Physiol. Genomics Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Physiol. Genomics 32: 343-351, 2008. First published December 11, 2007; doi:10.1152/physiolgenomics.00067.2007
1094-8341/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
32/3/343    most recent
00067.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, Y.
Right arrow Articles by Liang, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, Y.
Right arrow Articles by Liang, M.
Received 22 March 2007; accepted in final form 26 November 2007.
Physiological Genomics 32:343-351 (2008)
1094-8341/08 $8.00 © 2008 American Physiological Society

Suppression of 11β-hydroxysteroid dehydrogenase type 1 with RNA interference substantially attenuates 3T3-L1 adipogenesis

Yong Liu 1, Frank Park 2,3, Jennifer L. Pietrusz 1, Guangfu Jia 2,3, Ravinder J. Singh 4, Brian C. Netzel 4 and Mingyu Liang 1

1 Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin
2 Department of Medicine, Medical College of Wisconsin, Milwaukee, Wisconsin
3 Department of Kidney Disease Center, Medical College of Wisconsin, Milwaukee, Wisconsin
4 Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, Minnesota


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD1), which regulates the local level of glucocorticoids, has been suggested to be involved in the development of obesity. A definitive functional role for 11β-HSD1 in adipogenesis, however, remains to be established. We developed 3T3-L1 cell lines stably transfected with a small hairpin RNA (shRNA) targeting 11β-HSD1. A shRNA containing two nucleotide substitutions was used as a control. Silencing of 11β-HSD1 substantially attenuated the accumulation of lipid droplets and the expression of adipogenesis marker genes, which was induced by a mixture containing either corticosterone or dexamethasone. Silencing of 11β-HSD1 increased the concentration of 11-dehydrocorticosterone in the culture supernatant but did not significantly affect the levels of corticosterone or dexamethasone. Translocation of glucocorticoid receptors to the nucleus in response to glucocorticoids was significantly attenuated by silencing 11β-HSD1. The number of cells entering the S phase of the cell cycle following the induction of adipogenesis was significantly reduced by silencing 11β-HSD1. 11β-HSD1 shRNA delivered by lentiviral vectors after the induction of differentiation, however, did not affect the progression of adipogenesis. These results indicate that 11β-HSD1 plays a significant functional role in the initiation of 3T3-L1 adipogenesis and provide new mechanistic insights into the role of 11β-HSD1 in the development of obesity and related diseases.

obesity; metabolic syndrome; glucocorticoids; cell cycle; small interfering RNA


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
OBESITY IS CLOSELY ASSOCIATED with a cluster of abnormalities that constitute metabolic syndrome, including insulin resistance, hypertension, and dyslipidemia (8, 37). Excess glucocorticoids (mainly cortisol in human and corticosterone in rodent), produced by the adrenal cortex, can result in the development of obesity.

In addition to circulating glucocorticoids, high local levels of glucocorticoids within the adipose tissue may be a key factor in the development of obesity and metabolic syndrome. 11β-hydroxysteroid dehydrogenases (11β-HSD) have received significant attention in this regard due to their ability to regulate local levels of glucocorticoids. 11β-HSD type 1 (11β-HSD1) is a microsomal enzyme that has both dehydrogenase and reductase activities in vitro using NADP or NADPH as a cofactor, respectively. Studies of intact cells (6, 20), as well as kinetic analysis of purified enzymes (21), indicate that 11β-HSD1 acts predominantly as a reductase in vivo, regenerating biologically active glucocorticoids from their inactive forms. Conversely, 11β-HSD type 2 (11β-HSD2) is a dehydrogenase that uses NADP as a cofactor to inactivate glucocorticoids.

Specific overexpression of 11β-HSD1 in visceral fat, but not in the liver, in mice causes central obesity (22, 33). Mice with 11β-HSD1 knockout (12, 24, 25) or 11β-HSD2 overexpression (9) are resistant to obesity, even on a high-fat diet or with an obesity-prone genetic background. In humans, tissue-specific dysregulation of 11β-HSD1 has also been reported in obesity (34).

An important question that has yet to be addressed is whether 11β-HSDs play a significant functional role in the differentiation of preadipocytes to adipocytes, i.e., adipogenesis. 3T3-L1, derived from mouse embryos, has been extensively used as an in vitro model for studying adipogenesis and has provided most of our current knowledge of preadipocyte differentiation. Upon treatment with a mixture consisting of methylisobutylxanthine, dexamethasone, and insulin, postconfluent 3T3-L1 can differentiate into adipocytes. It has been shown that the expression of 11β-HSD1 is upregulated during 3T3-L1 adipogenesis (7, 18, 27). However, it is not clear if 11β-HSD1 plays a functional role in 3T3-L1 adipogenesis. Glycyrrhizic acid and carbenoxolone are commonly used inhibitors of 11β-HSD, but these inhibitors cannot distinguish between 11β-HSD1 and 11β-HSD2, limiting their value as a specific tool for manipulating 11β-HSD1 (13, 41).

Our strategy was to use small hairpin RNA (shRNA)-mediated RNA interference to specifically suppress 11β-HSD1 expression in 3T3-L1 cells. The effect of 11β-HSD1 silencing on 3T3-L1 adipogenesis and related mechanisms was compared with a control shRNA that contained two nucleotide substitutions.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Culture and differentiation of 3T3-L1 cells.
3T3-L1 cells (ATCC, Manassas, VA) were seeded at a density of 1.5 x 104 cells/cm2 and cultured in DMEM supplemented with 10% calf serum at 37°C in 5% CO2 for 2 days to reach confluence. Differentiation at 2 days after reaching confluence (designated as day 0) was initiated with an MDI (0.5 mM methylisobutylxanthine, 1 µM dexamethasone, and 10 µg/ml insulin) or MCI (0.5 mM methylisobutylxanthine, 1 µM corticosterone, and 10 µg/ml insulin) mixture supplemented with 10% fetal bovine serum (5). After 48 h (day 2), the medium was changed to DMEM supplemented with 10 µg/ml insulin and 10% fetal bovine serum. The medium was refreshed every other day from that point. The serum products we used were heat-inactivated, but not charcoal stripped.

Small interfering RNA, small interfering RNA expression constructs, and stable cell line construction.
Small interfering RNAs (siRNAs) were designed, chemically synthesized, and delivered into 3T3-L1 cells (100 nM) using Lipofectamine 2000 (Invitrogen) in a similar manner to what we described previously (16). Chemically synthesized shRNA oligonucleotides targeting 11β-HSD1, or control shRNA oligonucleotides containing two nucleotide substitutions, were annealed and ligated between the BamHI and XhoI sites of pRNAT-U6.2/Lenti (Genscript, Piscataway, NJ), which contains a geneticin-resistant gene. The plasmids were extracted and purified with an EndoFree Plasmid Maxi kit (Qiagen, Valencia, CA). 3T3-L1 cells were transfected with the plasmids (µg) using Lipofectamine 2000 (Invitrogen) (µl) at a ratio of 1:2. At 48 h after transfection, the regular medium was changed to one supplemented with 400 µg/ml geneticin (Invitrogen). The cells were maintained in the selection medium throughout the subculturing process until geneticin-resistant colonies were established.

Lentiviral vector delivery of shRNA.
Lentiviral particles containing 11β-HSD1 shRNA or its nucleotide-substituted control were packaged and produced as described previously (31, 32). Briefly, 10 µg 11β-HSD1 or control shRNA plasmid, 6.5 µg pCMV{Delta}R8.74, and 3.5 µg pMD.G were cotransfected into 293T cells using the calcium-phosphate coprecipitation method. Medium was replaced after 12–14 h. After 36–48 h, the replication-defective lentiviral vectors were harvested, cleared by low-speed centrifugation, and filtered through 0.45 µm cellulose acetate filters. The viral titer was determined by FACS analysis of GFP-positive HeLa cells. 3T3-L1 cells were infected by two consecutive additions of the viral particles 24 h apart at a dose of 4 x 105 tranducing units per well in a 24-well plate.

Oil Red O staining.
The Oil Red O staining method was used to visualize lipid droplet accumulation, a characteristic of adipocytes. The cells were washed in 10% formalin for 5 min at room temperature before being incubated in fresh 10% formalin for 1 h. The cells were then washed with 60% isopropanol and allowed to dry completely. A 0.21% Oil Red O working solution was applied for 10 min to stain the cells, and 70% ethanol was used to wash the cells prior to photographing.

Cell cycle analysis.
The cells were collected by trypsin-EDTA digestion, fixed with 95% ethanol, and stained with propidium iodide. About 20,000 well separated cells were used for cell cycle analysis using flow cytometry.

Measurement of glucocorticoids and their metabolites.
Corticosterone, 11-dehydrocorticosterone, dexamethasone, and 11-dehydrodexamethasone were measured by a liquid chromatography-tandem mass spectrometry (LC-MS/MS) method as described previously (40).

Real-time PCR.
TRIzol (Invitrogen, Carlsbad, CA) was used for total RNA extraction. Real-time PCR analysis using the Taqman chemistry (Applied Biosystems, Foster City, CA) was performed as described previously (11, 16). 18S rRNA was used as an internal normalizer. Oligonucleotide sequences were: mouse 11β-HSD1, forward CTCCTCCTTGGCTGGGAAA, reverse GAACCCATCCAGAGCAAACTTG, probe FAM-CCAGCCTATGATTGCTCCCTACTCT-TAMRA; mouse 11β-HSD2, forward GCTCATCACCGGTTGTGACA, reverse GGGCTATTCAAATCCAACACTGT, probe FAM-ATCCAGTTTCTTAGCTGTCTCCTTGCCA-TAMRA; mouse CCAAT enhancer binding protein (C/EBP){alpha}, forward TATAGACATCAGCGCCTACATCGA, reverse GTCGGCTGTGCTGGAAGAG, probe FAM-CGGCCGCCTTCAACGACGAGTT-TAMRA; mouse peroxisome proliferator-activated receptor (PPAR){gamma}, forward GGCCATCCGAATTTTTCAAG, reverse GGGATATTTTTGGCATACTCTGTGA, probe FAM-TCTTGCACGGCTTCTACGGATCGAAA-TAMRA.

Western blot.
Western blot analysis was performed as described previously (14, 15, 16). The antibodies for 11β-HSD1, 11β-HSD2, and glucocorticoid receptors (GR) were from R&D Systems (Minneapolis, MN), Chemicon (Temecula, CA), and Santa Cruz Biotechnology (Santa Cruz, CA), respectively. The membrane was stained with Coomassie blue, and the total Coomassie blue intensity in each lane was used for normalization.

Cytosolic and nuclear fractionation.
The cytosolic and the nuclear fractions were obtained from cells cultured in 10 cm dishes according to the method of Sanchez et al. (36), with some modifications to buffer A (20 mM HEPES, 1 mM EDTA, and 1 mM PMSF).

Statistical analysis.
The data were analyzed by Student's t-test or analysis of variance followed by the Holm-Sidak test. The data were presented as means ± SE. P < 0.05 was considered significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Corticosterone, a natural glucocorticoid, induced 3T3-L1 adipogenesis.
The mixture commonly used for inducing 3T3-L1 adipogenesis contains dexamethasone, a synthetic glucocorticoid. We compared corticosterone, a natural glucocorticoid and the major active glucocorticoid in rodents, to dexamethasone for efficiency of inducing 3T3-L1 adipogenesis. The MCI mixture containing 1 µM corticosterone was equally or slightly more potent than the MDI mixture containing 1 µM dexamethasone in inducing 3T3-L1 adipogenesis as revealed by Oil Red O staining (data not shown). Moreover, we found that 0.5 µM corticosterone was more effective than 0.1 µM, suggesting the effect of corticosterone on 3T3-L1 adipogenesis is concentration dependent. To better understand the role of glucocorticoids, we examined both MCI and MDI treatments in most of the subsequent experiments.

Expression of 11β-HSD1 and 11β-HSD2 during 3T3-L1 adipogenesis induced by MCI or MDI.
As shown in Fig. 1A and B, mRNAs for both 11β-HSD1 and 11β-HSD2 were detectable in 3T3-L1 cells before differentiation induction. Levels of 11β-HSD1 mRNA appeared to be slightly higher than 11β-HSD2, although one should be cautious when comparing real-time PCR results between genes. 11β-HSD1 mRNA was substantially upregulated by several thousandfold after the induction of differentiation by either the MCI or MDI mixture. 11β-HSD2 mRNA was not significantly affected by the induction of differentiation.


Figure 1
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 1. Expression patterns of 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) and type 2 (11β-HSD2) during 3T3-L1 adipogenesis. mRNA levels of 11β-HSD1 (A) and 11β-HSD2 (treated with MDI, B) were quantified with Taqman real-time PCR and normalized to 18s rRNA (n = 3–4). The protein levels of 11β-HSD1 were analyzed with Western blot using 30 µg of total cellular protein. A representative blot from 2 replicate experiments is shown in C. MCI and MDI, mixtures containing corticosterone and dexamethasone, respectively, which were used to induce 3T3-L1 differentiation (see MATERIALS AND METHODS).

 
Western blot analysis indicated a similar pattern of 11β-HSD1 upregulation. In both the MCI- and MDI-treated cells, 11β-HSD1 protein was barely detectable before day 4, showed moderate expression at day 4 and day 5, and displayed a significant level of expression after day 7 (Fig. 1C). 11β-HSD2 protein was not detectable throughout the time course.

shRNA-mediated 11β-HSD1 suppression substantially attenuated 3T3-L1 adipogenesis.
We examined the functional role of 11β-HSD1 in 3T3-L1 adipogenesis by specifically inhibiting 11β-HSD1 with RNA interference. In the first step of the study, several chemically synthesized siRNAs, targeting different parts of the mouse 11β-HSD1 mRNA sequence, were transiently transfected (100 nM) with Lipofectamine 2000 into the 3T3-L1 cells. The one with the highest efficiency in suppressing 11β-HSD1 expression, siRNA 1–7, was converted to shRNA sequence shRNA 1–7. A control shRNA, shRNA 2–18, was designed to be identical to shRNA 1–7, with the exception that two of the nucleotides were substituted in a way that maintained the same GC content as shRNA 1–7 (Fig. 2A).


Figure 2
View larger version (20K):
[in this window]
[in a new window]

  		Fig. 2. 11β-HSD1 expression was substantially reduced in 3T3-L1 cells stably transfected with 11β-HSD1 small hairpin RNA (shRNA). A: sequences of 11β-HSD1 shRNA and its nucleotide-substituted control. Nucleotides substituted in the control shRNA are highlighted. B: mRNA expression levels of 11β-HSD1, normalized to 18S rRNA, in cell lines stably transfected with control shRNA (Con) or 11β-HSD1 shRNA (line 1 and line 2, L1 and L2, respectively) prior to (day 0) and after (day 2, day 4, and day 10) the induction of adipogenesis by MCI or MDI. C: protein levels of 11β-HSD1 at day 10 after the MDI treatment. We used 20 µg of total protein for Western blot analysis. A representative blotting from 4 replicate experiments is shown. *P < 0.05 vs. the control cell line, **P < 0.01 vs. the control cell line; n = 4.

 
Transfection with shRNA 1–7 plasmids and the subsequent selection (see MATERIALS AND METHODS) resulted in two geneticin-resistant cell lines, line 1 and line 2. Transfection with shRNA 2–18 resulted in a geneticin-resistant control cell line. Compared with the control cell line, the 11β-HSD1 mRNA level was significantly downregulated in line 1 and largely abolished in line 2 prior to and after induction of adipogenesis by either MCI or MDI (Fig. 2B). Concomitantly, the protein levels of 11β-HSD1 were significantly decreased in line 1 and line 2 (Fig. 2C). No difference in 11β-HSD2 mRNA levels between line 1, line 2, and the control cell line was detected (data not shown).

As shown in Fig. 3, in line 2 cells, where 11β-HSD1 expression was largely abolished, the cells almost completely lost their ability to differentiate into adipocytes. In line 1, which has moderate 11β-HSD1 suppression, adipogenesis was substantially, but not completely, suppressed. The level of adipogenesis in the cell line stably transfected with the control shRNA was similar to untransfected 3T3-L1. We have extended the Oil Red O analysis to day 31, and the staining pattern was similar to day 10: line 2 was nearly without staining and line 1 had scattered staining, suggesting long-lasting attenuation of adipogenesis (data not shown).


Figure 3
View larger version (48K):
[in this window]
[in a new window]

  		Fig. 3. Adipogenesis was substantially attenuated in 3T3-L1 cells stably transfected with 11β-HSD1 shRNA. Untransfected 3T3-L1 cells and cell lines stably transfected with control shRNA (control) or 11β-HSD1 shRNA (line 1 and line 2) were induced to differentiate by a mixture containing corticosterone (MCI) or dexamethasone (MDI). The cells were in 6 cm dishes and were stained with Oil Red O at day 10. Representative staining from 4 replicate experiments is shown.

 
mRNA levels of c/EBP{alpha} and PPAR{gamma} were downregulated in 3T3-L1 cells with stable silencing of 11β-HSD1.
C/EBP{alpha} and PPAR{gamma} are key mediators and marker genes of 3T3-L1 adipogenesis (17, 35). mRNA levels of C/EBP{alpha} and PPAR{gamma} were significantly decreased in line 1 and line 2 compared with the control cell line (Fig. 4). The decrease was generally more significant in line 2, the line in which 11β-HSD1 was largely abolished. C/EBP{alpha} appeared to exhibit decreases earlier than PPAR{gamma}.


Figure 4
View larger version (11K):
[in this window]
[in a new window]

  		Fig. 4. CCAAT enhancer binding protein (C/EBP){alpha} and peroxisome proliferator-activated receptor (PPAR){gamma} mRNA expression was substantially downregulated in 3T3-L1 cells stably transfected with 11β-HSD1 shRNA. Cell lines stably transfected with control shRNA (control, Con) or 11β-HSD1 shRNA (line 1 and line 2, L1 and L2, respectively; see Figs. 2 and 3) were induced to differentiate with a mixture containing corticosterone (MCI) or dexamethasone (MDI). mRNA levels of C/EBP{alpha} (left) and PPAR{gamma} (right) at day 0, day 2, day 4, and day 10 were quantified with Taqman real-time PCR and normalized to 18s rRNA. *P < 0.05 vs. the control cell line, **P < 0.01 vs. the control cell line; n = 4.

 
Effect of 11β-HSD1 silencing on glucocorticoid metabolism and signaling.
Culture supernatant was sampled at day 2 after the treatment with MCI or MDI. Levels of glucocorticoids and their 11-dehydro-metabolites were measured using a recently developed LC-MS/MS method (40). We found that for cells treated with MCI, the level of 11-dehydrocorticosterone in the culture supernatant was significantly increased in line 2 of 3T3-L1 cells where 11β-HSD1 expression was largely abolished (Fig. 5). The effect was not observed in line 1 where the silencing of 11β-HSD1 was modest at the time of sampling (see day 2 in Fig. 2). 11β-HSD1 silencing did not significantly alter the level of corticosterone. For cells treated with dexamethasone, levels of dexamethasone or 11-dehydrodexamethasone in the culture supernatant were not significantly altered by 11β-HSD1 silencing (Fig. 5).


Figure 5
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 5. Effects of 11β-HSD1 silencing on the levels of glucocorticoids and their metabolites in the culture supernatant. 3T3-L1 cell lines stably transfected with 11β-HSD1 shRNA (line 1 and line 2) or control shRNA (control) or untransfected cells (untransfected) were seeded as indicated in MATERIALS AND METHODS. Two days after MCI or MDI treatments, the culture supernatant was collected for measurements of corticosterone or dexamethasone and their 11-dehydro-metabolites. *P < 0.05 vs. control; n = 4.

 
Many biological effects of glucocorticoids are mediated by GR, which, upon activation by glucocorticoids, are translocated from the cytosol to the nucleus to regulate the expression of target genes. In the control cell line, treatment with corticosterone or dexamethasone caused a significant increase in the amount of GR in the nucleus. The increase was substantially attenuated in line 1 and line 2, where 11β-HSD1 was suppressed (Fig. 6, A and B). We estimated the amount of total cellular GR, taking into consideration the different amounts of cytosolic and nuclear proteins used for the Western blot analysis. The total cellular level of GR in the control cell line, but not in line 1 or line 2, was significantly elevated by ~80% after treatment with corticosterone or dexamethasone. These data suggest that suppression of 11β-HSD1 attenuated the GR signaling.


Figure 6
View larger version (26K):
[in this window]
[in a new window]

  		Fig. 6. 11β-HSD1 silencing attenuated glucocorticoids-induced nuclear translocation of glucocorticoid receptors (GR). Cell lines stably transfected with control shRNA (control) or 11β-HSD1 shRNA (line 1 and line 2, see Figs. 2 and 3) were treated with 1 µM of either corticosterone (COR) or dexamethasone (DEX), or vehicle (untreated, UTD) for 2 h before subcellular fractionation and protein analysis. A: GR levels in cytosolic and nuclear fractions in the 3 cell lines treated with vehicle (UTD), corticosterone (COR), or dexamethasone (DEX). We used 15 µg cytosolic protein and 2 µg nuclear protein for analysis. Representative blots from 3 replicate experiments are shown. B: an increase of GR levels in the nucleus in response to corticosterone or dexamethasone treatments was substantially attenuated by 11β-HSD1 silencing. *P < 0.05, **P < 0.01, vs. untreated (UTD); n = 3.

 
Role of 11β-HSD1 in the initial and the later stages of 3T3-L1 adipogenesis.
Mitotic clonal expansion is important for the initial commitment of 3T3-L1 cells to adipogenesis and is characterized by an increase in the number of cells entering the S phase of the cell cycle at ~20 h after induction (39). Silencing of 11β-HSD1 significantly decreased the percentage of cells entering the S phase after the induction and increased the percentage of cells remaining in the G1 phase (Fig. 7).


Figure 7
View larger version (15K):
[in this window]
[in a new window]

  		Fig. 7. 11β-HSD1 silencing reduced the number of cells entering the S phase. Untransfected 3T3-L1 and cell lines stably transfected with control or 11β-HSD1 shRNA (line 2) were induced to differentiate by MDI for 20 h. Approximately 20,000 cells were used for the cell cycle analysis with flow cytometry. Representative flow cytometry results (A) and a summary of the percentages of cells in the G1, G2, and S phases (B) are shown. *P < 0.05 vs. untransfected or control shRNA cells; n = 4–5.

 
Expression of 11β-HSD1 was dramatically upregulated following the induction of adipogenesis by MCI or MDI and remained highly elevated for several days (see Fig. 1). The role of this later surge of 11β-HSD1 expression was puzzling since glucocorticoids were present in the culture medium only for the first 2 days of induction.

We examined the role of the surge of 11β-HSD1 expression by suppressing 11β-HSD1 expression after the induction of adipogenesis. Transfection of 3T3-L1 cells with shRNA using Lipofectamine 2000 4 days after the induction of differentiation did not significantly reduce the level of 11β-HSD1 expression (data not shown), presumably due to the difficulty in transfecting 3T3-L1 cells that had started to differentiate. To achieve expression suppression after the induction of adipogenesis, we generated lentiviral vector particles to deliver the 11β-HSD1 shRNA molecules in this part of the experiments.

Lentiviral vector transduction of 11β-HSD1 shRNA at day 4 after the induction of differentiation significantly suppressed the expression of 11β-HSD1 by >40% (Fig. 8B). However, suppression of 11β-HSD1 expression after the induction of differentiation failed to significantly attenuate the progression of adipogenesis (Fig. 8). On the other hand, consistent with the results from stably transfected cells, lentiviral vector delivery of 11β-HSD1 shRNA two days prior to the induction nearly abolished adipogenesis (Fig. 8).


Figure 8
View larger version (73K):
[in this window]
[in a new window]

  		Fig. 8. Lentiviral vector delivery of 11β-HSD1 shRNA prior to, but not after, the induction attenuated 3T3-L1 adipogenesis. A: 3T3-L1 cells were seeded into 24-well plates at a density of 1.5 x 104 cells/cm2. Lentiviral vector particles (4 x 105 transducing units per well) that contained 11β-HSD1 shRNA (TRD) or its control (CON) were used to infect the cells 2 days before (day –2 infection) or 4 days after (day 4 infection) MCI or MDI induced differentiation. Cells on day 10 were stained with Oil Red O and photographed. NTC, untransduced cells. B: mRNA levels of 11β-HSD1 2 days after day –2 lentiviral vector infection were quantified with real-time PCR and normalized to 18s rRNA. *P < 0.05 vs. NTC or CON; n = 4. C: mRNA levels of 11β-HSD1 2 days after day 4 lentiviral vector infection were quantified with real-time PCR and normalized to 18s rRNA. *P < 0.05 vs. NTC or CON; n = 4.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
In the present study, we have demonstrated that 1) shRNA-mediated suppression of 11β-HSD1 substantially attenuated 3T3-L1 adipogenesis induced by a mixture containing either corticosterone or dexamethasone, 2) 11β-HSD1 silencing increased the level of 11-dehydrocorticosterone in the culture supernatant and attenuated the activation of GR by glucocorticoids but did not significantly alter the levels of corticosterone or dexamethasone in the culture supernatant, 3) 11β-HSD1 silencing reduced the number of cells entering the S phase, and 4) suppression of the later surge of 11β-HSD1 expression, unlike the silencing of the basal expression, did not affect adipogenesis.

The important functional role of 11β-HSD1 in 3T3-L1 adipogenesis provides a mechanistic explanation for in vivo evidence linking 11β-HSD1 to the development of obesity. Genetic analysis of the polymorphisms in 11β-HSD1 intronic sequences (3) and 5' upstream sequences (26) indicated a possible connection between 11β-HSD1 and the development of obesity. Stewart et al. (38) reported that 11β-HSD1 activity, assessed by urinary metabolites, was reduced in obese subjects. Rask et al. (34) reported that 11β-HSD1 activity in subcutaneous fat biopsy was higher in obese subjects but suggested that liver 11β-HSD1 activity was reduced in obesity. In mouse models, genetic manipulations of 11β-HSD1 have provided strong evidence for a positive relationship between 11β-HSD1 expression and the development of obesity, especially central obesity (12, 22, 24, 25). The relationship could be due in part to the role of 11β-HSD1 in promoting the differentiation of preadipocytes to adipocytes as demonstrated in the present study.

Naturally present variations of 11β-HSD1 genes likely result in partial, but not complete, deficiencies in 11β-HSD1 expression or activity. As such, the quantitative relationship between the level of 11β-HSD1 and the extent of adipogenesis shown in the present study, compared with a gene knock-out model, might be particularly relevant to in vivo situations in human populations.

An interesting new finding in the present study is that 11β-HSD1 silencing attenuated adipogenesis only if the silencing occurred prior to the induction of adipogenesis, suggesting that 11β-HSD1 might contribute mainly to the initiation of adipogenesis. The effectiveness of the early 11β-HSD1 silencing appears to be due to the suppression of mitotic clonal expansion, which occurs within hours after the induction and has been shown to be required for the initiation of adipogenesis (39). The functional significance of the later surge of 11β-HSD1 expression remains to be determined.

The role of glucocorticoid metabolism in the effect of 11β-HSD1 silencing that we observed is not clear. The activation of GR was significantly attenuated by 11β-HSD1 silencing. However, the amount of active glucocorticoids in the culture supernatant was not altered. Moreover, dexamethasone is usually not as good a substrate for 11β-HSDs as natural glucocorticoids (1, 2, 4), yet we observed roughly equal potency of 11β-HSD1 silencing in attenuating adipogenesis induced by either dexamethasone or corticosterone. As we were preparing the current manuscript, Kim et al. (10) reported that adipogenesis induced by dehydrocorticosterone, but not by dexamethasone, was attenuated by 11β-HSD1 suppression or overexpression. There are a number of technical differences between our study and the study by Kim et al., but it is not clear how the technical differences would explain the apparent differences in the results. On the other hand, while we were revising the manuscript, Liu et al. (19) reported that 11β-HSD1 silencing attenuated dexamethasone-induced adipogenesis, which is consistent with our data. It has been shown that 11β-HSD1 can be functionally important in tissues that are exposed to high concentrations of circulating corticosterone in vivo (22, 23).

We speculate that the effect of 11β-HSD1 silencing on adipogenesis that we observed might be mediated by unknown mechanisms that are independent of glucocorticoid metabolism. This speculation might be particularly relevant in the case of dexamethasone. Another possibility is that glucocorticoid metabolism and signaling might be compartmentalized, requiring glucocorticoids be processed by 11β-HSDs before interacting with steroid receptors. Both 11β-HSD1 and 11β-HSD2 are anchored on the membrane of endoplasmic reticulum (28, 30), while both mineral corticoid and glucocorticoid receptors are present in the cytoplasm. The localization pattern prompted Naray-Fejes-Toth and Fejes-Toth (28) to speculate that glucocorticoids might require intracellular compartmental transfer before binding to their receptors. 11β-HSD2 was shown to stimulate the translocation of mineral corticoid receptors to endoplasmic reticulum (29). It is not known if similar interactions occur with 11β-HSD1 and GR.

The RNA interference approach is potentially applicable to manipulating gene expression in vivo in adult animals or human subjects. The present study has established a clear functional role for 11β-HSD1 in 3T3-L1 adipogenesis. It provides a strong rationale for performing in vivo studies to examine the therapeutic potential of 11β-HSD1 RNA interference in obesity and related diseases in human subjects or animal models.


   GRANTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
The present study was supported by National Heart, Lung, and Blood Institute Grant R01 HL-077263 (M. Liang).


   FOOTNOTES
 
Address for reprint requests and other correspondence: M. Liang, Dept. of Physiology, Medical College of Wisconsin, 8701 Watertown Plank Rd., Milwaukee, Wisconsin 53226 (e-mail: mliang{at}mcw.edu).

Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Diederich S, Eigendorff E, Burkhardt P, Quinkler M, Bumke-Vogt C, Rochel M, Seidelmann D, Esperling P, Oelkers W, Bahr V. 11beta-hydroxysteroid dehydrogenase types 1 and 2: an important pharmacokinetic determinant for the activity of synthetic mineralo- and glucocorticoids. J Clin Endocrinol Metab 87: 5695–5701, 2002.[Abstract/Free Full Text]
  2. Diederich S, Hanke B, Oelkers W, Bahr V. Metabolism of dexamethasone in the human kidney: nicotinamide adenine dinucleotide-dependent 11beta-reduction. J Clin Endocrinol Metab 82: 1598–1602, 1997.[Abstract/Free Full Text]
  3. Draper N, Echwald SM, Lavery GG, Walker EA, Fraser R, Davies E, Sorensen TI, Astrup A, Adamski J, Hewison M, Connell JM, Pedersen O, Stewart PM. Association studies between microsatellite markers within the gene encoding human 11beta-hydroxysteroid dehydrogenase type 1 and body mass index, waist to hip ratio, and glucocorticoid metabolism. J Clin Endocrinol Metab 87: 4984–4990, 2002.[Abstract/Free Full Text]
  4. Ferrari P, Smith RE, Funder JW, Krozowski ZS. Substrate and inhibitor specificity of the cloned human 11 beta-hydroxysteroid dehydrogenase type 2 isoform. Am J Physiol Endocrinol Metab 270: E900–E904, 1996.[Abstract/Free Full Text]
  5. Frost SC, Lane MD. Evidence for the involvement of vicinal sulfhydryl groups in insulin-activated hexose transport by 3T3–L1 adipocytes. J Biol Chem 260: 2646–2652, 1985.[Abstract/Free Full Text]
  6. Jamieson PM, Chapman KE, Edwards CR, Seckl JR. 11 beta-hydroxysteroid dehydrogenase is an exclusive 11 beta- reductase in primary cultures of rat hepatocytes: effect of physicochemical and hormonal manipulations. Endocrinology 136: 4754–4761, 1995.[Abstract]
  7. Jessen BA, Stevens GJ. Expression profiling during adipocyte differentiation of 3T3–L1 fibroblasts. Gene 299: 95–100, 2002.[CrossRef][Web of Science][Medline]
  8. Kahn BB, Flier JS. Obesity and insulin resistance. J Clin Invest 106: 473–481, 2000.[Web of Science][Medline]
  9. Kershaw EE, Morton NM, Dhillon H, Ramage L, Seckl JR, Flier JS. Adipocyte-specific glucocorticoid inactivation protects against diet- induced obesity. Diabetes 54: 1023–1031, 2005.[Abstract/Free Full Text]
  10. Kim J, Temple KA, Jones SA, Meredith KN, Basko JL, Brady MJ. Differential modulation of 3T3–L1 adipogenesis mediated by 11beta-hydroxysteroid dehydrogenase-1 levels. J Biol Chem 282: 11038–11046, 2007.[Abstract/Free Full Text]
  11. Knoll KE, Pietrusz JL, Liang M. Tissue-specific transcriptome responses in rats with early streptozotocin-induced diabetes. Physiol Genomics 21: 222–229, 2005.[Abstract/Free Full Text]
  12. Kotelevtsev Y, Holmes MC, Burchell A, Houston PM, Schmoll D, Jamieson P, Best R, Brown R, Edwards CR, Seckl JR, Mullins JJ. 11beta-hydroxysteroid dehydrogenase type 1 knockout mice show attenuated glucocorticoid-inducible responses and resist hyperglycemia on obesity or stress. Proc Natl Acad Sci USA 94: 14924–14929, 1997.[Abstract/Free Full Text]
  13. Latif SA, Conca TJ, Morris DJ. The effects of the licorice derivative, glycyrrhetinic acid, on hepatic 3 alpha- and 3 beta-hydroxysteroid dehydrogenases and 5 alpha- and 5 beta-reductase pathways of metabolism of aldosterone in male rats. Steroids 55: 52–58, 1990.[CrossRef][Medline]
  14. Liang M, Croatt AJ, Nath KA. Mechanisms underlying induction of heme oxygenase-1 by nitric oxide in renal tubular epithelial cells. Am J Physiol Renal Physiol 279: F728–F735, 2000.[Abstract/Free Full Text]
  15. Liang M, Knox FG. Nitric oxide activates PKCalpha and inhibits Na+-K+-ATPase in opossum kidney cells. Am J Physiol Renal Physiol 277: F859–F865, 1999.[Abstract/Free Full Text]
  16. Liang M, Pietrusz JL. Thiol-related genes in diabetic complications: a novel protective role for endogenous thioredoxin 2. Arterioscler Thromb Vasc Biol 27: 77–83, 2007.[Abstract/Free Full Text]
  17. Lin FT, Lane MD. CCAAT/enhancer binding protein alpha is sufficient to initiate the 3T3–L1 adipocyte differentiation program. Proc Natl Acad Sci USA 91: 8757–8761, 1994.[Abstract/Free Full Text]
  18. Liu Y, Sun WL, Sun Y, Hu G, Ding GX. Role of 11-beta-hydroxysteroid dehydrogenase type 1 in differentiation of 3T3–L1 cells and in rats with diet-induced obesity. Acta Pharmacol Sin 27: 588–596, 2006.[CrossRef][Web of Science][Medline]
  19. Liu Y, Sun Y, Zhu T, Xie Y, Yu J, Sun WL, Ding GX, Hu G. 11 beta-hydroxysteroid dehydrogenase type 1 promotes differentiation of 3T3–L1 preadipocyte. Acta Pharmacol Sin 28: 1198–1204, 2007.[CrossRef][Web of Science][Medline]
  20. Low SC, Chapman KE, Edwards CR, Seckl JR. ‘Liver-type’ 11 beta-hydroxysteroid dehydrogenase cDNA encodes reductase but not dehydrogenase activity in intact mammalian COS-7 cells. J Mol Endocrinol 13: 167–174, 1994.[Abstract/Free Full Text]
  21. Maser E, Volker B, Friebertshauser J. 11 Beta-hydroxysteroid dehydrogenase type 1 from human liver: dimerization and enzyme cooperativity support its postulated role as glucocorticoid reductase. Biochemistry 41: 2459–2465, 2002.[CrossRef][Web of Science][Medline]
  22. Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, Seckl JR, Flier JS. A transgenic model of visceral obesity and the metabolic syndrome. Science 294: 2166–2170, 2001.[Abstract/Free Full Text]
  23. Masuzaki H, Yamamoto H, Kenyon CJ, Elmquist JK, Morton NM, Paterson JM, Shinyama H, Sharp MG, Fleming S, Mullins JJ, Seckl JR, Flier JS. Transgenic amplification of glucocorticoid action in adipose tissue causes high blood pressure in mice. J Clin Invest 112: 83–90, 2003.[CrossRef][Web of Science][Medline]
  24. Morton NM, Holmes MC, Fievet C, Staels B, Tailleux A, Mullins JJ, Seckl JR. Improved lipid and lipoprotein profile, hepatic insulin sensitivity, and glucose tolerance in 11beta-hydroxysteroid dehydrogenase type 1 null mice. J Biol Chem 276: 41293–41300, 2001.[Abstract/Free Full Text]
  25. Morton NM, Paterson JM, Masuzaki H, Holmes MC, Staels B, Fievet C, Walker BR, Flier JS, Mullins JJ, Seckl JR. Novel adipose tissue-mediated resistance to diet-induced visceral obesity in 11 beta-hydroxysteroid dehydrogenase type 1-deficient mice. Diabetes 53: 931–938, 2004.[Abstract/Free Full Text]
  26. Nair S, Lee YH, Lindsay RS, Walker BR, Tataranni PA, Bogardus C, Baier LJ, Permana PA. 11beta-Hydroxysteroid dehydrogenase Type 1: genetic polymorphisms are associated with Type 2 diabetes in Pima Indians independently of obesity and expression in adipocyte and muscle. Diabetologia 47: 1088–1095, 2004.[Web of Science][Medline]
  27. Napolitano A, Voice MW, Edwards CR, Seckl JR, Chapman KE. 11Beta-hydroxysteroid dehydrogenase 1 in adipocytes: expression is differentiation-dependent and hormonally regulated. J Steroid Biochem Mol Biol 64: 251–260, 1998.[CrossRef][Web of Science][Medline]
  28. Naray-Fejes-Toth A, Fejes-Toth G. Subcellular localization of the type 2 11beta-hydroxysteroid dehydrogenase A green fluorescent protein study. J Biol Chem 271: 15436–15442, 1996.[Abstract/Free Full Text]
  29. Odermatt A, Arnold P, Frey FJ. The intracellular localization of the mineralocorticoid receptor is regulated by 11beta-hydroxysteroid dehydrogenase type 2. J Biol Chem 276: 28484–28492, 2001.[Abstract/Free Full Text]
  30. Ozols J. Lumenal orientation and post-translational modifications of the liver microsomal 11 beta-hydroxysteroid dehydrogenase. J Biol Chem 270: 10360, 1995.[Web of Science][Medline]
  31. Park F, Ohashi K, Chiu W, Naldini L, Kay MA. Efficient lentiviral transduction of liver requires cell cycling in vivo. Nat Genet 24: 49–52, 2000.[CrossRef][Web of Science][Medline]
  32. Park F, Kay MA. Modified HIV-1 based lentiviral vectors have an effect on viral transduction efficiency and gene expression in vitro and in vivo. Mol Ther 4: 164–173, 2001.[CrossRef][Web of Science][Medline]
  33. Paterson JM, Morton NM, Fievet C, Kenyon CJ, Holmes MC, Staels B, Seckl JR, Mullins JJ. Metabolic syndrome without obesity: Hepatic overexpression of 11beta-hydroxysteroid dehydrogenase type 1 in transgenic mice. Proc Natl Acad Sci USA 101: 7088–7093, 2004.[Abstract/Free Full Text]
  34. Rask E, Olsson T, Soderberg S, Andrew R, Livingstone DE, Johnson O, Walker BR. Tissue-specific dysregulation of cortisol metabolism in human obesity. J Clin Endocrinol Metab 86: 1418–1421, 2001.[Abstract/Free Full Text]
  35. Rosen ED, Hsu CH, Wang X, Sakai S, Freeman MW, Gonzalez FJ, Spiegelman BM. C/EBPalpha induces adipogenesis through PPARgamma: a unified pathway. Genes Dev 16: 22–26, 2002.[Abstract/Free Full Text]
  36. Sanchez ER, Hu JL, Zhong S, Shen P, Greene MJ, Housley PR. Potentiation of glucocorticoid receptor-mediated gene expression by heat and chemical shock. Mol Endocrinol 8: 408–421, 1994.[Abstract/Free Full Text]
  37. Spiegelman BM, Flier JS. Obesity and the regulation of energy balance. Cell 104: 531–543, 2001.[CrossRef][Web of Science][Medline]
  38. Stewart PM, Boulton A, Kumar S, Clark PM, Shackleton CH. Cortisol metabolism in human obesity: impaired cortisone–cortisol conversion in subjects with central adiposity. J Clin Endocrinol Metab 84: 1022–1027, 1999.[Abstract/Free Full Text]
  39. Tang QQ, Otto TC, Lane MD. Mitotic clonal expansion: a synchronous process required for adipogenesis. Proc Natl Acad Sci USA 100: 44–49, 2003.[Abstract/Free Full Text]
  40. Usa K, Singh RJ, Netzel BC, Liu Y, Raff H, Liang M. Renal interstitial corticosterone and 11-dehydrocorticosterone in conscious rats. Am J Physiol Renal Physiol 293: F186–F192, 2007.[Abstract/Free Full Text]
  41. Wang M. The role of glucocorticoid action in the pathophysiology of the metabolic syndrome. Nutr Metab (Lond) 2: 3, 2005.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 HypertensionHome page
Z. Tian, Y. Liu, K. Usa, D. Mladinov, Y. Fang, X. Ding, A. S. Greene, A. W. Cowley Jr, and M. Liang
Novel Role of Fumarate Metabolism in Dahl-Salt Sensitive Hypertension
Hypertension, August 1, 2009; 54(2): 255 - 260.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
Y. Su, K. Shankar, and R. C. M. Simmen
Early Soy Exposure via Maternal Diet Regulates Rat Mammary Epithelial Differentiation by Paracrine Signaling from Stromal Adipocytes
J. Nutr., May 1, 2009; 139(5): 945 - 951.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
Y. Liu, D. Mladinov, J. L. Pietrusz, K. Usa, and M. Liang
Glucocorticoid response elements and 11{beta}-hydroxysteroid dehydrogenases in the regulation of endothelial nitric oxide synthase expression
Cardiovasc Res, January 1, 2009; 81(1): 140 - 147.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
Y. Liu, R. J. Singh, K. Usa, B. C. Netzel, and M. Liang
Renal medullary 11{beta}-hydroxysteroid dehydrogenase type 1 in Dahl salt-sensitive hypertension
Physiol Genomics, December 12, 2008; 36(1): 52 - 58.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
A. Balachandran, H. Guan, M. Sellan, S. van Uum, and K. Yang
Insulin and Dexamethasone Dynamically Regulate Adipocyte 11{beta}-Hydroxysteroid Dehydrogenase Type 1
Endocrinology, August 1, 2008; 149(8): 4069 - 4079.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
Z. Tian, A. S. Greene, K. Usa, I. R. Matus, J. Bauwens, J. L. Pietrusz, A. W. Cowley Jr, and M. Liang
Renal Regional Proteomes in Young Dahl Salt-Sensitive Rats
Hypertension, April 1, 2008; 51(4): 899 - 904.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
32/3/343    most recent
00067.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, Y.
Right arrow Articles by Liang, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, Y.
Right arrow Articles by Liang, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.