A (10 mM HEPES pH 7.9, 10% glycerol, 1.5 mM MgCl2, 10 mM KCl, 250 mM sucrose, 10 mM β-mercaptoethanol, 1 mM PMSF, 0.32 µg/ml pepstatin A, 10 µg/ml leupeptin, and 2 µg/ml aprotinin), and homogenized with a Dounce (type B pestle) homogenizer. The homogenate was filtered through a four-layer cheesecloth to remove particulate material and connective tissue. Nuclei were collected by centrifugation at 5,000 rpm in a Sorvall SS-34 rotor. The nuclear pellet was resuspended in 6 volumes of buffer A and then pelleted at 14,500 rpm in the same rotor. The pellet was resuspended in 0.1 volume of buffer C (20 mM HEPES pH 7.9, 25% glycerol, 1.5 mM MgCl2, 0.42 mM NaCl, 10 mM β-mercaptoethanol, 1 mM PMSF, 0.32 µg/ml pepstatin A, 10 µg/ml leupeptin, and 2 µg/ml aprotinin), and the suspension was transferred to a microcentrifuge tube and stirred for 30 min at 4°C. The lysate was centrifuged at 14,500 rpm for 1 min, and the supernatant was dialyzed against buffer D (20 mM HEPES pH 7.9, 20% glycerol, 0.1 M KCl, 10 mM β-mercaptoethanol, 2 mM EDTA, 1 mM PMSF, and 0.32 µg/ml pepstatin A). The dialysate was centrifuged at 14,500 rpm for 20 min, and the supernatant was frozen in aliquots at –70°C. The protein concentration of all extracts was quantified by Bradford assay.
Electrophoretic mobility shift and supershift assays.
Complementary oligonucleotides from +48 to +75 were synthesized for each allele (–763C GCCGTTCGCACAGCCCCCCGCGCCCAGA and –763G GCCGTTCGCACAGCCGCCCGCGCCCAGA), annealed, and labeled by extension with the Klenow polymerase and [32P]dCTP.
Binding reactions were carried out in 20 µl of binding buffer (20 mM HEPES pH 7.5, 50 mM KCl, 0.1 mM EDTA, 10% glycerol, 0.5 M MgCl2, 0.5 M spermidine, 50 mM DTT, and 5 µg/µl BSA) containing 1 µg/µl of poly(dI-dC) in the presence or absence of 20 µg of nuclear extracts. They were incubated at room temperature for 10 min before the addition of 0.25 pmol of each labeled DNA probe and then incubated for an additional 15 min at 4°C. In supershift experiments, 2 µg of anti-Sp1 or anti-Sp3 antibodies (Santa Cruz Biotechnology) were added before the addition of the probe.
The DNA-protein complexes were electrophoresed on a 4% polyacrylamide gel in 0.25x Tris-borate-EDTA (TBE) buffer. Gels were dried and exposed to X-ray film for 2 days at –80°C.
 |
RESULTS AND DISCUSSION
|
|---|
The importance of small differences in gene expression in the determination of individual phenotypes has been recently acknowledged. The SNPs located in regulatory regions could contribute to these differences. The g.763G>C SNP is localized in the first untranslated exon of the bovine FASN gene and may therefore affect its expression. The sequence alignment of the 5' flanking region of the bovine FASN gene showed that the sequence 170 bp upstream from the transcription initiation site (TIS) was 90% identical to both human and murine genes (25), but the untranslated exon 1 had a much lower degree of similarity (Fig. 1). However, the GC-rich region encompassing the g.763G>C SNP (+60 to +72 from the bovine TIS) was more conserved, presenting 100% and 69% identity with the human and murine genes, respectively. The clustering of conserved regions among different species suggests a role for them. In this case, the role would imply regulation of FASN gene expression. This becomes reinforced by the prediction of cis elements of the Sp family in the +60/+72 GC box. Consequently, the present study was conducted to analyze the possible functional changes produced by the g.763G>C SNP.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1. Sequence alignment of the FASN promoter of different species. The first noncoding exon is in bold. The basic cis elements described in human or rat are shaded in gray, as well as the +60/+72 GC box (Sp element) including the g.763G>C single nucleotide polymorphism (*).
|
|
First, the fragment –570/+270 spanning the SNP was cloned into the pGL3 basic vector. The regulatory elements important for the basal FASN promoter activity were identified within the –248/–19 region in rat (17). Thus, the bovine FASN constructs would contain the most important regulatory elements of the promoter. The constructs were assayed in three different cellular lines, namely, 3T3L1, HepG2, and MCF-7. All of these are known to express endogenous FASN (13, 18, 33), and so they were considered to possess the physiological requirements for bovine FASN reporter gene expression. The results showed a consistent and significant difference between both alleles, the G allele being 40% stronger than the C allele (Fig. 2). These results indicate that both alleles are functionally different. The C allele is associated with a higher milk fat content in Holstein-Friesian cows (24). Therefore, given that the abundance of FASN mRNA in a tissue determines the tissue content of FASN protein (5), higher promoter strength should be expected for the C construct. However, the results observed were exactly the contrary: the construct having the C allele, which is associated with higher milk fat content, presented lower promoter activity than the G allele in all the cellular lines assayed.

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 2. Luciferase reporter assays. C and G allele constructs were transfected into 3T3L1, HepG2, and MCF-7 cells. Relative luciferase activities are shown as means ± SE expressed relative to the construct containing the C allele. Significant promoter activity differences were found between alleles in all the cellular lines (*P < 0.05).
|
|
To elucidate the molecular mechanisms underlying these results, we proceeded to further investigate the sequence spanning the SNP by analyzing its TF binding activity by band shift assay (Fig. 3). The experiments were carried out in the presence of labeled –763C and –763G probes and nuclear extracts from 3T3L1, HepG2, and MCF-7 cells. Two main and specific complexes (A and B) were detected in all the extracts with both probes. However, the –763G complexes were almost undetectable. Therefore, the G>C transversion increased the binding capacity of the nuclear proteins, implying a sequence-specific interaction with functionally relevant nucleotides. With the exception of MCF-7, the intensity of the B complex was very low compared with the A complex. Given that the A complex presented higher binding affinity, the TF involved with the complex would have a stronger influence over the control of the promoter activity.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 3. Supershift assays of 3T3L1, HepG2, and MCF-7 cell nuclear extracts. Both –763C and –763G probes were incubated with or without nuclear extract (NE) and anti-Sp1 antibody (2 µg), anti-Sp3 antibody (2 µg), 100 molar excess of the –763C/G unlabeled probes, or 100 molar excess of a nonspecific unlabeled probe (NS). The main specific complexes (A and B) are indicated with arrows.
|
|
Since Sp elements were predicted within the region surrounding the SNP, supershift assays were also carried out with antibodies against the Sp factors previously reported to regulate FASN expression, Sp1 and Sp3 (10, 32) (Fig. 3). In all the cell extracts, the dominant TF binding the –763C probe was Sp1. The A complex was mostly supershifted in 3T3L1 and HepG2 extracts by anti-Sp1, while both A and B complexes were completely supershifted in MCF-7 extracts. On the other hand, in both 3T3L1 and HepG2 cells, the A and B complexes were poorly and totally supershifted by anti-Sp3, respectively. The total binding capacity for the G allele was lower, but the same trends occurred in both alleles in that Sp1 was more specifically bound to form the A complex while Sp3 was more specifically bound to form the B complex. However, in both 3T3L1 and HepG2 cells, the intensity of the B complex was very low, suggesting a major role for the A complex as discussed above. Indeed, the fact that MCF-7 cells only bound Sp1 reinforced the major role of this TF given that, although both 3T3L1 and HepG2 cells also bound Sp3, the promoter activity of all the cellular lines assayed was identical (Fig. 2). Thus the C allele predominantly bound Sp1 while the G allele hardly did, but the promoter activity of the former was significantly lower. Therefore, Sp1 binding to the C allele element must repress the FASN promoter in all the cellular lines assayed. Interestingly, Sp1 was previously reported to repress the FASN promoter in rat hepatocytes in vitro while Sp3 activated it (10). As a result, the rate of bound Sp1/Sp3 could modulate the bovine FASN promoter activity.
In ruminants about one-half of the milk fatty acids (molar percent) are derived from de novo synthesis (1) in the epithelial cells of the mammary gland (MG) (1, 7, 20). The promoter activities and the Sp-binding profiles were very consistent among all the cellular lines studied. However, although the previous results could explain the basic mechanism underlying the control of the bovine FASN promoter through the +60/+72 element as well as the effect of the SNP over it, the effect of the g.763G>C SNP within the setting of the MG during lactation still remained unclear at this point. To further analyze the role of the SNP in relation to the milk fat content association in cattle, band shift and supershift assays were carried out with nuclear extracts from bovine LMG (Fig. 4). As was seen for the cellular lines, the G>C substitution increased the binding capacity of the nuclear proteins. The intensity of the –763C complexes was also significantly stronger than that of the –763G complexes. By contrast, no binding of Sp1 was detected, and thus no Sp1-mediated repression of the bovine gene could be expected in the LMG. On the other hand, both A and B specific complexes were partially and completely supershifted by anti-Sp3, respectively. Hence, the bovine FASN element presented different TF-binding activity in the LMG than in the cellular lines studied. The activity of FASN (and other key enzymes in lipid synthesis) increased fivefold during lactation in the MG (20). This and many other metabolic changes occurring in the MG during lactation to produce milk should require in turn changes in the gene expression profiles mediated by different tissue-specific mechanisms. For this reason, the different TF-binding pattern observed in the LMG may be due to a tissue-specific regulation mechanism of the FASN element in this tissue. Thus the specific binding of Sp3 to the C allele could modulate FASN promoter activity in the bovine LMG. It is worth noting that a similar phenomenon was described previously (31). In rat MG, although both Sp1 and Sp3 proportionally increase in abundance during lactation and both are clearly involved in the induction of the connexin 26 gene when the MG is fully differentiated, Sp3 is the dominant TF that binds to the connexin 26 promoter (31). In this situation, only Sp3 would be involved, and this may account for the association of the C allele with higher milk fat content in dairy cattle.

View larger version (101K):
[in this window]
[in a new window]
|
Fig. 4. Supershift assay of bovine lactating mammary gland (LMG) nuclear extracts. Both –763C and –763G probes were incubated with or without nuclear extract (NE) and anti-Sp1 antibody (2 µg), anti-Sp3 antibody (2 µg), 100 molar excess of the –763C/G unlabeled probes, or 100 molar excess of a nonspecific unlabeled probe (NS). The main specific complexes A and B are indicated with arrows.
|
|
In summary, our results demonstrate that the g.763G>C SNP altered bovine FASN promoter activity in vitro and binding of the sequence by Sp1/Sp3 TFs. In LMG, only Sp3 bound to the +60/+72 GC box, mainly in the presence of the C allele. Therefore, the g.763G>C SNP could contribute to changes in FASN gene expression, which may explain the association of the SNP with milk fat content in dairy cattle (24).
 |
GRANTS
|
|---|
This work has been supported by the Gobierno de Aragón (Grant B063/2003), the Programa Europa de Estancias de Investigación (CAI-Gobierno de Aragón), the Spanish Ministerio de Educación y Ciencia (Project AGL2006-05762), and the Spanish Instituto de Salud Carlos III (Grant PI061068 to J. C. Rodríguez-Rey).
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: L. Ordovás, Laboratorio de Genética Bioquímica, Facultad de Veterinaria, Miguel Servet 177, 50013 Zaragoza, Spain (e-mail: lordovas{at}unizar.es).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Bauman DE, Davis CL. Biosynthesis of milk fat. In: Lactation: a Comprehensive Treatise, edited by Larson BL, Smith VR. New York: Academic, 1974, p. 31–75.
- Berndt J, Kovacs P, Ruschke K, Kloting N, Fasshauer M, Schon MR, Korner A, Stumvoll M, Bluher M. Fatty acid synthase gene expression in human adipose tissue: association with obesity and type 2 diabetes. Diabetologia 50: 1472–1480, 2007.[CrossRef][Web of Science][Medline]
- Boichard D, Grohs C, Bourgeois F, Cerqueira F, Faugeras R, Neau A, Rupp R, Amigues Y, Boscher MY, Leveziel H. Detection of genes influencing economic traits in three French dairy cattle breeds. Genet Sel Evol 35: 77–101, 2003.[CrossRef][Web of Science][Medline]
- Buckland PR, Hoogendoorn B, Guy CA, Coleman SL, Smith SK, Buxbaum JD, Haroutunian V, O'Donovan MC. A high proportion of polymorphisms in the promoters of brain expressed genes influences transcriptional activity. Biochim Biophys Acta 1690: 238–249, 2004.[Medline]
- Clarke SD. Regulation of fatty acid synthase gene expression: an approach for reducing fat accumulation. J Anim Sci 71: 1957–1965, 1993.[Abstract]
- Dignam JD, Martin PL, Shastry BS, Roeder RG. Eukaryotic gene transcription with purified components. Methods Enzymol 101: 582–598, 1983.[Web of Science][Medline]
- Dils RR. Comparative aspects of milk fat synthesis. J Dairy Sci 69: 904–910, 1986.[Abstract/Free Full Text]
- Falaki M, Prandi A, Corradini C, Sneyers M, Gengler N, Massart S, Fazzini U, Burny A, Portetelle D, Renaville R. Relationships of growth hormone gene and milk protein polymorphisms to milk production traits in Simmental cattle. J Dairy Res 64: 47–56, 1997.[CrossRef][Web of Science][Medline]
- Fukuda H, Iritani N, Noguchi T. Transcriptional regulatory regions for expression of the rat fatty acid synthase. FEBS Lett 406: 243–248, 1997.[CrossRef][Web of Science][Medline]
- Fukuda H, Noguchi T, Iritani N. Transcriptional regulation of fatty acid synthase gene and ATP citrate-lyase gene by Sp1 and Sp3 in rat hepatocytes(1). FEBS Lett 464: 113–117, 1999.[CrossRef][Web of Science][Medline]
- Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41: 95–98, 1999.
- Hoogendoorn B, Coleman SL, Guy CA, Smith K, Bowen T, Buckland PR, O'Donovan MC. Functional analysis of human promoter polymorphisms. Hum Mol Genet 12: 2249–2254, 2003.[Abstract/Free Full Text]
- Jayakumar A, Tai MH, Huang WY, al-Feel W, Hsu M, Abu-Elheiga L, Chirala SS, Wakil SJ. Human fatty acid synthase: properties and molecular cloning. Proc Natl Acad Sci USA 92: 8695–8699, 1995.[Abstract/Free Full Text]
- Kovacs P, Harper I, Hanson RL, Infante AM, Bogardus C, Tataranni PA, Baier LJ. A novel missense substitution (Vall483Ile) in the fatty acid synthase gene (FAS) is associated with percentage of body fat and substrate oxidation rates in nondiabetic pima Indians. Diabetes 53: 1915–1919, 2004.[Abstract/Free Full Text]
- Loftus TM, Jaworsky DE, Frehywot GL, Townsend CA, Ronnett GV, Lane MD, Kuhajda FP. Reduced food intake and body weight in mice treated with fatty acid synthase inhibitors. Science 288: 2379–2381, 2000.[Abstract/Free Full Text]
- Morris CA, Cullen NG, Glass BC, Hyndman DL, Manley TR, Hickey SM, McEwan JC, Pitchford WS, Bottema CDK, Lee MAH. Fatty acid synthase effects on bovine adipose fat and milk fat. Mamm Genome 18: 64–74, 2007.[CrossRef][Web of Science][Medline]
- Moustaid N, Beyer RS, Sul HS. Identification of an insulin response element in the fatty acid synthase promoter. J Biol Chem 269: 5629–5634, 1994.[Abstract/Free Full Text]
- Moustaid N, Sakamoto K, Clarke S, Beyer RS, Sul HS. Regulation of fatty acid synthase gene transcription. Sequences that confer a positive insulin effect and differentiation-dependent expression in 3T3-L1 preadipocytes are present in the 332 bp promoter. Biochem J 292: 767–772, 1993.[Web of Science][Medline]
- Mozas P, Galetto R, Albajar M, Ros E, Pocovi M, Rodriguez-Rey JC. A mutation (–49C>T) in the promoter of the low density lipoprotein receptor gene associated with familial hypercholesterolemia. J Lipid Res 43: 13–18, 2002.[Abstract/Free Full Text]
- Neville MC, Picciano MF. Regulation of milk lipid secretion and composition. Annu Rev Nutr 17: 159–183, 1997.[CrossRef][Web of Science][Medline]
- Pampin S, Rodriguez-Rey JC. Functional analysis of regulatory single-nucleotide polymorphisms. Curr Opin Lipidol 18: 194–198, 2007.[Web of Science][Medline]
- Ponsuksili S, Murani E, Walz C, Schwerin M, Wimmers K. Pre- and postnatal hepatic gene expression profiles of two pig breeds differing in body composition: insight into pathways of metabolic regulation. Physiol Genomics 29: 267–279, 2007.[Abstract/Free Full Text]
- Roy R, Gautier M, Hayes H, Laurent P, Osta R, Zaragoza P, Eggen A, Rodellar C. Assignment of the fatty acid synthase (FASN) gene to bovine chromosome 19 (19q22) by in situ hybridization and confirmation by somatic cell hybrid mapping. Cytogenet Cell Genet 93: 141–142, 2001.[CrossRef][Web of Science][Medline]
- Roy R, Ordovas L, Zaragoza P, Romero A, Moreno C, Altarriba J, Rodellar C. Association of polymorphisms in the bovine FASN gene with milk-fat content. Anim Genet 37: 215–218, 2006.[CrossRef][Web of Science][Medline]
- Roy R, Taourit S, Zaragoza P, Eggen A, Rodellar C. Genomic structure and alternative transcript of bovine fatty acid synthase gene (FASN): comparative analysis of the FASN gene between monogastric and ruminant species. Cytogenet Genome Res 111: 65–73, 2005.[CrossRef][Web of Science][Medline]
- Roy R, Zaragoza P, Gautier M, Eggen A, Rodellar C. Radiation hybrid and genetic linkage mapping of two genes related to fat metabolism in cattle: fatty acid synthase (FASN) and glycerol-3-phosphate acyltransferase mitochondrial (GPAM). Anim Biotechnol 16: 1–9, 2005.[CrossRef][Web of Science][Medline]
- Schweizer M, Roder K, Zhang L, Wolf SS. Transcription factors acting on the promoter of the rat fatty acid synthase gene. Biochem Soc Trans 30: 1070–1072, 2002.[CrossRef][Web of Science][Medline]
- Sourdioux M, Brevelet C, Delabrosse Y, Douaire M. Association of fatty acid synthase gene and malic enzyme gene polymorphisms with fatness in turkeys. Poult Sci 78: 1651–1657, 1999.[Abstract/Free Full Text]
- Sul HS, Wang D. Nutritional and hormonal regulation of enzymes in fat synthesis: studies of fatty acid synthase and mitochondrial glycerol-3-phosphate acyltransferase gene transcription. Annu Rev Nutr 18: 331–351, 1998.[CrossRef][Web of Science][Medline]
- Taylor JF, Coutinho LL, Herring KL, Gallagher DS Jr, Brenneman RA, Burney N, Sanders JO, Turner JW, Smith SB, Miller RK, Savell JW, Davis SK. Candidate gene analysis of GH1 for effects on growth and carcass composition of cattle. Anim Genet 29: 194–201, 1998.[CrossRef][Web of Science][Medline]
- Tu ZJ, Kollander R, Kiang DT. Differential up-regulation of gap junction connexin 26 gene in mammary and uterine tissues: the role of Sp transcription factors. Mol Endocrinol 12: 1931–1938, 1998.[Abstract/Free Full Text]
- Wolf SS, Roder K, Schweizer M. Role of Sp1 and Sp3 in the transcriptional regulation of the fatty acid synthase gene. Arch Biochem Biophys 385: 259–266, 2001.[CrossRef][Web of Science][Medline]
- Yeh CW, Chen WJ, Chiang CT, Lin-Shiau SY, Lin JK. Suppression of fatty acid synthase in MCF-7 breast cancer cells by tea and tea polyphenols: a possible mechanism for their hypolipidemic effects. Pharmacogenomics J 3: 267–276, 2003.[Web of Science][Medline]
- Zhang S, Knight TJ, Reecy JM, Beitz DC. DNA polymorphisms in bovine fatty acid synthase are associated with beef fatty acid composition. Anim Genet 39: 62–70, 2008.[CrossRef][Web of Science][Medline]
Copyright © 2008 by the American Physiological Society.