|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3 Department of Medicine, Johns Hopkins School of Medicine, Johns Hopkins University, Baltimore, Maryland
1 Department of Physiology, Johns Hopkins School of Medicine, Johns Hopkins University, Baltimore, Maryland
2 Instituto de Biophysica Carlos Chagas, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
| ABSTRACT |
|---|
|
|
|---|
gene array; Dent disease; cholesterol; endocytosis
| INTRODUCTION |
|---|
|
|
|---|
The previous studies of the Willnow and Jentsch groups used gene arrays on whole kidney from the megalin knockout and Jentsch Clcn5 KO mice. These revealed 21 and 58 changes in gene expression, respectively (23, 29). We wondered whether this may be due to the fact that contamination from medullary thick ascending limb cells and collecting ducts as well as other tubules in the cortex including distal tubules, collecting ducts, or vascular tissue would blunt changes attributed to the proximal tubule. Therefore, the goal of this gene array was to determine what adaptations occur in the genes of the proximal tubules after a knockout of Clcn5. By isolating proximal tubules, we hypothesized that the gene profile might give some hint as to the underlying molecular compensations that occur from the knockout of Clcn5 in that tubule. We found that numerous genes of biological process or molecular function had changes in mRNA. This gene array shows that there may be substantial, heretofore unexpected changes in metabolism in the proximal tubule of these Clcn5 knockout mice.
CLC5 is a proton/chloride exchanger (37) expressed in renal tubules including the thick ascending limb and the cortical collecting ducts, but the highest expression is in the proximal tubule (12). Clc5 is found in the early endosome, where it is thought to help acidify the endosomal compartment in conjunction with H+-ATPase (12, 15, 28). Thus Clc5 provides the counterion, chloride, for proton movement across the endosomal membrane. It has already been found that a lack of Clc5 causes several important changes in transporters of the kidney of the Clcn5 KO (34). These changes are thought to occur because the early endosomal compartment, which is involved in trafficking of proteins from the apical membrane, has an increased pH in the Clcn5 KO. For example, in the Clcn5 KO, megalin, cubulin, the sodium/proton exchanger Slc9a3 (Nhe3), and the sodium-phosphate cotransporter Slc34a1 (Npt2a) are situated off of the plasma membrane in an intracellular compartment (10). One goal of this gene array, therefore, was to try to shed light on the causes of this altered distribution of transporters by determining whether genes that control trafficking, endosome function, or ion transport are altered in expression level.
We previously found (39) that the Guggino Clcn5 KO, like human Dent disease patients not in renal failure, has twofold elevated 1
,25-dihydroxyvitamin D3 compared with wild-type mice (WT), even though vitamin D binding protein (DBP) is lost as part of the low-molecular-weight proteinuria. The Guggino Clcn5 KO does not have a serum parathyroid hormone (PTH) level that is different from WT (39). Therefore, the Guggino Clcn5 KO appears to mimic Dent disease patients, who usually have normal or slightly lowered PTH levels (38). Although the Jentsch mouse and Guggino mouse models both lack mRNA and protein for Clcn5 and both mice have a similar knockout strategy that causes disruption of Clcn5 at the pore region, the Jentsch ClCn5 KO has low levels of 1
,25- dihydroxyvitamin D3, thought to be due to urinary loss of DBP (34). Lowered serum 1
,25-dihydroxyvitamin D3 is also found in the megalin knockout mouse, which also loses DBP into the urine because megalin, the receptor for DBP uptake, is absent (23). What causes the different outcomes of serum 1
,25-dihydroxyvitamin D3 in these three mice? Can gene array determine what compensations occur in the ClCn5 KO model compared with WT?
The gene array performed by the Jentsch group on Clcn5 KO (29) found that there was an eightfold decreased mRNA for the 1
,25-dihydroxyvitamin D3 24-hydroxylase (Cyp24a1). When the conversion of 1
,25-dihydroxyvitamin D3 to 1
,24,25-trihydroxyvitamin D3 occurs, the less potent 24-hydroxylated by-product has a much reduced binding to the vitamin D receptor. Thus transcription of 1
,25-dihydroxyvitamin D3-dependent genes is decreased. But a decrease in Cyp24a1 would cause a slowed conversion of the active hormone 1
,25-dihydroxyvitamin D3 to the inactive form 1
,24,25-trihydroxyvitamin D3, thus acting to maintain levels of 1
,25-dihydroxyvitamin D3. Lowered mRNA of Cyp24a1 was also documented in the megalin knockout mouse (29).
The Jentsch gene array also indicated that the mRNA of 25-hydroxyvitamin D3 1
-hydroxylase (Cyp27b1) was about fourfold elevated (29). This result was not found in the megalin knockout mouse. Although changes in this hydroxylase would be predicted to increase the levels of 1
,25-dihydroxyvitamin D3, the actual level of serum 1
,25-dihydroxyvitamin D3 was lowered in the Jentsch Clcn5 KO and megalin knockout mouse models, but not the Guggino Clcn5 KO model. The Jentsch gene array also found that the mRNA of several proteins, which are transcriptionally regulated by 1
,25-dihydroxyvitamin D3 through the vitamin D receptor, were upregulated. These included TrpV6 (ECac2) and calbindin D28K in the kidney, but not calbindin D9K or TrpV5 (ECac1) in the intestine. Thus, although the absolute level of serum 1
,25-dihydroxy vitamin D3 was low, the kidney, but not intestinal, mRNA levels of target genes were increased. Maritzen et al. (29) propose a model that explains the results of these outcomes. The Guggino group (39) found previously that the mRNA of both the intestinal genes calbindin D9K and TrpV5 (ECac1) were increased as measured by Northern blot. This result is expected because the Guggino Clcn5 KO mice have higher serum 1
,25-dihydroxyvitamin D3 than WT (39). Because of the importance of Cyp27b1 to calcium balance, we measured protein levels of this enzyme.
| METHODS |
|---|
|
|
|---|
10 min) with a tissue homogenizer (Kontes Glass, Vineland, NJ) designed for Eppendorf tubes. RNA was isolated according to the TRIzol protocol (GIBCO BRL, Gaithersburg, MD). After dissection of
80–100 segments of 2-mm length per kidney, the RNA from three or four mice was combined to have enough RNA per chip. Three chips were used for each of wild-type and knockout samples. After the ethanol precipitation step in the TRIzol extraction procedure, the RNA was purified with the Qiagen RNeasy Total RNA isolation kit. Quantification of the RNA yield was assessed by spectrophotometric analysis. Absorbance (A) was checked at 260 and 280 nm for determination of sample concentration and purity. The A260-to-A280 ratio was between 2.0 and 2.1. The total RNA had a concentration of 0.8–1 µg/µl, in order to obtain sufficient quantity of labeled cRNA for hybridization on the GeneChip expression probe arrays. The cDNA synthesis protocol was performed with 7.5 µg of total RNA as starting material. Double-stranded cDNA was synthesized, and then the biotin-labeled cRNA was generated and fragmented for target hybridization. The washing, staining, and scanning of probe arrays was performed according to Affymetrix sample preparation procedures as outlined in the Affymetrix GeneChip Expression Analysis Technical Manual (no. 701021 rev. 2). The hybridization was performed in the Johns Hopkins Gene Array Center.
The RT-PCR reaction was performed with a program of 94°C for 45 s, 60°C for 45 s, 52–62°C for 45 s, 72°C for 45 s, using 32–36 cycles. RT-PCR primer sequences were taken from the hybridized sequences of genes on the MOE 430A gene chip. These sequences and their annealing temperatures are Angpt1 (59): 1424485_AT, forward attcaacaccggaaagatgg, reverse tccctttgctctgtgattcc; Gc (60): 1426547_AT, forward cagctgctgaaccacttcaa, reverse accatggaggatttctgtcg; F5 (60): 1449269_AT, forward aacggatgttccacaccact, reverse accatggagaggatttctgtcg; Gucyla3 (62): 1434141_AT, forward tcatcctcttaagctgtgcagt, reverse ggaaccgtacatggagcttcta; Hmgcs2 (52): 1423858_A_AT, forward cccctgaggaattcacagaa, reverse tctccattagacgggacacc; Clcn5 (59): 1429400_AT, forward cagcatcttggtcatgtcac, reverse ggctactgcgactgaagc; Cxc11 (59): 1419209_AT, forward gcacctgtctggtgaacg, reverse ccacacatgtcctcaccc; Gadd45g (52): 1453851_A_AT, forward tggtctgatcgacttggtga, reverse cagtcggctaagtccagctc; NT5e (59): 1428547_AT, forward gtcctgtgaccaagtgagca, reverse ccttatttactcgccaagca; and Scl10a2 (59): 1450245_AT, forward caaccagatgagaagtag, reverse gaggcttaagcttctgtg.
To isolate proximal tubule protein, the kidney was first perfused with Hanks' balanced salt solution containing a cocktail tablet of protease inhibitors (Roche Diagnostics), followed with the protease solution containing collagenase B. Tubules were incubated with collagenase B and then isolated by dissection in the protease solution on ice. Groups of tubules were pooled from four or five mice and then homogenized in Eppendorf tubes in RIPA buffer (52). Western blots of tubules or kidney cortex were performed as previously described (47). The antibody for Cyp27b1 was from H. J. Ambrecht (St. Louis VA Medical Center, St. Louis, MO). The antibody for NHE10/sperm was from Dan Wang (University of Texas Southwestern, Dallas, TX). The antibody for Cap 1 was from E. Bertling and P. Lappalainen (University of Helsinki, Helsinki, Finland). The antibody to Slc10a2 was from P. A. Dawson (Wake Forest University, Winston-Salem, NC).
Quality control measures.
After scanning, array images were assessed by eye to confirm scanner alignment and the absence of significant bubbles or scratches. The 3'-to-5' ratio for GAPDHMur was confirmed to be <2 for all six chips used in the analysis. The spike controls BioB, BioC, BioD, and CreX were identified as being present in increasing intensity. GeneChip initial expression analysis was performed with GCOS 1.2 software (Affymetrix, Santa Clara, CA).
Microarray data analysis.
GeneChip expression data were exported to GeneSpring 7.2 (Silicon Genetics, Redwood City, CA), where per-chip normalization to the 50th percentile expression level and per-gene normalization to the median expression intensity in all samples was performed. Only probe sets scored as present or marginal in at least 50% of samples were included in the analysis. Data were transformed to log ratio for display and analysis. GeneSpring and S-Plus 6.2 (MathSoft, Cambridge, MA) software programs were used in data analysis and visualization. A candidate list of genes was produced by setting P
0.05 with the GeneSpring t-test with the cross-gene error model activated, which uses the Rocke-Lorenzato model of error correction (36). The filtered gene list was further refined by submitting it to ANOVA analysis using a false discovery rate (FDR) (4) cutoff of 10%. This was similar to the results from Statistical Analysis of Microarrays (43) with 10% FDR, with an 80% overlap with ANOVA results.
Those probe sets identified as significantly differentially expressed by genotype underwent an intensive search to identify biological function. Probe set sequences from the Affymetrix web site were checked against the University of California, Santa Cruz genome database to verify identity and update annotation. For individual genes with multiple probe set sequences specific to different regions of the gene, each probe set was checked separately. The resulting list of genes was submitted to PathwayAssist 3.0 (Stratagene, La Jolla, CA) for automated literature search. Gene Ontology (GO) (3) classifications using GOMiner, conserved protein family domains, and reference literature were used to construct functional groupings of genes. GOMiner was utilized to perform a two-sided Fisher's exact test to determine whether a significantly greater number than expected of differentially expressed genes occurred in a GO category (50). Gene identity was also documented with all of the NIH databases including OMIM, PubMed, etc. All original array data images and files are available online at NCBI.
| RESULTS |
|---|
|
|
|---|
RT-PCR validation was performed on some genes of increased and decreased expression. Slc10a2 mRNA expression was 17-fold elevated in Clcn5 KO vs. WT proximal tubules in the gene array and showed a sixfold increase by RT-PCR. Gadd45g mRNA was upregulated by 2.75-fold in Clcn5 KO vs. WT in the gene array and 1.8-fold in the RT-PCR experiments. Likewise, 5'-nucleotidase showed a 2.5-fold upregulation by gene array and 1.7-fold by RT-PCR. The gene transcripts downregulated in the gene array in Clcn5 KO vs. WT are Hmgcs2 (–12.5), Clcn5 (–7.14), F5 (–4.54), and Gucyla3 (–2.22) and these were –2.86, –2.86, –1.67, and –1.67, respectively, by RT-PCR. The RT-PCR mRNA changes were indicative of changes in transcripts recorded by the gene array.
In preliminary gene array studies of the whole kidney, an Affymetrix MOE 430 gene array chip was used to determine the level of expression of genes; we found that Clc5 in the Clcn5 KO kidney was 2.8-fold lower compared with WT kidney. The ratio found by Jentsch with the Affymetrix U74v2 array and the whole kidney (Clcn5 KO/WT) was 1.2-fold decreased (29). We found that 45 gene transcripts were significantly different in preliminary screens of whole kidney from Clcn5 KO and WT. Besides Clcn5, only one gene was common to the Jentsch whole kidney gene array and this was midkine, a gene that did not show a significant change in our proximal tubule array (Supplemental Table S1).1 As a first investigation of the gene array sensitivity to tissue source, we looked at the ratios of Clcn5 mRNA in the dissected proximal tubules by comparing Clcn5 KO and WT. Using the Affymetrix 430 Plus 2 array, we found that Clcn5 expression was reduced an average of fourfold across four probe sets. This validated that the MOE 430 Plus 2 gene arrays were sensitive to decreases in the mRNA for Clcn5 in proximal tubules. Because few genes were changed in whole kidney, the apparent decrease in the Clcn5 abundance seemed larger with proximal tubules; we used these for gene array analysis. We believe the more uniform proximal tubule preparation contributes to the sensitivity of this array.
From GOMiner analysis, Table 1 shows the groups significantly changed in the biological process category. The top significantly changed groups were (changed/total, P value) 1) lipid metabolism (37/255, <0.0001), 2) organ development (36/402, 0.014), 3) organismal physiological process (36/433, 0.04); 4) cellular lipid metabolism (which has many of the same changes as those in the lipid metabolism category) (30/220, <0.0001), 5) organic acid metabolism (29/217, 0.0001), and 6) ion transport (26/270, 0.016). Also notable were the changes in metal ion transport (16/142, 0.014), steroid metabolism (10/64, 0.006), lipid transport (7/31, 0.002), cholesterol metabolism (5/31, 0.04), and vitamin D metabolism (3/4, 0.0009). Categories that were not significantly changed in the biological process summary included phosphate or phosphorus metabolism, intracellular signaling (cell-surface receptor-linked signal transduction), and metal ion binding for iron, zinc, and copper (data not shown).
|
In fatty acid metabolism significantly changed transcripts (15/73) were Mte1, Pld1, Osbp13, Mapk14, Ipl, Hpgd, Apoc3, Adfp, Facl4, Hmgcs2, Facl3, Acaa1, Amacr, Hexa, Tbxas, Hsd11b1, Srd5a2, Dhrs8, Hsd3b4, Abca1, Pip5k2b, Pte2a, Hmgcs1, Dci, Lpin1, Bucs1, Vldlr, Cpt2, Cte1, Slc27a1, Galc, Mgll, Acaa2, Lip1, Facl2, Hdlbp, and Angptl3. The fatty acid long chain coenzyme A ligase, Facl3, which utilizes myristate, laurate, arachidonate, and eicosapentaenoate (–1.92, –1.67), and fatty acid coenzyme A ligase 2 (Facl2), which acts on shorter-chain fatty acids (–1.92) are downregulated. The cytosolic acyl-CoA thioesterase Cte1 (–2.27) and the long-chain fatty acid transporter Slc27a1 (–1.67) are also downregulated. The gene with the lowest fold expression is Mte1 or Acot2 (–2.27), a mitochondrial acyl-CoA thioesterase.
Because GOMiner analyzes lists of descriptions that are hand curated and does not address relationships among categories, analysis was extended by mapping the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways to the significantly changed gene list. Additional gene transcripts in the fatty acid metabolism pathway were also found to be decreased in Clcn5 KO vs. WT proximal tubules. These include acetyl-coenzyme A acyl transferase (–1.35), 3-ketacyl-CA thiolase (–1.33), acetyl-coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-coenzyme A thiolase) (–1.56), and dodecenoyl-coenzyme A
isomerase (–1.43), which are all decreased. Carnitine palmitoyltransferase 2 (Cpt2), which catalyzes the last step of fatty acid entry to mitochondria, is also decreased (–1.45). Cyp4a10 (–3.57) and Cyp4a14 (–33.3), which are involved in the metabolism of fatty acids and eicosanoids, are also decreased. One gene transcript in this pathway that is upregulated is aldehyde dehydrogenase (mitochondrial) (1.34). As a group these KEGG pathway gene changes are significant to 7.2E–09.
In the subclass of steroid metabolism 10 of 64 gene transcripts are significantly changed; these are Vldlr, Osbpl3, Hsd11b1, Srd5a2, Hmgcs1, Hdlbp, Dhrs8, Hsd3b4, Hmgcs2, and Abca1. The mRNA with the largest increase is 3-hydroxy-3-methylglutaryl (HMG)-CoA synthase 1 (Hmgcs1) (1.8). The protein for Hmgcs1 is a transcriptionally regulated enzyme of cholesterologenesis. The next gene, oxysterol binding protein-like 3 (Osbpl3), has transcripts increased 1.6-fold. The gene with the lowest transcript expression in steroid metabolism is HMG-CoA synthase 2 (Hmgcs2) (–12.5). The cholesterol efflux pump Abca1 transcripts are also decreased (–1.56) in Clcn5 KO proximal tubules compared with WT.
In the subclass of cholesterol metabolism (5/31), a number of key metabolic enzyme transcripts, including Vldlr, Hmgcs1, Hdlbp, Hmgcs2, and Abca1, are changed in Clcn5 KO vs. WT mice. Other cholesterol gene transcripts that were significantly changed but not included in this subclass include the ATP citrate lyase, which makes cellular acetyl-CoA in many tissues (10-fold). Acetyl-CoA is involved in several important biosynthetic pathways including cholesterologenesis. The rate-limiting enzyme in cholesterol synthesis, squalene monooxygenase, has a twofold increase in transcript expression. Cytoplasmic HMG-CoA synthase 1 (Hmgcs1), which mediates an early step in cholesterol synthesis, is upregulated in transcript level (1.84). Glucose-6-phosphate dehydrogenase is a key enzyme in the pentose phosphate pathway that is involved in providing reducing equivalents (NADPH) for biosynthesis of fatty acids and cholesterol. This enzyme transcript is up 1.6-fold in the Clcn5 KO proximal tubules compared with the WT proximal tubules. Abca1, a member of the ATP-binding cassette (ABC)-transporter family, is downregulated (–1.5); apolipoproteins are also decreased (–1.56-fold). It remains to be tested whether these changes in lipid, sterol, or cholesterol metabolism cause any changes in the Dent phenotype, in particular in endocytosis.
Because this disease is accompanied by significant changes in transport function, we paid particular attention to this class of genes. In the class of ion transport genes (26/270) many genes show changes in transcripts, including Atp10d, Atp6v1e, Ftl1, Kcnk5, F5, Scl03a1, Atp4a, Slc4a1, Slc10a2, Slc38a3, Slc26a7, Slc34a3, Mcoln1, Adrb2, Atox1, Cp, Slc30a7, LOC20816, Kcne1, Gabrb3, Pln, Slc39a8, Clcn5, Slc8a1, Moat6, and Clcn3. The gene expression transcripts that are most highly upregulated are the Asbt solute carrier or Slc10a2. This gene mRNA is upregulated 17-fold in the Clcn5 KO mouse proximal tubules compared with WT. This gene was also highly expressed in KO whole kidney (8-fold) compared with WT (Supplemental Table S1). Absorption of a bile analog, cholylsarcosine, which is absorbed on this transporter, was shown to increase when 1
,25-dihydroxyvitamin D3 was given. The activation of Slc10a2 by 1
,25-dihydroxyvitamin D3 is abrogated after site-directed mutagenesis or deletion of the vitamin D response element (VDRE) in the Slc10a2 (ASBT) promoter (8). The increase in this transcript may be caused by increased levels of serum 1
,25-dihydroxyvitamin D3 in the Guggino Clcn5 KO mouse. However, this protein is not increased significantly, suggesting further regulation at another level (Fig. 1). In the Jentsch gene array this transcript was decreased 69% compared with WT, which could reflect the lowered 1
,25-dihydroxyvitamin D3 in that mouse. Clcn3 transcripts are also upregulated in the Clcn5 KO tubules, as shown by four different probe sets of the gene (1.94, 1.79, 1.71, 1.69). Whether the Clc3 channel protein is upregulated in the Clcn5 KO is still unknown. The putative sodium/proton exchanger-like protein mRNA LOC208169 (NHE10/sperm) was downregulated (–2.17). The sodium/proton exchanger NHE10/sperm is thought to function by extruding protons from sperm, where lowered intracellular pH is a critical factor in sperm motility. NHE10/sperm has been found to target the plasma membrane of cells (45), where it acts functionally like a sodium/proton exchanger, but the physiology of NHE10/sperm in the kidney is not known. Western blotting shows that Nhe10/sperm is slightly decreased in Clcn5 KO proximal tubules compared with WT (data not shown), and cell fractionation shows that Nhe10 resides in the plasma membrane fraction because it localizes with the membrane marker aminopeptidase N (not shown).
|
Downregulated gene transcripts in the classes of vesicle-mediated transport and endocytosis include synaptotagmin 1 (–1.43), which is a complexin/synaptotagmin 1 switch that controls fast synaptic vesicle exocytosis. The complexin proteins are fusion clamps. By arresting vesicle secretion just prior to fusion, complexin primes select vesicles for a fast, synchronous response to calcium (30). The gene for the very low-density lipoprotein receptor Vldlr (–1.41) is highly expressed in tissues that are active in fatty acid metabolism. Mice lacking either Reln or Vldlr and ApoER2 (42) exhibit a dramatic increase in the phosphorylation level of the microtubule-stabilizing protein tau. Stabilin-2 (Stab2) (–1.54) is part of a novel family of fasciclin domain-containing hyaluronan receptor homologs. Stabilins are present in early endosomal antigen (EEA)-1-positive organelles colocalizing with endocytosed BSA (17). The cholesterol efflux transporter Abca1 (–1.56) belongs to a group of traffic ATPases. Mutations in the ABCA1 gene cause Tangier disease, a disease of low serum high-density lipoprotein (HDL) (51). The membrane transporter ATP-binding cassette transporter A1 (ABCA1) has been shown to be the rate-limiting step in the initial formation of plasma HDL particles. The mechanisms of action of ABCA1, including its role in the vesicular transport of lipids to the cell surface for the lipidation of HDL apolipoproteins, are not fully understood.
Even though there were few genes associated with vitamin D3 metabolism, they were significantly changed and are of interest for the changes in vitamin D3 metabolism in this disease. The cytochrome P-450 Cyp24a1 mRNA is lowered in Clcn5 KO vs. WT mice (–6.25). Although changes in the mRNA of Cyp27b1 did not reach significance in this gene array, because of the importance of this protein for vitamin D3 metabolism we measured the protein level. The protein level of Cyp27b1 was highly elevated in KO vs. WT cortex, and as a control it was shown that injected 1
,25-dihydroxyvitamin D3 lowered the protein in the cortex of both WT and KO mice, as expected (Fig. 2). Also of note is the fact that the mRNA of the group-specific component (Gc) globulin, or DBP, is downregulated in Clcn5 KO kidney proximal tubules (–5). The function of DBP is to carry 25-hydroxyvitamin D3 from the liver to the bloodstream and then to the proximal tubule, where it is internalized by megalin to release 25-hydroxyvitamin D3 to the 25-hydroxyvitamin D3 1
-hydroxylase, Cyp27b1, found there. We wondered how the renal loss of DBP could be compatible with elevated 1
,25-dihydroxyvitamin D3 in the Clcn5 KO mouse. Thus we measured the level of DBP in blood. DBP was found in the ClCn5 KO but not WT urine, as expected. In the same animals there were equal amounts of DBP in the serum of WT and ClCn5 KO mice (Fig. 3). Similar levels of DBP in the serum of both WT and ClCn5 KO mice suggest that liver synthesis of DBP in the ClCn5 KO keeps pace with losses in the urine.
|
|
|
|
|
-methylacyl-CoA racemase (Amacr) (1.6), fucosyltransferase 9
(1.3), lipoprotein lipase Lpl (–1.5), carnitine palmitoyltransferase 2 (Cpt2) (–1.43), argininosuccinate synthetase 1 (Ass1) (–1.79), methylcrotonoyl-coenzyme A carboxylase 1 (
) (Mccc1) (–1.64), glycine dehydrogenase (Gldc) (–1.73), fucosyltransferase Fut9 (–1.75), and monoglyceride lipase (Mgll) (–1.96, –2.38, –1.67). Many genes in the catalytic activity category are associated with signaling. These genes include guanylate binding protein 1 interferon-inducible (Gbp1) (2.5), protein tyrosine phosphatase, nonreceptor type 8 (Ptpn8) (2.1), phosphodiesterase A1 (calmodulin-dependent) (Pde1a) (2.0), guanine nucleotide binding protein (G protein), β polypeptide 1 (Gnb1) (1.7), calcium/calmodulin-dependent protein kinase I (Camk1) (–1.39), p21 (CDKN1A)-activated kinase 2 (Pak2) (–1.43), guanylate cyclase 1 soluble
3 (Gucy1a3) (–1.56, –2.22), phosphatidylinositol-4-phosphate 5-kinase, type II, β (Pip5k2b) (–1.54), protein kinase, cAMP-dependent, regulatory, type II,
(Prkar2a) (–1.56), protein tyrosine phosphatase, receptor type, F polypeptide (Ptprf) (–1.64), and phosphoinositide 3-kinase, class 2,
polypeptide (Pik3c2a) (–2.0, –1.82). The second major significantly changed group in the molecular function summary is transporter activity (54/553). The changed genes in this category are Nup210, Vldlr, Slc34a3, Slc10a2, Apoc3, Atox1, Lpl, Dbp, Mcoln1, Mtac2d1, Slcoca1, Atp6v1e, Aqp6, Slc39a8, Aqp3, Garb3, Gc, Slc38a3, Kcne1, Hdlbp, Atp10d, Slc25a20, Syt1, Slc27a1, Prkar2a, Cox6a2, Snap29, Scl7a7, Abcb10, Slc7a13, Maoa, Kdelr2, Cp, Tm9sf2, Slc4a1, Moat6, Slc18a1, Hbb-b1, Rhbg, Atp4a, Clcn3, Abcd4, Slc2a4, Ttr, Slc6a13, Loc208169, Slc8a1, Gjb1, Clcn5, Kcnk5, Pln, Slc30a7, Slc27a7, F5. Of note is the vacuolar H+-ATPase Atp6v1e1 (1.40), which is involved in acidification of endosomes and lysosomes, a physiological function that is known to be decreased in Dent disease (16, 18), and two potassium channels, Kcne1 (1.43) and Kcnk5 (1.39), that are involved in plasma membrane K transport and perhaps transepithelial transport. Also important are the group of Slc transporters that have significant changes in mRNA that have not been previously been reported.
A list of all significant genes changed (10% FDR) in the proximal tubule gene array is provided in Supplemental Table S2. This table shows, in order, the genes of highest and lowest individual changes rather than the significant groupings of genes as shown in Tables 1 and 2. All other results are available in the NCBI GEO database as series GSE10162 at the link http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=phwtxcisimisetq&acc=GSE10162.
| DISCUSSION |
|---|
|
|
|---|
One of the most unexpected aspects of this work are the changes in lipid metabolism, as judged by the fact that this category has such a large number of genes that were altered in expression when comparing the Clcn5 KO mice proximal tubules and the WT proximal tubules. There is a decrease in mRNA of all of the changed genes in this fatty acid metabolism group. Likewise, the mRNA of Cyp4a14, an enzyme involved in fatty acid and eicosanoid metabolism, is greatly decreased. These changes in metabolism have not been reported previously.
In cholesterol metabolism the most important transcript increase is that of squalene monooxygenase, which is a key regulatory enzyme in cholesterol synthesis. Soluble Hmgcs1 mRNA is upregulated almost twofold, and the cholesterol efflux pump mRNA for Abca1 is decreased. The large increase in mRNA for the ATP citrate lyase gene, which makes acetyl-CoA, is also important in possibly contributing to cholesterologenesis. It has been reported that when the synthesis of cholesterol is inhibited in the endosome for >2 h, the localization patterns of the late endosomes and lysosomes are altered and their mobility is retarded (40). If there are changed amounts of cholesterol present in proximal tubule cells of the Clcn5 KO mice, it is also a possibility that the endosomal pattern is changed and there might be changes in endocytosis as a result. This could not be hypothesized from previous data on Dent disease patients or mice. These data suggest not only that the loss of Clcn5 disrupts the endosomal pathway but that other secondary factors could also affect endocytosis. For example, caveolin 2 mRNA is also upregulated. Caveolin 2-mediated transport is a process that is cholesterol dependent. Upregulation of caveolin protein could affect caveolin/cholesterol-mediated endocytosis. To date, the process of caveolin-mediated endocytosis has not been evaluated in the Clcn5 KO. Could other compensatory pathways of endocytosis be upregulated in response to the decrease in receptor-mediated endocytosis caused by the loss of Clcn5?
Surprisingly, there are not many mRNA changes in pathways that are likely to be involved in protein reabsorption in the proximal tubule. It was previously shown that megalin protein is decreased in the Clcn5 KO mouse (10), but there is no change in the mRNA shown in this gene array. Likewise, there is no change in the mRNA of the Slc34a1 (Npt2a) transporter, even though this protein is decreased in the Clcn5 KO mouse kidney cortex compared with WT (34). Two transporters do show reductions in mRNA that could correspond to the physiological phenotype of Dent disease. If decreases in Nhe10/sperm and the phosphate transporter Slc34a3 mRNA translate into changes in transporter protein, they may contribute to the decreased uptake of both sodium and phosphate in the proximal tubules. The decrease in Nhe10/sperm mRNA is found at the protein level, and this protein has been found to localize at the plasma membrane (44). The presence of NHE10/sperm in kidney proximal tubule has not been reported previously. It is possible that decreases in these transporters contribute to the changes already found for Slc9a3 (Nhe3) and Slc34a1 (Npt2a). Both Nhe3 and Npt2a are mislocalized away from the plasma membrane in Clcn5 KO mouse proximal tubules. It is thought that this is the cause of the phosphaturia and polyuria in the Clcn5 KO and in Dent disease patients.
Another transporter with increased mRNA expression that may have physiological relevance to the Dent phenotype is Clc3, which is in the same class of intracellular ion chloride proton exchangers as Clc5. Clc3 is thought to be an intracellular exchanger, but its exact location in the proximal tubule cell is still unknown. It has been hypothesized that Clc3 or 4 and Clc5 may heterodimerize (31). If this is so, and if the protein also increases as the mRNA does, one would expect that an increase in the ion channel protein might mitigate the symptoms of Dent disease such as low-molecular-weight proteinuria. But this would only occur if the Clc3 ion channels segregated to the same vesicle population as Clcn5 and if there was enough Clc3 protein to take over the function of Clcn5. The idea that Clc3 may participate in the uptake of low-molecular-weight proteins has not been verified. This warrants further investigation with the Clcn3 KO mouse to determine whether loss of Clc3 in proximal tubules causes loss of low-molecular-weight proteins. Cystic fibrosis transmembrane conductance regulator (Cftr) knockout mice and cystic fibrosis patients with the
F508 CFTR deletion have a mild low-molecular-weight proteinuria and decreased amounts of megalin in the kidney cortex (22). This suggests that CFTR may also function like Clc5 to acidify a population of vesicles that are involved in megalin-mediated low-molecular-weight protein uptake. A gene array of the renal proximal tubules from the Cftr knockout mouse may be informative and give some similar changes in transport genes as Clcn5.
Several genes involved in vesicle-mediated transport or vesicle turnover are changed. The stabilin-2 gene is decreased. Stabilins are situated in the early endosome. The change in this gene could signal another faulty process underlying decreased receptor-mediated endocytosis in the Clcn5 KO mouse proximal tubule. In vesicle-mediated transport one of the most interesting changes in mRNA is that of the Cap1 gene. It has been reported that Clc5 binds cofilin (19); if Clc5 also binds profilin, then interaction with the Cap1 protein may also have relevance to movement through the actin matrix. Snap29 mRNA is down in Clcn5 KO tubules (–1.32). Snap29 protein is known to act as a negative modulator of neurotransmitter release, probably by slowing fusion events and vesicle turnover. Snap23, not changed in the Clcn5 KO tissue, regulates plasma membrane vesicle fusion events. Snap23 is downregulated at the mRNA level in mouse lung cystic fibrosis tissue (48). The mutated gene product of cystic fibrosis (CFTR) is a chloride channel that has decreased stability on the plasma membrane (27).
The calcium/vitamin D3 axis, including phosphate transport, is altered in Dent disease patients. Dent disease patients have elevated 1
,25-dihydroxyvitamin D3, normal to low PTH, and renal loss of calcium and phosphate. These outcomes have also received attention in the Clcn5 KO mouse models. In this gene array we found that the 1
,25-dihydroxyvitamin D3 24- hydroxylase (Cyp24a1) is downregulated significantly in proximal tubules of Clcn5 KO mice compared with WT mice, which is consistent with elevated levels of the active hormone 1
,25-dihydroxyvitamin D3 in the Guggino mouse model. The gene array performed by Maritzen et al. (29) showed an increase in the mRNA for the 25-hydroxyvitamin D3 1
-hydroxylase (Cyp27b1) in the Clcn5 KO mouse kidney. Although this present gene array did not show significant changes in the 25-hydroxyvitamin D3 1
-hydroxylase (Cyp27b1) mRNA, we investigated the protein levels of the gene product. In protein assays for Cyp27b1 there was a significant increase in the amount of Cyp27b1 in the Clcn5 KO mouse cortex compared with WT cortex. These results suggest that the significant increase in Cyp27b1 may be the cause of the increased concentration of 1
,25-dihydroxyvitamin D3 in the Guggino Clcn5 KO mouse and perhaps in Dent disease patients. Although 25-hydroxyvitamin D3 levels are normal in this mouse, the enzyme may still be substrate limited because of decreased uptake of DBP via megalin into the proximal tubules. Although DBP is lost in the urine of the Clcn5 KO mouse, serum levels of DBP are the same in WT and Clcn5 KO mice. Thus filtered DBP is not rate limiting to 24-hydroxyvitamin D3 uptake in the proximal tubule. When comparing this proximal tubule gene array to that of the Jentsch whole kidney gene array, there is overlap of only two genes, namely, Cyp24a1 and Slc10a2. Interestingly, Maritzen et al. found that Slc10a2 mRNA was downregulated, which corresponds to lowered levels of 1
,25-dihydroxyvitamin D3 in the Jentsch Clcn5 KO mice. It is possible that the great number of genes up- or downregulated in the Guggino gene array is a result of the pleiotropic effects caused by elevated serum 1
,25-dihydroxyvitamin D3. A gene array done on whole kidney of 1
,25-dihydroxyvitamin D3-treated wild-type mice compared with untreated wild-type mice shows that 94 genes were up- or downregulated (24). The vitamin D3 hydroxylases were changed, but no other changed genes were common to those in the Clcn5 gene arrays. Most importantly, the many genes associated with lipid metabolism, transport, or vesicular endocytosis are not changed in the 1
,25-dihydroxyvitamin D3 injection model.
In summary, we have shown that there are numerous changes in gene transcript levels in the comparison of proximal tubules of WT and Clcn5 KO mice. This gene array gives the fingerprint of mRNA compensations that occur with the loss of Clc5 in the proximal tubules of this mouse. These data may be compared with other gene arrays to determine what classes of genes change in a particular phenotype. Outcomes, in terms of functional or protein changes for these gene transcript changes, await further study.
| GRANTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).
1 The online version of this article contains supplemental material. ![]()
| REFERENCES |
|---|
|
|
|---|
,25-dihydroxyvitamin D3 via the vitamin D receptor. Mol Pharmacol 69: 1913–1923, 2006.
-subunit in rabbit kidney. Am J Physiol Renal Physiol 273: F615–F624, 1997.This article has been cited by other articles:
![]() |
D. Duan Phenomics of cardiac chloride channels: the systematic study of chloride channel function in the heart J. Physiol., May 15, 2009; 587(10): 2163 - 2177. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |