Physiol. Genomics Genetics/Genomics of Vascular Disease Workshop
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 30: 156-171, 2007. First published March 20, 2007; doi:10.1152/physiolgenomics.00249.2006
1094-8341/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow All Versions of this Article:
30/2/156    most recent
00249.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by López-Sánchez, N.
Right arrow Articles by Frade, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by López-Sánchez, N.
Right arrow Articles by Frade, J. M.
Received 12 November 2006; accepted in final form 20 March 2007.
Physiological Genomics 30:156-171 (2007)
1094-8341/07 $8.00 © 2007 American Physiological Society

Single mage gene in the chicken genome encodes CMage, a protein with functional similarities to mammalian type II Mage proteins

Noelia López-Sánchez1, Zaira González-Fernández1, Michio Niinobe2, Kazuaki Yoshikawa2 and José María Frade1

1 Department of Developmental Neurobiology, Instituto Cajal (CSIC), Madrid, Spain
2 Laboratory of Regulation of Neuronal Development, Institute for Protein Research, Osaka University, Osaka, Japan


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In mammals, the type II melanoma antigen (Mage) protein family is constituted by at least 10 closely related members that are expressed in different tissues, including the nervous system. These proteins are believed to regulate cell cycle withdrawal, neuronal differentiation, and apoptosis. However, the analysis of their specific function has been complicated by functional redundancy. In accordance with previous studies in teleosts and Drosophila, we present evidence that only one mage gene exists in genomes from protists, fungi, plants, nematodes, insects, and nonmammalian vertebrates. We have identified the chicken mage gene and cloned the cDNA encoding the chick Mage protein (CMage). CMage shares close homology with the type II Mage protein family, and, as previously shown for the type II Mage proteins Necdin and Mage-G1, it can interact with the transcription factor E2F-1. CMage is expressed in specific regions of the developing nervous system including the retinal ganglion cell layer, the ventral horn of the spinal cord, and the dorsal root ganglia, coinciding with the expression of the neurotrophin receptor p75 (p75NTR) in these regions. We show that the intracellular domain of p75NTR can interact with both CMage and Necdin, thus preventing the binding of the latter proteins to the transcription factor E2F-1, and facilitating the proapoptotic activity of E2F-1 in N1E-115 differentiating neurons. The presence of a single mage gene in the chicken genome, together with the close functional resemblance between CMage and Necdin, makes this species ideal to further analyze signal transduction through type II Mage proteins.

Necdin; p75NTR; E2F-1


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
THE MELANOMA ANTIGEN (Mage) proteins were initially described as precursors of human antigens exposed by the members of the major histocompatibility complex in melanoma cells. This protein family has since been characterized by the presence of a 165- to 171-amino acid Mage homology domain (MHD) in the center of the molecule (5). The first member of this protein superfamily to be identified was Mage-A1 (59). However, the gene encoding Mage-A1 was later found to belong to a cluster of 15 Mage-A genes located in the q28 region of the human X chromosome (10, 15). Subsequent studies identified further groups of related mage genes in two clusters on the human X chromosome. These genes encode 17 Mage-B proteins (10, 39, 41), and seven Mage-C proteins (10, 39, 40). Similarly, two groups of mage genes of murine origin have also been identified to date (13, 14, 48). Based on sequence homology, these two groups were considered as the murine counterparts of the human mage-A and mage-B genes. Accordingly, the mage-C genes do not seem to be present in the mouse genome, and their absence suggests that the members of this subfamily have arisen during the course of mammalian evolution. A common feature of all the mammalian genes encoding the Mage-A, -B, and -C proteins is that their open reading frames are contained within a single exon and that their normal expression in adults is restricted to male germinal cells and placenta. These features together with their genomic clustering have led to their classification as type I Mage proteins (5).

At least 10 new human genes encoding proteins that contain a Mage domain and that reside outside of the mage-A, -B, and -C clusters have been described so far. As a result, the Mage protein superfamily has recently been expanded (10) to include this type II family of Mage proteins, comprising: Mage-D1/NRAGE/Dlxin-1, Mage-D2, Mage-D3/Trophinin/Magphinin, Mage-E1/Mage-D4, Mage-E2, Mage-F1 Mage-G1/Necdin-like 2, Mage-H1, Mage-L2, and Necdin (5). These proteins contain a phylogenetically distinct MHD, although like type I Mage proteins, most of them are encoded by a single exon (5). This has led to the suggestion that the whole Mage superfamily has evolved in mammals by retrotransposition followed by gene duplication from an ancestral gene (10). Accordingly, Necdin is not present in marsupials, and it was probably acquired by retrotransposition during the recent assembly of the Prader-Willi/Angelman syndrome region on the chromosome 15q in humans, an event that occurred 105–180 million yr ago (51). The ancestral mage gene is probably an ortholog of the mage-D genes, which are the only mage mammalian genes that contain introns (10).

Type II Mage proteins are widely expressed in many embryonic and adult tissues, particularly in the nervous system (2, 6, 29, 46, 53). These proteins also interact with the p75 neurotrophin receptor (p75NTR) (5), which displays multiple functions in this tissue. To date these type II Mage proteins have been implicated in the regulation of cell cycle progression, cell differentiation, and apoptosis, acting as adaptors in multiple signal transduction pathways (54). The best characterized example of a mammalian type II Mage protein is Necdin, which was initially isolated from mouse embryonal carcinoma cells differentiated into neurons (42). The mouse necdin gene is predominantly expressed in postmitotic neurons (58), and when expressed ectopically, it suppresses proliferation (25) and triggers neuronal differentiation (31) in different cell lines. These latter effects seem to be mediated by the capacity of Necdin to interact with and block the transactivation domain of E2F-1 (56), a transcription factor necessary for G1/S phase progression that is capable of inducing apoptosis in postmitotic cells (22, 23). The absence of the necdin gene has been associated with the Prader-Willi syndrome, a neurogenetic disorder caused by the deletion of the 15q11-q13 segment of the paternal chromosome, which triggers mental retardation and other physiological alterations (45). Like Necdin, the type II Mage protein Mage-D1 is expressed in neurogenic areas of the developing rat and mouse nervous systems (29, 53), as well as in the mature rat brain (6). Mage-D1 can also suppress cell cycle progression, and it is able to promote p75NTR-dependent apoptosis in sympathoadrenal cells (53). In addition, p75NTR has been shown to sequester Necdin or Mage-G1 through its intracellular domain (p75ICD), thereby favoring the proapoptotic activity of E2F-1 in postmitotic neurons (33, 56).

While it is clear that type II Mage proteins are key elements in neurogenesis and proapoptotic signaling triggered by p75NTR, our understanding of their function in the developing nervous system remains poor. The analysis of these proteins in mammals is complicated because of the large number of related genes with possible redundant functions. Indeed, only minor defects in the development of the nervous system have been observed in null-mutant mice for the necdin gene. Depending on the genetic background, these mice may die in the neonatal period due to apparent respiratory insufficiency that can be explained by abnormal neuronal activity within the putative respiratory rhythm-generating center. Alternatively, they may be viable and fertile simply displaying some functional alterations in the hypothalamus, and changes of behavior reminiscent of Prader-Willi syndrome (21, 45, 52). Therefore, a model system with fewer Mage proteins would facilitate the analysis of Mage function in development and adulthood.

In this study, we show that in the genome of nonmammalian species only one mage gene can be detected. Thus, we cloned the chicken Mage protein, CMage, whose pattern of expression is similar to that of p75NTR in the developing retina, ventral spinal cord, and dorsal root ganglia. Moreover, CMage shows functional similarities to the type II Mage protein Necdin, indicating that the chick may be a useful model system to further characterize the signal transduction pathways used by Mage proteins in the absence of functional redundancy.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Chick embryos.
Fertilized eggs from White Leghorn hens were obtained from a local supplier (Granja Santa Isabel, Cordoba, Spain), and they were incubated at 38.5°C in an atmosphere of 70% humidity. The embryos were staged according to Hamburger and Hamilton (24). Experimental procedures were approved by the CSIC animal ethics committee.

Primary antibodies.
The rabbit anti-p75NTR polyclonal antiserum against the cytoplasmic domain of human p75NTR (Promega, Madison, WI) was used at a dilution of 1:500 for immunocytochemistry and 1:5,000 for Western blot analysis. The rabbit polyclonal antiserum (9992) against the intracellular domain of p75NTR was kindly provided by Moses Chao (New York University, New York, NY), and it was used at a dilution 1:1,000 for immunohistochemistry. The mouse polyclonal antibody obtained by immunizing mice with a p75NTR receptor-Fc chimeric protein (11), kindly provided by Alfredo Rodríguez-Tébar (CABIMER, Seville, Spain), was used at a dilution 1:500 for immunohistochemistry. The NC243 antiserum, raised against the 243 COOH-terminal amino acids of mouse Necdin (46), was used at a dilution of 1:2,000 for immunocytochemistry and immunohistochemistry, and a dilution of 1:20,000 in Western blots. The anti-FLAG monoclonal antibody (MAb; Sigma, St. Louis, MO) was used at 20 µg/ml for immunocytochemistry, at 30 µg/ml for immunoprecipitations and at 0.12 µg/ml in Western blots. The anti E2F-1 MAb KH95 (Santa Cruz Biotechnology, Santa Cruz, CA) was used at 1:15,000 in Western blots. 5-Bromo-2'-deoxy-uridine (BrdU) was visualized with the G3G4 MAb (Developmental Studies Hybridoma Bank, Iowa City, IA) used at a dilution of 1:4,000. The mouse TuJ-1 MAb against neuron-specific ßIII tubulin (Chemicon) was used at 1:2,000 dilution. The anti-Islet-1 MAb 40.2D6 (Developmental Studies Hybridoma Bank) was diluted 1:200 for immunohistochemistry.

cDNA probes for Southern blot.
A 319-bp cDNA fragment (corresponding to bp 347–665 of clone ChEST965i23) was amplified by PCR from the pcDNA6-CMage-FLAG plasmid using specific oligonucleotides. This cDNA fragment, included in the region codifying for the MHD of CMage, was then labeled with digoxigenin-11-dUTP by random priming using DIG-High Prime (Roche, Basel, Switzerland) according to the manufacturer's instructions.

RNA probes for in situ hybridization.
Complementary RNA probes for cmage, corresponding to bp 17–730 of clone ChEST965i23 [National Center for Biotechnology Information (NCBI) accession number BX934453] were generated by RT-PCR using a Pyrococcus furiosus (Pfu) DNA polymerase (Biotools, Madrid, Spain) and from a cDNA template derived from E4 eye/tectum. This PCR fragment was cloned into the pGEM-T Easy vector (Promega), and digoxigenin-labeled antisense riboprobes were obtained from linearized plasmid templates using Sp6 RNA polymerase (Roche).

Plasmids.
The pRc/CMV-E2F-1 and the pRc/CMV-Necdin expression vector have been described previously (33, 56). The vector expressing p75ICD (pRc/CMV-p75ICD-HA) was a generous gift of Yves-A. Barde (University of Basel, Basel, Switzerland). Green fluorescent protein (GFP) was expressed in the DF-1 cells by using the pEGFP-N1 plasmid (BD Biosciences, San Jose, CA). The coding sequence of CMage-FLAG corresponded to bp 17–754 of clone ChEST965i23 and was amplified with Pfu DNA polymerase (Biotools) from cDNAs derived from E4 eye/tectum using the following oligonucleotides: upstream primer (CACAAGCTTATGTCTCAGAGGAAGCGCAGC); downstream primer (CTCGAATTCCTA CTTATCGTCGTCATCCTTGTAATCCGTGTGGCTTTGGCCTCG). The PCR amplification product of 786 bp contained a HindIII cleavage site at the 5'-end, and a FLAG tag sequence followed by a stop codon and an EcoRI restriction site at the 3'-end. This fragment was cut with HindIII and EcoRI, inserted in the HindIII/EcoRI site of pcDNA 6/V5-His-A vector (Invitrogen, Carlsbad, CA), and the integrity of the resulting expression vector (pcDNA6-CMage-FLAG) was confirmed by sequencing. The coding region of the cmage gene was cloned into the pGEM-T Easy vector (Promega) (see below) and referred to as pGEM-cmage. The pRFPRNAiC and pRFPRNAi Luciferase vectors (12) were provided by Stuart Wilson (University of Sheffield, Sheffield, UK). The pRFPRNAi CMage vector capable of suppressing cmage expression was constructed using the pRFPRNAiC plasmid following the procedures described previously (12). The target sequence used to interfere with the cmage mRNA corresponded to bp 168–189 of clone ChEST965i23. Similar results were obtained when the sequences corresponding to bp 174–195, 58–579, or 666–687 of clone ChEST965i23 were used (data not shown).

Southern blot analysis.
Genomic DNA from E5 chick embryos (10 µg) was digested with CaiI (Fermentas) and separated on agarose gels. As positive controls, EcoRI/HindIII-digested pcDNA-CMage-FLAG plasmid (0.77 ng) and CaiI-digested pGEM-cmage (0.23 ng) were used, these digestions yielding 0.1 ng of DNA corresponding to the cmage cDNA or the cmage gene sequences, respectively. The DNA was transferred onto Hybond-N+ nylon filters (GE Healthcare) in 10x SSC (1x SSC contains 15 mM sodium citrate, 150 M NaCl; pH 7.0), and UV-cross linked (UV Stratalinker 2400, Stratagene). The filters were hybridized overnight at 47°C with the digoxigenin-labeled probes (see above) using DIG High Prime DNA Labeling and Detection Starter Kit II (Roche) following the protocol recommended by the manufacturer. The filters were then washed at low stringency, twice in 2x SSC/0.1% SDS at room temperature for 5 min and once in 2x SSC/0.1% SDS at 57°C for 1 h. The probes were detected following the protocol described by the manufacturer and the filters were exposed to Hyperfilm ECL (GE Healthcare).

Cell culture.
DF-1 chicken fibroblast cells and N1E-115 neuroblastoma cells were maintained in Dulbecco's modified Eagle's medium (DMEM)/10% fetal calf serum (FCS) (Invitrogen) at 37°C in a water-saturated atmosphere containing 5% CO2. N1E-115 neuroblastoma cells and DF-1 cells were both seeded at 30,000 cells/cm2 and maintained for 24 h in DMEM/10% FCS. The cells were transfected with Lipofectamine 2000 (Invitrogen), and the transfected cells were induced to differentiate by adding 2% DMSO (Sigma) to the culture medium 24 h after transfection (30). The cells were then fixed or prepared for Western blot analysis 48 h after transfection. In experiments to quantify apoptosis, N1E-115 neuroblastoma cells were grown on 12-mm coverslips (Menzel-Gläser, Braunschweig, Germany) coated with 500 µg/ml poly(D-L)ornithine.

In vivo BrdU treatment.
Eggs were opened at their blunt end, and 40 µl of a solution containing 10 mg/ml BrdU (Roche) prepared in phosphate-buffered saline (PBS) was applied to the chorioallantoic membrane. Subsequently, the eggs were sealed and returned to the incubator. Embryos were killed 1 h after BrdU treatment.

In situ hybridization.
In situ hybridization was performed as described previously (44), performing all steps under RNase-free conditions. Chick embryos of the ages specified were fixed for 4–8h at 4°C in 4% paraformaldehyde (PFA), incubated overnight at 4°C in 100 mM sodium phosphate buffer containing 30% sucrose, and then embedded in the OCT compound Tissue-Tek (Sakura, Torrance, CA). Cryosections (12 µm) were collected on 3-aminopropyl-trimethoxysilane-coated slides (Sigma), postfixed for 15 min in 4% PFA, and then carbethoxylated for 30 min in PBS containing 0.1% active diethyl-pyrocarbonate (Sigma). Sections were equilibrated for 5 min in 5x SSC and then prehybridized for 2 h at 60°C in 5x SSC containing 50% formamide (Fluka, Seelze, Germany) and 50 µg/ml tRNA (Roche). Hybridization was performed at 60°C overnight in the same solution containing 400 ng/ml of digoxigenin-labeled probes. Prior to hybridization, the riboprobes were denatured for 5 min at 80°C and then cooled on ice. Following hybridization, the sections were washed three times for 1 h in 2x SSC at room temperature (RT), 2x SSC at 65°C, and 0.1x SSC at 65°C. Slides were then incubated for 1 h in 0.5% blocking reagent (Roche) prepared in 150 mM NaCl, 100 mM Tris·HCl pH 7.5 (NT), and the localization of the bound riboprobes was detected by incubating overnight at 4°C with an AP-coupled antidigoxigenin antibody (Roche) diluted 1:5,000 in 0.5% blocking reagent prepared in NT. The slides were then washed twice in NT and equilibrated in 50 mM MgCl2, 100 mM NaCl, 100 mM Tris·HCl pH 9.5 (MNT). The antibody was visualized using an alkaline phosphatase substrate (338 µg/ml nitro blue tetrazolium, 175 µg/ml 5-bromo-4-chloro-3-indolyl phosphate; Roche) in MNT buffer. Finally, the color reaction was stopped by washing the slides in a 10 mM Tris·HCl pH 8.0 solution containing 1 mM EDTA.

Immunohistochemistry.
Immunohistochemistry was performed as described previously (38). In brief, embryos were fixed for 4 h at 4°C in 4% PFA incubated overnight at 4°C in 100 mM sodium phosphate buffer containing 30% sucrose and embedded in the OCT compound Tissue-Tek (Sakura). Cryosections 12 µm thick were permeabilized for 30 min at RT in the presence of 0.1% Triton X-100 (Sigma) in PBS (PBS-T). The sections were blocked for 1 h with 10% normal goat serum (NGS) in PBS-T and subsequently incubated overnight at 4°C with the primary antibody in 1% NGS/PBS-T. After five washes with PBS-T, the sections were incubated for 1 h at RT with a Cy2-conjugated goat anti-rabbit IgG (H+L) antibody (Jackson Immunoresearch, West Grove, PA) diluted 1,000-fold or an Alexa Fluor 594 goat anti-mouse IgG (H+L) antibody (Molecular Probes) diluted 1:1,000. Sections were finally washed five times in PBS-T and once in PBS alone, and the labeled sections were mounted in 50% glycerol in PBS. The sections that were immunolabeled for BrdU were first subjected to DNA denaturation by incubating for 30 min with 2 N HCl/0.33 x PBS at RT, which was neutralized by 3 x 15-min washes with 0.1 M Na borate (pH 8.9) and two 5-min washes with PBS-T. Images were acquired with a Leica (Nussloch, Germany) TCF-4D confocal microscope and used directly to create the figures.

Coimmunoprecipitation.
To detect the E2F-1 complexes, combinations of pRc/CMV-Necdin, pcDNA6-CMage-FLAG, pRc/CMV-E2F-1, and pRc/CMV-p75ICD-HA plasmids were transfected in N1E-115 neuroblastoma cells using Lipofectamine 2000 (Invitrogen). These cells were grown in P60 petri dishes at an initial density of 6.0 x 104 cells/cm2, and they were induced to differentiate with 2% DMSO as described above. The cells were then lysed in a Potter microhomogenizer with 250 µl of lysis buffer containing: 20 mM Tris (Roche) pH 7.5, 100 mM NaCl (Merck, Darmstadt, Germany), 5 mM MgCl2 (Merck), 0.5% Triton X-100 (Sigma), 0.5 mM EDTA (Merck), 0.5 µg/ml DNase I (Roche), and 1x protease inhibitor mix (Roche). After incubating the lysates for 10 min at 4°C, they were centrifuged at 13,000 g for 10 min at 4°C, and 50 µl of the supernatant from each extract was mixed with 50 µl of 2x Laemmli's buffer and boiled for 5 min (Input samples). The rest of the supernatant was incubated with 30 µg/ml anti-FLAG-specific MAb for 2h at 4°C followed by incubation with 20 µl (bed-volume) of protein A/G Sepharose (Santa Cruz Biotechnology) for 1 h at 4°C. Immunoprecipitates were washed three times with 500 µl of lysis buffer, mixed with 20 µl of 2x Laemmli's buffer lacking 2-mercaptoethanol, and boiled for 5 min.

Western blot.
Total cell extracts from 1.5 x 105 cells, or 10-µl immunoprecipitates were separated by SDS PAGE on 11% acrylamide gels and transferred to Immun-Blot polyvinylidene difluoride membranes (Bio-Rad, Hercules, CA). The membranes were incubated for 1 h with 2% ECL Advance blocking agent (ECL Advanced Western Blotting Detection Kit) (GE Healthcare Europe, Munich, Germany) in PBS containing 0.1% Tween 20 (PBT) (Sigma), and incubated for 2 h at room temperature with the appropriate antisera in blocking buffer. After being washed the membranes five times in PBT, they were incubated for 1 h at room temperature with a peroxidase-conjugated Affinipure goat anti-rabbit IgG antibody diluted 1:1,660,000 (Jackson Immunoresearch) or a goat anti-mouse IgG horseradish peroxidase-conjugated antibody at 1:500,000 (Bio-Rad) in blocking buffer. Finally, they were washed again as above, and the protein bands were visualized using ECL Advanced Western Blotting Detection Kit (GE Healthcare Europe).

5'- and 3'-rapid amplification of cDNA ends.
5'- and 3'-rapid amplification of cDNA ends (RACE) was performed with the BD SMART RACE cDNA Amplification Kit (BD Biosciences) using cDNA obtained from whole E3 chick embryos following the manufacturer's instructions. This cDNA was amplified with the Advantage 2 PCR Enzyme System (BD Biosciences) using cmage-specific oligos corresponding to bp 480–507 of clone ChEST965i23. The sequences of these oligos were TATGGGAGTTCCTGCGCCGGCTCCGGGT for 3'-RACE and ACCCGGAGCCGGCGCAGGAACTCCCATA for 5'-RACE.

Genomic DNA amplification.
Amplification of the coding sequence of the cmage gene was performed with Pfu DNA polymerase (Biotools) (n = 2) or with CertAMP (Biotools) (n = 2) from E3 whole chick embryo genomic DNA using the oligonucleotides corresponding to the 5'- and 3'-ends of the coding region of cmage described above. The 5'-untranslated region (UTR) of cmage gene was amplified with Pfu DNA polymerase (Biotools) (n = 2) or with CertAMP (Biotools) (n = 2) from this same genomic DNA using the primers corresponding to bp 1–17 and bp 68–87 of the ChEST868j13 clone (NCBI accession number BU381672). The PCR amplified products were cloned into the pGEM-T Easy vector and sequenced.

Cell death analyses.
N1E115 cells (6 x 104) were transfected with the pEGFP-N1 expression vector (BD Biosciences), together with different combinations of pRc/CMV-p75ICD-HA, pRc/CMV-E2F-1, and pRc/CMV-Necdin, or pcDNA6-CMage-FLAG (1 µg each) using Lipofectamine 2000 (Invitrogen). The plasmid quantities were adjusted to 5 µg with pBlueScript (Stratagene, La Jolla, CA). Cells were induced to differentiate as described previously (33). To quantify apoptosis, the DNA of PFA-fixed N1E115 cells was labeled with 1 µg/ml bisbenzimide (Sigma), and the number of pyknotic nuclei was established. Cells were counted on a Nikon E80i microscope using an oil immersion x60 objective with phase contrast and epifluorescence illumination, and an average of 500 cells were analyzed per coverslip. The means ± SE from at least three independent experiments are shown, and the statistical differences were analyzed by Student's t-test.

Database searches.
Tblastn searches were performed in the nonredundant DNA database available at the NCBI database using the Mage homology domain of mouse Necdin (amino acids 116–280; NCBI accession number: BAA11183) or CMage (amino acids 57–221, Fig. 1C). We ran tblastn searches using the BLOSUM-62 substitution matrix and the default values for the gap costs (existence: 11; extension: 1). Blastn searches in the Biotechnology and Biological Sciences Research Council (BBSRC) ChickEST database (http://www.chick.umist.ac.uk) were performed using the ChEST965i23 sequence as the query. Blastn searches were run using the BLOSUM-62 substitution matrix and the default values for gap and nucleotide mismatching. Blastn searches in the chicken genome database from NCBI were performed using the sequence between bp 185–679 of ChEST965i23, encoding the cmage MHD, following default settings.


Figure 1
View larger version (56K):
[in this window]
[in a new window]

 
Fig. 1. Phylogenetic relationship between chicken melanoma antigen (CMage) and the type II mammalian Mage proteins. A: coding sequence of cmage and deduced amino acid sequence of CMage. The sequence corresponding to its Mage homolog domain (MHD), as proposed by Ref. 5, is underlined. Sequence between arrows correspond to that shown in D and Fig. 3A. Brackets indicate boundaries of homology between CMage and the hypothetical Mage protein (NCBI accession number XM_424083) predicted by automated computational analysis from a genomic region contained in the sequence with NCBI accession number NW_098113 (see text). B: phylogenetic tree obtained by sequence alignment of CMage with representative human Mage proteins. Note that CMage shows higher homology to the type II Mage proteins Mage-D1, Mage-E1, Mage-F1, Mage-G1, Mage-L2, or Necdin than to the type I Mage proteins Mage-A1, Mage-B1, or Mage-C1. C: scheme showing structural similarity of CMage to the human type II Mage proteins Necdin, Mage-D1, Mage-E1, Mage-F1, Mage-G1, and Mage-L2 (black boxes represent the MHD). D: sequence alignment performed by the CLUSTAL method to identify contigous regions of homology among the MHDs of CMage, and human Necdin, Mage-D1, Mage-E1, Mage-F1, Mage-G1, and Mage-L2. Regions I, III, and V are underlined, corresponding to the MHD previously described (5). Asterisks show Mage conserved residues, as proposed by Ref. 5, in CMage. The Mage conserved residues proposed by Ref. 5 that are not present in CMage are shown as dots.

 
Multiple sequence alignments.
The Mage domains were aligned using the CLUSTAL method (MegaAlign package software). The high degree of homology between the proteins was revealed by the tblastn search (E < 8e–45). Pair alignments were performed by the Lipman-Pearson method (MegaAlign package software).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cloning of CMage and its gene.
To identify chicken homologs of Mage proteins in mammals, we performed tblastn searches of Gallus gallus sequences in the nonredundant DNA database available at NCBI using the Mage homology domain of mouse Necdin (amino acids 116–280; NCBI accession number: BAA11183). This search identified a single expressed sequence tag (EST) cluster containing three sequences (ChEST965i23, NCBI accession number BX934453; ChEST970m21, NCBI accession number BX930943; and ChEST297b18, NCBI accession number CR354280) These sequences encode a putative Mage protein containing 246 amino acids (Fig. 1A) with an expected molecular mass of 28.5 kDa. We refer to this protein as CMage (for chicken Mage; NCBI accession numbers ABI98817 and ABI98818). Alignments between CMage and representative members of the different human Mage subfamilies indicated that CMage is highly related to the type II family (Fig. 1, B–D).

Part of the genomic sequence corresponding to the cmage gene, flanked by two gaps of uncertain length, is contained in a genomic contig with NCBI accession number NW_098113. From their sequence, five small exons can be deduced corresponding to bp 219–580 of the ChEST965i23 sequence (equivalent to bp 2738–2817, 2917–3011, 3127–3206, 3293–3335, and 3437–3500 from the genomic contig mentioned above). We have sequenced the whole region of the cmage gene encoding CMage, identifying four additional exons in the 5'-end and two in the 3'-end (NCBI accession number DQ983362). Therefore, from the abovementioned sequence 11 exons encompass the whole cmage gene, corresponding to bp 1–14, 167–210, 309–404, 597–660, 897–976, 1079–1173, 1278–1357, 1444–1486, 1588–1650, 1941–2055, and 2157–2219 (Fig. 2A), being the coding sequence of cmage comprising exons 2 through 11 (Fig. 2, A and B). Ten small introns (from 86 to 290 bp in size) distributed throughout the sequence were detected in the cmage gene, in accordance with the reduced size of the chicken genome known to be one-third that of a typical mammal (8). All the introns obey the GT-AG rule of splice junctions (Fig. 2B).


Figure 2
View larger version (32K):
[in this window]
[in a new window]

 
Fig. 2. Structure of the nonmammalian mage genes and proteins. A: genomic organization of the mage genes from the species indicated. Boxes represent sequences present in the mature mRNAs and lines introns. Coding regions are labeled in gray. Arrows indicate the partial sequence of cmage described previously (NCBI accession number NW_098113). Observe how the cmage isoform 1 is generated by retaining intron 1 in the 5'-untranslated region (UTR) of the mature mRNA. B: exon-intron boundaries corresponding to the coding sequence of the cmage gene. Circled nucleotides indicate the donor site junction, and the acceptor site is underlined. ***initial ATG; ^^^stop codon. C: Southern blot of genomic DNA obtained from embryonic day (E) 5 chick embryos (10 µg), digested with CaiI, and probed with a cmage-specific probe derived from part of the cDNA sequence encoding the MHD of CMage. A fragment of cmage cDNA (771 bp) and a fragment of cmage genomic DNA digested with CaiI (1,382 bp) were used as controls. The minor mobility shift with respect to the expected size observed in the right lane compared with the middle lane is probably due to distortions derived from the large amount of genomic DNA that was loaded into the gel. D: comparison of the Mage proteins from the species indicated with the MHD represented as black boxes.

 
Blastn searches of the chicken genome using the region of cmage encoding the MHD of CMage did not yield any additional sequences, indicating that the chicken genome contains only a single mage gene. This conclusion was empirically confirmed by Southern blot analysis of chicken genomic DNA using a specific cDNA probe from the MHD region of cmage. Low stringency hybridization of the latter probe resulted in a unique band (Fig. 2C).

A hypothetical CMage protein (NCBI accession number XM_424083) was previously predicted by automated computational analysis of a genomic region contained in the genomic contig mentioned above. This hypothetical protein derives from part of intron 4 and exons 5 to 9 of the cmage gene sequence, followed by two exons included in the chicken ESTs ChEST561j8, ChEST911e13, and ChEST183i21. These latter EST sequences are almost identical to the chicken 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 mRNA (NCBI accession number: NM_001030584). Moreover, the mRNA encoding this hypothetical CMage protein cannot be detected in the BBSRC ChickEST database. Indeed, we were unable to detect this mRNA by 3'- or 5'-RACE from E3 whole chick embryo or stage 36 heart cDNA (data not shown). Together, these data do not support the existence of this hypothetical protein.

mage gene family comprises single members in nonmammalian species.
Although more than 10 different type II mage genes have been described in mammals (5), the genomes of Drosophila, teleost fish, and chicken (G. gallus) seem to contain only a single mage gene (7, 47, 50; this study). We therefore decided to verify whether this is also the case in other nonmammalian species. Using information available in the NCBI public database, we examined the existence of putative mage genes in the genome of birds (Taeniopygia guttata), amphibia (Xenopus tropicalis), fishes (Danio rerio and Tetraodon nigroviridis), echinoderma (Strongylocentrotus purpuratus), insects (Drosophila melanogaster, Drosophila yakuba, Apis mellifera, and Anopheles gambiae), plants (Oryza sativa and Arabidopsis thaliana), fungi (Cryptococcus neoformans), nematodes (Caenorhabditis elegans), and protists (Entamoeba histolytica: Table 1, Fig. 2A). These data indicate that the genomes from nonmammalian species contain only one mage gene (Fig. 2A), most probably the ortholog of the ancestral gene that gave rise to the Mage superfamily of proteins in mammals (Fig. 2D). Although it was proposed that the ancestral mage gene originally contained multiple exons (10), the coding sequences of the Entamoeba histolityca and D. melanogaster mage genes are contained in a single exon (Fig. 2A). Therefore, the ancestral mage gene was probably encoded by a single exon, and it has acquired introns during the course of evolution. Indeed, the number of introns in the mage genes in the different animal phyla seems to increase as they have evolved (Fig. 2A).


View this table:
[in this window]
[in a new window]

 
Table 1. Mage proteins in nonmammalian species

 
Alternative splicing of cmage transcripts.
Unlike human mage-D genes (10), alternative splicing of exons in the mage genes from nonmammalian species seems to be a rare event (Fig. 2A). One exception is the mage gene from D. rerio (Fig. 2A) that encodes three different mRNA transcripts corresponding to full-length proteins (isoforms 1 and 3), as well as a hypothetical truncated Mage protein that lacks part of the MHD (isoform 2, NCBI accession number XP_708652) whose functional significance remains unclear (Fig. 2A). Therefore, we analyzed whether the cmage gene may also undergo alternative splicing. After performing a blastn search in the BBSRC ChickEST database with the ChEST965i23 sequence, we obtained 34 clones from different tissues of adult and embryonic chicken with a similar coding sequence, emphasizing that cmage is the only mage gene in the chicken genome. These EST sequences could be grouped into two major mRNA isoforms depending on the presence of intron 1 at their 5'-untranslated ends (Table 2). Thus, cmage isoform 1 retains this intron whereas in cmage isoform 2, this sequence is spliced out (Fig. 2A). Both these isoforms encode an identical protein, and they were readily detected by 5'-RACE from cDNA derived of E3 whole chick embryo (data not shown).


View this table:
[in this window]
[in a new window]

 
Table 2. Chicken ESTs found in the BBSRC ChickEST database codifying for the isoforms of CMage described in Fig. 2A

 
Conservation of the MHD during evolution.
The MHD from nonmammalian proteins has been conserved during evolution, as seen by comparing the MHD sequences derived from the nonmammalian Mage proteins with the MHD of human Necdin, used in this study as a prototypical type II Mage protein (Fig. 3A). As described previously (5), five subdomains can be seen in these MHDs. The relationship between the aligned MHD sequences was represented by a phylogenetic tree diagram (Fig. 3B), revealing that the different MHD motifs largely recapitulate eukaryote evolution. This result is in agreement with previous studies showing phylogenetical conservation between Drosophila Mage and the mammalian Mage proteins (7, 50). Thus, Mage proteins seem to represent an ancient eukaryotic protein family.


Figure 3
View larger version (54K):
[in this window]
[in a new window]

 
Fig. 3. Sequence comparison of the MHDs from known nonmammalian Mage proteins. A: an alignment of the MHDs from the nonmammalian Mage proteins together with human Necdin was performed by the CLUSTAL method to identify contigous regions of homology. The MHD subdomains I, III, and V described previously (5) are underlined. B: phylogenetic tree based on the homology between the Mage homology domains shown in A.

 
Anti-Necdin antiserum NC243 specifically recognizes CMage.
Since lower vertebrates appear to contain only a single mage gene in their genomes, the analysis of the signal transduction pathways mediated by type II Mage proteins might be simplified in these species. Birds shared a common ancestor with mammals ~310 million yr ago, at a phylogenetic distance not previously covered by other genome sequences (8). Therefore, these organisms are theoretically the best model system to study Mage protein function in higher vertebrates.

To further characterize CMage, we amplified its coding sequence from cDNAs obtained from E4 chick embryos using specific primers designed to add a FLAG tag in the COOH terminus of the molecule. This cDNA was subsequently cloned into a eukaryote expression vector. The flagged CMage protein was expressed in DF-1 cells, an immortalized chick fibroblast cell line, together with an RNA interference (RNAi) construct specific for either cmage or luciferase. Immunostaining performed with the NC243 anti-Necdin antiserum could be detected in most DF-1 cells cotransfected with cmage and luciferase-specific RNAi constructs, but not when cmage was coexpressed with the cmage-specific RNAi vector (Fig. 4A).


Figure 4
View larger version (51K):
[in this window]
[in a new window]

 
Fig. 4. Molecular characterization of CMage. A: CMage was expressed in DF-1 cells together with an RNA interference (RNAi) expression vector against Luciferase (RNAi lucif.) or an RNAi expression vector against cmage (RNAi cmage). After 24 h, the DF-1 cells were fixed and immunostained with the NC243 antibody raised against mouse Necdin (NC243), which was visualized with green fluorescence. RNAi vectors contained the coding sequence of red fluorescence protein and thus yielding red fluorescence in transfected DF-1 cells. Note how the NC243 antibody specifically recognized CMage in those cells transfected with the control RNAi expression vector. Bar: 15 µm. B: CMage was expressed in DF-1 cells together with an RNAi expression vector against luciferase (lucif.) or a RNAi expression vector against cmage (cmage). After 24 h, total extracts from DF-1 cells were obtained and subjected to Western blot analysis with the NC243 antibody. Note the 28.5-kDa band in extracts from DF-1 cells transfected with the RNAi expression vector against luciferase or with no RNAi expression vector. The CMage-specific 28.5-kDa band was highly reduced in the extracts derived from untransfected DF-1 cells or DF-1 cells transfected with the RNAi expression vector against cmage, demonstrating that the NC243 antibody specifically recognizes CMage. This same antibody recognized a specific 28.5-kDa band in total extracts from E5 chick retinal cells. The amount of protein extracted from DF-1 cells on the membranes was similar in all lanes as revealed by Ponceau S staining (Ponceau).

 
A 28.5-kDa band, corresponding to the expected molecular mass of CMage, was detected in total extracts from cmage transfected DF-1 cells or in DF-1 cells cotransfected with cmage and the luciferase-specific RNAi construct. In contrast, this band was not observed in the control untransfected DF-1 cells or in DF-1 cells cotransfected with cmage and the cmage-specific RNAi construct. This same band was also observed in extracts of E5 chick retinas (Fig. 4B). Together, these data indicate that the NC243 antiserum reliably recognizes chicken CMage.

High levels of CMage can be detected in vivo in regions that accumulate p75NTR and are enriched in postmitotic neurons.
The expression of cmage was analyzed in the chick embryo by in situ hybridization with a cmage-specific probe and by immunohistochemistry using the NC243 antiserum. At E4, the earliest stage analyzed, cmage mRNA was particularly enriched in the neural epithelium (Fig. 5A). Accordingly, strong levels of cmage mRNA were detected at different developmental stages in specific regions of the developing nervous system with the cmage-specific antisense probe (Fig. 5, B, E, H, and K), but not with a control probe containing the sense sequence of cmage (Fig. 5B). This analysis revealed that cmage was expressed strongly in the dorsal root ganglia at all developmental stages analyzed and in the ventral horn of the spinal cord between embryonic day (E) 4 and E6. The expression of cmage subsequently decreased in the ventral horn of the spinal cord as development proceeded and was virtually absent at E11. In addition, sympathetic ganglia also strongly expressed cmage mRNA at E6–E11. The expression of CMage in these neural structures was also analyzed by immunohistochemistry in adjacent brachial sections, and as expected, the distribution of CMage protein was highly coincident with that of its mRNA (Fig. 5, C, F, I, and L). Thus, CMage was enriched in cells located in the ventral horn of the spinal cord, the number of these cells diminishing as development proceeded, and it also accumulated in the dorsal root ganglia at all developmental stages studied. CMage was also detected in the sympathetic ganglia (data not shown).


Figure 5
View larger version (99K):
[in this window]
[in a new window]

 
Fig. 5. Expression of cmage mRNA in the dorsal root ganglia and the ventral horn of the spinal cord visualized by in situ hybridization, and distribution of CMage and p75 neurotrophin receptor (p75NTR) visualized by immunohistochemistry. A saggital section (12 µm, A) or transverse sections (B–M) from the brachial region (see dashed line in A) of chick embryos at the ages indicated were subjected to in situ hybridization using a cmage-specific probe (cmage) or a sense control probe (sense), or they were immunostained with the NC243 antiserum (CMage) or an antibody against the intracellular domain of p75NTR (p75). Observe the specific labeling for cmage or CMage of cells located in dorsal root ganglia (drg) cells at all developmental stages, coincident with p75NTR immunoreactivity. Cells in the ventral horn of the spinal cord (asterisk) were labeled for cmage or CMage. This labeling steadily decreased as development proceeds, whereas p75NTR immunolabeling was maintained through all the developmental stages analyzed. In E, H, K: panels at right represent higher magnification of the panels to the left. Sympathetic ganglia (sg) also expressed cmage at E6–E11. h, heart; m, mesencephalic vesicle; ne, neuroepithelium; s, somite; sp, spinal cord; t, telencephalic vesicle; wb, wing bud. Bar: 75 µm (C, D); 150 µm (A, B, E–M).

 
The expression of cmage in the retina was also examined by in situ hybridization and immunohistochemistry. At E4, all retinal cells seem to express low levels of cmage mRNA and contain a little CMage protein, except the cells in the presumptive retinal ganglion cell layer (RGCL) that accumulated higher levels of CMage protein and its transcripts (Fig. 6, A and B). This expression pattern was maintained as development proceeded, and accordingly, most cells in the RGCL at E6–E8 strongly expressed cmage or contained high levels of CMage protein (Fig. 6, D, E, G, and H). At E11, cells containing high levels of cmage mRNA or the CMage protein could be observed in the RGCL, as well as in the most internal and external areas of the inner nuclear layer (Fig. 6, J and K).


Figure 6
View larger version (115K):
[in this window]
[in a new window]

 
Fig. 6. Expression of cmage RNA in the retina visualized by in situ hybridization, and of CMage and p75NTR visualized by immunohistochemistry. Cryosections (12 µm) from chick embryos of the ages indicated were used for in situ hybridization using a cmage-specific probe (cmage) or immunostained with the NC243 antiserum (CMage) or an antibody against the intracellular domain of p75NTR (p75). Although at E4 most retinal cells seem to express cmage or contain the CMage product, its expression is higher in the presumptive retinal ganglion cell layer (rgcl, arrows in A, B). This pattern coincided with that of p75 intracellular domain (p75ICD, arrowhead in C). At E6–E8, most cells expressing cmage or containing CMage protein were visible in the rgcl (arrows in D, E, G, H), coinciding with p75ICD-positive cells in this region (arrowheads in F, I). At E11, most cmage- or CMage-expressing cells are confined to the rgcl (arrows in J, K) where p75ICD-positive cells can also be observed (arrowhead in L). Cells positive for cmage, CMage, or p75ICD can also be observed in the most internal and external areas (asterisks in K, L) of the inner nuclear layer (inl). In A, D, G, J: panels at right represent higher magnification of the panels to the left. fl, Fiber layer; ipl, inner plexiform layer; l, lens; pe, pigmented epithelium; v, vitreous body. Bar: 75 µm (A–C); 150 µm (D–L).

 
To compare the expression pattern of CMage with that of p75NTR, a protein known to interact with type II Mage proteins, we performed immunohistochemistry with a p75ICD-specific antibody in adjacent sections. This analysis revealed that p75ICD-specific immunostaining was present in the dorsal root ganglia and in cells located at the ventral horn of the spinal cord at all stages analyzed (Fig. 5, D, G, J, and M), coincident with the expression of CMage in these structures. A similar overlap in expression was also observed in the retina, where p75NTR-specific labeling was observed in the RGCL at all stages analyzed, as well as in the most internal and external areas of the inner nuclear layer from E8 onward (Fig. 6, C, F, I, and L). Unlike CMage, at E11 p75NTR immunoreactivity was also observed in the inner plexiform layer. Finally, colocalization of CMage with p75NTR in the retina, the ventral horn of the spinal cord, and the dorsal root ganglia was confirmed by double immunostaining with a previously described mouse polyclonal anti-p75NTR antibody (11) together with the NC243 antiserum (Supplementary Fig. S1). (The online version of this article contains supplementary material.)

The areas where CMage were seen to be expressed are known to contain postmitotic neurons. To directly test whether CMage is mainly expressed by cells that cannot proliferate, chick embryos from different developmental stages were treated with BrdU for 1 h and then killed. Sections from these embryos were double immunostained with the NC243 antiserum and anti-BrdU. Most areas containing high levels of CMage immunolabeling excluded BrdU immunostaining (Fig. 7, A and C, and data not shown), indicating that the cells expressing CMage at high levels were postmitotic. Double labeling was also performed in these sections with the NC243 antiserum and the MAb TuJ-1, which specifically recognizes neurons (39). This analysis confirmed that the cells that express CMage at high levels in the dorsal root ganglia, the ventral horn of the spinal cord, and the retina are predominantly postmitotic neurons (Fig. 7, B, D, and E).


Figure 7
View larger version (73K):
[in this window]
[in a new window]

 
Fig. 7. CMage is expressed at high levels in postmitotic neurons. Cryosections (12 µm) from BrdU-treated chick embryos of the ages indicated were double immunostained with the NC243 antiserum (Mage, green) and anti-BrdU (BrdU), anti TuJ-1 (TuJ), or anti-Islet-1 (Islet-1) antibodies (red). Observe how most areas enriched in CMage labeling (arrows in A, B; asterisks and drg in C–E) were coincident with TuJ-1 immunoreactivity (B, D, E) but not with areas of BrdU incorporation (A, C). Although some CMage-positive cells located in the ventral horn of the spinal cord did not colocalized with Islet-1 immunoreactivity (arrows in F), many other cells coexpress Islet-1, a motoneuron-specific marker in the spinal cord, and CMage (asterisks in F). Drg cells also express Islet-1 (F). Right panels show merged images. Bar: 75 µm (A–D); 150 µm (E, F).

 
To define the identity of the CMage-positive neurons from the ventral spinal cord, double labeling with an anti-Islet-1 antibody was performed. Accordingly, many CMage-positive cells located in the ventral horn of the spinal cord coexpress Islet-1 (Fig. 7F), a spinal cord motoneuron-specific marker (17), demonstrating that motoneurons express CMage during the early stages of development. Interestingly, some CMage-positive neurons located in the ventral horn of the spinal cord do not show Islet-1 (Fig. 7F) nor p75NTR (Supplementary Fig. S1C) expression, indicating that CMage expression is not restricted to motoneurons.

CMage can interact with both E2F-1 and p75ICD.
To test whether CMage shows functional similarities to the mammalian type II Mage proteins, we compared it with Necdin, used in this study as a prototypical member of this protein family. Necdin has been shown to maintain neurons in a postmitotic state by binding to the transactivation domain of the E2F-1 transcription factor, thereby blocking its function and mimicking the function of Rb (56). Hence, we examined whether CMage also interacts with E2F-1 in differentiating N1E-115 neuroblastoma cells. Full-length p75NTR has been shown to interact with Necdin and Mage-G1 through its intracellular domain in differentiating N1E-115 neuroblastoma cells, displacing the interaction of these proteins with E2F-1 (33). Therefore, we also assessed whether the presence of p75ICD can prevent CMage from interacting with E2F-1.

To address these issues, we performed coimmunoprecipitation assays on cell extracts from N1E-115 neuroblastoma cells transfected with E2F-1 and CMage (or Necdin) alone or in the presence of p75ICD and induced to differentiate (30). An interaction between Necdin or CMage and E2F-1 was readily detected in the absence of p75ICD expression (Fig. 8, A and B), demonstrating that like Necdin, CMage can interact with E2F-1. The expression of p75ICD in differentiating N1E-115 neurons impaired the interaction between CMage and E2F-1 while a strong interaction of CMage with p75ICD was observed (Fig. 8B) similar to that observed for the interaction between Necdin and E2F-1 (Fig. 8A). Thus, we conclude that CMage can interact with p75ICD like other type II Mage proteins [including Mage-D1 (53), Necdin (33, 57), Mage-G1 (33), and Mage-H1 (57)]. Importantly, this association impaired the interaction of CMage with E2F-1, as previously shown for Necdin and Mage-G1 (33).


Figure 8
View larger version (38K):
[in this window]
[in a new window]

 
Fig. 8. Overexpression of p75ICD reduces the association of CMage with E2F-1 in differentiating N1E-115 neuroblastoma cells. N1E-115 neuroblastoma cells were transfected with different combinations of the expression vectors for FLAG-Necdin (A) or FLAG-CMage (B) and E2F-1, and with different amounts of HA-p75ICD, before they were induced to differentiate with 2% DMSO. Cell lysates were immunoprecipitated (IP) with antibodies against the FLAG epitope ({alpha}FLAG), and immunoblotted (WB) with anti-p75ICD ({alpha}p75ICD) or anti-E2F-1 ({alpha}E2F-1) antibodies. Cell lysates were subjected to Western blotting for p75ICD, E2F-1 and FLAG, (Input, bottom) to show the amount of these proteins in the lysates prior to immunoprecipitation.

 
Interference of p75ICD with the E2F-1/CMage interaction facilitates apoptosis in differentiating N1E-115 neuroblastoma cells.
The interaction of Necdin or Mage-G1 with E2F-1 abolishes the proapoptotic influence of the latter in differentiating N1E-115 neuroblastoma cells, whereas the expression of full-length p75NTR in these cells impedes these proteins from interacting with E2F-1, thereby favoring E2F-1-dependent neuronal death (33). We therefore studied whether CMage could mimic this effect, favoring E2F-1-dependent neuronal death in differentiating N1E-115 neuroblastoma cells. We quantified the percentage of condensed nuclei undergoing programmed cell death to assess the extent of cell death observed in the differentiating N1E-115 neuroblastoma cells expressing CMage and E2F-1 alone or together with p75ICD. As shown previously (33), the expression of E2F-1 in these cells dramatically increased the basal level of apoptosis (Fig. 9B). This cell death was partially prevented by the coexpression of CMage (Fig. 9B) in agreement with its capacity to bind E2F-1. The expression of p75ICD clearly neutralized the rescue from apoptosis by CMage (Fig. 9B), probably by impairing its interaction with E2F-1. A similar result was also obtained with Necdin instead of CMage (Fig. 9A). Therefore, we conclude that Necdin and CMage have the potential to inhibit E2F-1-dependent apoptosis, which can be prevented by their interaction with p75ICD.


Figure 9
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 9. Overexpression of p75ICD facilitates the proapoptotic activity of E2F-1 in differentiating N1E-115 neuroblastoma cells. N1E-115 neuroblastoma cells were transfected with combinations of expression vectors for E2F-1 (E2F1), HA-p75ICD (p75ICD), and FLAG-Necdin (Necdin) (A) or FLAG-CMage (CMage) (B), together with a green fluorescent protein (GFP)-expressing vector (1 µg each). Transfected cells were induced to differentiate with 2% DMSO for 24 h, fixed, and stained with bisbenzimide. The percentage of pyknotic nuclei as revealed by nuclear condensation after bisbenzimide staining was analyzed in GFP-positive cells and represented as percentages of apoptosis. *P < 0.01; **P < 0.005; ***P < 0.001 (n = 3, Student's t-test).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Mage proteins are expressed by single genes in nonmammalian species.
In this study, we have detected the presence of single mage genes in all nonmammalian species for which the genomic sequences are available in the NCBI database, in accordance with earlier indications that only one mage gene can be detected in Drosophila and teleost fish (7, 47, 50). The presence of a single mage gene per genome in nonmammalian species contrasts with the situation described in mammals, which contain dozens of different mage genes possibly generated by retrotransposition (10). Indeed, only genes belonging to the mage-D subfamily contain introns in their coding sequence, indicating that they are likely to be the orthologs of the common ancestor of all the mage genes. We believe that this ancestral mage gene may have lacked introns since the mage genes of Entamoeba histolytica and D. melanogaster do not contain introns in their sequences. The acquisition of introns seems to have played a role during the evolution of the mage genes, in accordance with the known importance of exon gain and loss during gene evolution (18).

Despite the presence of multiple exons in most nonmammalian mage genes, alternative splicing of exons is a rare event that usually takes place in noncoding regions. This indicates that only one Mage protein per genome is expressed in most nonmammalian species. Nevertheless, alternative forms of zebrafish mage-specific mRNA lacking the first exon can be found in the NCBI database. The analysis of the BBSRC ChickEST database indicated the existence of two main isoforms of cmage mRNA, similar to mage isoforms 1 and 3 from zebrafish, both encoding an identical form of CMage. cmage isoform 1 differs from isoform 2 in its 5'-UTR due to alternative splicing of intron 1 in the mature mRNA.

Structurally, most Mage proteins from nonmammalian species contain a conserved MHD in the center of the molecule. This domain has been conserved during evolution, and it is highly related to the MHD of the type II Mage proteins, in accordance with a previous study demonstrating that the Mage proteins from Drosophila and mammals are phylogenetically conserved (50). Most nonmammalian Mage proteins contain two small MHD flanking regions similar to human Necdin, Mage-G1, and Mage F1. Nevertheless, other mammalian Mage proteins have acquired additional domains in these flanking regions, as is the case of the Mage-D proteins that contain the so-called MHD2 and an "interspersed repeat domain" (5). Such motifs seem to have been acquired during the course of evolution of the mammalian genome as they are not present in nonmammalian Mage proteins.

CMage is a new member of the Mage family expressed in specific areas of the nervous system enriched in p75NTR.
In this study, we cloned the full-length coding sequence corresponding to the cmage gene, which contains eleven exons distributed over a 2.2-kb genomic fragment. In accordance with other nonmammalian species, cmage seems to be unique in the chicken genome since only a single band could be observed in low-stringency Southern blots of genomic DNA, and Blastn searches of the chicken genome did not yield any additional sequence to that of cmage. The cDNA cloned encodes CMage, which is structurally similar to the members of the type II Mage protein family.

CMage was specifically recognized by the NC243 antiserum directed against mouse Necdin, which detected a specific band of 28.5 kDa in extracts from DF-1 cells transiently transfected with CMage or from chick retinal cells and was able to immunostain CMage-expressing DF-1 cells but not control cells. Furthermore, immunostaining with NC243 in tissue sections yielded a similar pattern to that observed by in situ hybridization, again indicating that this antibody specifically recognizes CMage.

These experiments demonstrate that CMage was strongly expressed in developing areas enriched in projecting neurons such as the retinal ganglion cell layer, the ventral horn of the spinal cord, and dorsal root ganglia. Low levels of CMage expression were also detected in proliferating progenitor cells at the early stages of retinal development, in accordance with the finding that the Drosophila Mage protein may be expressed in mitotically active neural precursors such as neuroblasts and ganglion mother cells (47). Moreover, weak levels of this Mage protein were detected throughout the embryo, in accordance with the existence of ESTs from several specific tissues encoding CMage (Table 2). The areas where CMage was strongly expressed contain postmitotic neurons and express p75NTR, known to interact with type II Mage proteins through its intracellular domain (5). Indeed, p75NTR is expressed by chicken retinal ganglion cells (60), dorsal root ganglia (26), and motoneurons (26, 43), and we confirmed that p75NTR is also expressed in these regions and colocalizes with CMage in most cells.

CMage shows functional similarities with the type II Mage protein Necdin.
In this study we present evidence of functional similarities between CMage and Necdin, based on the capacity of both proteins to interact with p75NTR and E2F-1.

p75NTR is able to transduce proapoptotic signals in response to ligand binding (20), which can be linked to alterations in cell cycle progression (37), and type II Mage proteins are known to interact with the intracellular domain of p75NTR (33, 53, 57), thus constituting a potential link between p75NTR, cell cycle regulation, and apoptosis (37). To date, four different type II Mage proteins have been shown to interact with the intracellular domain of p75NTR in mammals: Necdin (33, 57), Mage-D1 (53), Mage-G1 (33), and Mage-H1 (57). Of these proteins, Necdin is predominantly expressed in postmitotic cells (2, 42, 58), and its pattern of expression in the developing mouse correlates with p75NTR expression (4), as occurs with CMage (this study). Through coimmunoprecipitation of total extracts from differentiating N1E-115 neuroblastoma cells cotransfected with p75ICD and CMage or Necdin, we demonstrated that the latter proteins are both able to interact with p75ICD. These results stress the functional conservation between CMage and type II Mage proteins.

Besides its capacity to interact with p75ICD, Necdin can suppress proliferation in several cell lines due to its capacity to repress the activity of the E2F-1 transcription factor (25, 56). Previous studies in differentiating N1E-115 neuroblastoma cells have demonstrated that full-length p75NTR can sequester Necdin and Mage-G1 at the cell membrane, preventing their interaction with E2F-1 (33). In this study, we have demonstrated that the binding of the p75ICD fragment to Necdin or CMage can prevent these latter proteins from establishing an inhibitory interaction with E2F-1.

The presence of functional E2F-1 in postmitotic neurons is known to trigger cell death through well-characterized mechanisms, including the stabilization of p53 levels or the induction of cdk1/cdc2 expression (22, 23), being the latter mechanism directly attenuated by Necdin (32). Furthermore, the activation of p75NTR by neurotrophins can provoke the release of p75ICD, which is linked to the induction of apoptosis (19, 28, 49). We have demonstrated that releasing E2F-1 from its interaction with CMage or Necdin in the presence of p75ICD is capable of facilitating apoptosis of differentiating N1E-115 neuroblastoma cells, as occurs when Necdin is sequestered by full-length p75NTR in the cell membrane (33). In vivo, the lack of Necdin has been shown to trigger sensory defects derived from a loss of dorsal root ganglion neurons, probably due to apoptosis (3). Whether or not the mechanism used by Necdin to prevent this loss of sensory neurons is based on a mechanism dependent on p75ICD/E2F-1 remains to be analyzed.

While Necdin and Mage-G1 have been reported to bind to p75NTR and E2F-1, other type II Mage proteins such as Mage-L2 do not bind to these proteins (33). This functional divergence raises the question as to whether the capacity of some Mage proteins to interact with p75NTR and E2F-1, preventing E2F-1 activity, was acquired during mammalian evolution. Conversely, this function may have existed in other phyla before the origin of mammals, and it was lost in some mammalian Mage members. In this study we demonstrate that this function seems to have arisen before mammals diverged from other phyla, as a nonmammalian Mage protein, CMage, is able to interact with p75NTR and E2F-1, and prevent the proapoptotic function of the latter.

In this study we have compared the function of CMage and Necdin. However, CMage appears to be more closely related to Mage-D1 in structural terms (Fig. 1B). Therefore, we cannot exclude that Mage-D1 may also be able to interact with E2F-1 and block its proapoptotic function, as previously shown for other type II Mage proteins (33). Mage-D1 has incorporated novel protein domains into its amino acid sequence during the course of mammalian evolution (5) and unlike Necdin and CMage, it is strongly expressed in proliferative neural subpopulations where p75NTR is absent (29, 53). These distinctive features of Mage-D1 indicate that this protein may have acquired additional functions to that of other type II Mage proteins during the course of mammalian evolution.

In conclusion, we believe that the functional similarity between CMage and Necdin coupled with the fact that only one mage gene is present in the chicken genome strengthens the idea that the chick represents a potentially useful model system to further analyze Mage protein function.


    GRANTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by Ministerio de Educación y Ciencia Grants BMC2003-03441 and BFU2006-00805, by Fundación La Caixa Grant BM05-71-0, and by FUNDALUCE.


    ACKNOWLEDGMENTS
 
We thank Ruth Diez del Corral, María-Jesús Latasa, and Mark Sefton for useful scientific comments and Yves-Alain Barde, Alfredo Rodríguez-Tébar, and Moses Chao for the gift of the p75ICD construct, the mouse anti-p75NTR polyclonal antibody, and the rabbit anti-p75ICD antiserum [9992], respectively. The anti-BrdU MAb G3G4, developed by Stephen J. Kaufman, and the anti-Islet1 MAb 40.2D6, developed by Thomas M. Jessell, were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the National Institute of Child Health and Human Development and maintained by the University of Iowa.

Present address for Z. Fernández-González: Dept. of Neurology, Univ. of Navarra, E-31008 Pamplona, Spain.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: J. M. Frade, Instituto Cajal, CSIC, Avda Doctor Arce 37, E-28002 Madrid, Spain (e-mail: frade{at}cajal.csic.es).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, Amanatides PG, Scherer SE, Li PW, Hoskins RA, Galle RF, George RA, Lewis SE, Richards S, Ashburner M, Henderson SN, Sutton GG, Wortman JR, Yandell MD, Zhang Q, Chen LX, Brandon RC, Rogers YH, Blazej RG, Champe M, Pfeiffer BD, Wan KH, Doyle C, Baxter EG, Helt G, Nelson CR, Gabor GL, Abril JF, Agbayani A, An HJ, Andrews-Pfannkoch C, Baldwin D, Ballew RM, Basu A, Baxendale J, Bayraktaroglu L, Beasley EM, Beeson KY, Benos PV, Berman BP, Bhandari D, Bolshakov S, Borkova D, Botchan MR, Bouck J, Brokstein P, Brottier P, Burtis KC, Busam DA, Butler H, Cadieu E, Center A, Chandra I, Cherry JM, Cawley S, Dahlke C, Davenport LB, Davies P, de Pablos B, Delcher A, Deng Z, Mays AD, Dew I, Dietz SM, Dodson K, Doup LE, Downes M, Dugan-Rocha S, Dunkov BC, Dunn P, Durbin KJ, Evangelista CC, Ferraz C, Ferriera S, Fleischmann W, Foster C, Gabrielian AE, Garg NS, Gelbart WM, Glasser K, Glodek A, Gong F, Gorrell JH, Gorrell JH, Gu Z, Guan P, Harris M, Harris NL, Harvey D, Heiman TJ, Hernandez JR, Houck J, Hostin D, Houston KA, Howland TJ, Wei MH, Ibegwam C, Jalali M, Kalush F, Karpen GH, Ke Z, Kennison JA, Ketchum KA, Kimmel BE, Kodira CD, Kraft C, Kravitz S, Kulp D, Lai Z, Lasko P, Lei Y, Levitsky AA, Li J, Li Z, Liang Y, Lin X, Liu X, Mattei B, McIntosh TC, McLeod MP, McPherson D, Merkulov G, Milshina NV, Mobarry C, Morris J, Moshrefi A, Mount SM, Moy M, Murphy B, Murphy L, Muzny DM, Nelson DL, Nelson DR, Nelson KA, Nixon K, Nusskern DR, Pacleb JM, Palazzolo M, Pittman GS, Pan S, Pollard J, Puri V, Reese MG, Reinert K, Remington K, Saunders RD, Scheeler F, Shen H, Shue BC, Siden-Kiamos I, Simpson M, Skupski MP, Smith T, Spier E, Spradling AC, Stapleton M, Strong R, Sun E, Svirskas R, Tector C, Turner R, Venter E, Wang AH, Wang X, Wang ZY, Wassarman DA, Weinstock GM, Weissenbach J, Williams SM, Woodage T, Worley KC, Wu D, Yang S, Yao QA, Ye J, Yeh RF, Zaveri JS, Zhan M, Zhang G, Zhao Q, Zheng L, Zheng XH, Zhong FN, Zhong W, Zhou X, Zhu S, Zhu X, Smith HO, Gibbs RA, Myers EW, Rubin GM, Venter JC. The genome sequence of Drosophila melanogaster. Science 287: 2185–2195, 2000.[Abstract/Free Full Text]
  2. Aizawa T, Maruyama K, Kondo H, Yoshikawa K. Expression of necdin, an embryonal carcinoma-derived nuclear protein, in developing mouse brain. Dev Brain Res 68: 265–274, 1992.[Medline]
  3. Andrieu D, Meziane H, Marly F, Angelats C, Fernandez PA, Muscatelli F. Sensory defects in Necdin deficient mice result from a loss of sensory neurons correlated within an increase of developmental programmed cell death. BMC Dev Biol 6: 56, 2006.[CrossRef][Medline]
  4. Andrieu D, Watrin F, Niinobe M, Yoshikawa K, Muscatelli F, Fernandez PA. Expression of the Prader-Willi gene Necdin during mouse nervous system development correlates with neuronal differentiation and p75NTR expression. Gene Expr Patterns 3: 761–765, 2003.[CrossRef][Medline]
  5. Barker PA, Salehi A. The MAGE proteins: emerging roles in cell cycle progression, apoptosis, and neurogenetic disease. J Neurosci Res 67: 705–712, 2002.[CrossRef][Web of Science][Medline]
  6. Barret GL, Greferath U, Barker PA, Trieu J, Bennie A. Co-expression of the P75 neurotrophin receptor and neurotrophin receptor-interacting melanoma antigen homolog in the mature rat brain. Neuroscience 133: 381–392, 2005.[CrossRef][Web of Science][Medline]
  7. Bischof JM, Ekker M, Wevrick R. A MAGE/NDN-like gene in zebrafish. Dev Dyn 228: 475–479, 2003.[CrossRef][Web of Science][Medline]
  8. Burt DW. Chicken genome: current status and future opportunities. Genome Res 15: 1692–1698, 2005.[Abstract/Free Full Text]
  9. C. elegans Sequencing Consortium. Genome sequence of the nematode C. elegans: a platform for investigating biology. Science 282: 2012–2018, 1998.[Abstract/Free Full Text]
  10. Chomez P, De Backer O, Bertrand M, De Plaen E, Boon T, Lucas S. An overview of the MAGE gene family with the identification of all human members of the family. Cancer Res 61: 5544–5551, 2001.[Abstract/Free Full Text]
  11. Cotrina ML, González-Hoyuela M, Barbas JA, Rodríguez-Tébar A. Programmed cell death in the developing somites is promoted by nerve growth factor via its p75NTR receptor. Dev Biol 228: 326–336, 2000.[CrossRef][Web of Science][Medline]
  12. Das RM, Van Hateren NJ, Howell GR, Farrell ER, Bangs FK, Porteous VC, Manning EM, McGrew MJ, Ohyama K, Sacco MA, Halley PA, Sang HM, Storey KG, Placzek M, Tickle C, Nair VK, Wilson SA. A robust system for RNA interference in the chicken using a modified microRNA operon. Dev Biol 294: 554–563, 2006.[CrossRef][Web of Science][Medline]
  13. De Backer O, Verheyden AM, Martin B, Godelaine D, De Plaen E, Brasseur R, Avner P, Boon T. Structure, chromosomal location, and expression pattern of three mouse genes homologous to the human MAGE genes. Genomics 28: 74–83, 1995.[CrossRef][Web of Science][Medline]
  14. De Plaen E, De Backer O, Arnaud D, Bonjean B, Chomez P, Martelange V, Avner P, Baldacci P, Babinet C, Hwang SY, Knowles B, Boon T. A new family of mouse genes homologous to the human MAGE genes. Genomics 55: 176–184, 1999.[CrossRef][Web of Science][Medline]
  15. De Plaen E, Traversari C, Gaforio JJ, Szikora JP, De Smet C, Brasseur F, van der Bruggen P, Lethé B, Lurquin C, Chomez P, De Backer O, Boon T, Arden K, Cavenee W, Brasseur R. Structure, chromosomal localization, and expression of 12 genes of the MAGE family. Immunogenetics 40: 360–369, 1994.[CrossRef][Web of Science][Medline]
  16. Domazet-Loso T, Tautz D. An evolutionary analysis of orphan genes in Drosophila. Genome Res 13: 2213–2219, 2003.[Abstract/Free Full Text]
  17. Ericson J, Thor S, Edlund T, Jessell TM, Yamada T. Early stages of motor neuron differentiation revealed by expression of homeobox gene Islet-1. Science 256: 1555–1560, 1992.[Abstract/Free Full Text]
  18. Fedorova L, Fedorov A. Introns in gene evolution. Genetica 118: 123–131, 2003.[CrossRef][Web of Science][Medline]
  19. Frade JM. Nuclear translocation of the p75 neurotrophin receptor cytoplasmic domain in response to neurotrophin binding. J Neurosci 25: 1407–1411, 2005.[Abstract/Free Full Text]
  20. Frade JM, Rodríguez-Tébar A, Barde YA. Induction of cell death by endogenous nerve growth factor through its p75 receptor. Nature 383: 166–168, 1996.[CrossRef][Medline]
  21. Gerard M, Hernandez L, Wevrick R, Stewart CL. Disruption of the mouse necdin gene results in early post-natal lethality. Nat Genet 23: 199–202, 1999.[CrossRef][Web of Science][Medline]
  22. Ginsberg D. E2F1 pathways to apoptosis. FEBS Lett 529: 122–125, 2002.[CrossRef][Web of Science][Medline]
  23. Greene LA, Biswas SC, Liu DX. Cell cycle molecules and vertebrate neuron death: E2F at the hub. Cell Death Differ 11: 49–60, 2004.[CrossRef][Web of Science][Medline]
  24. Hamburger V, Hamilton H. A series of normal stages in the development of chick embryo. J Morphol 88: 49–92, 1951.[CrossRef][Web of Science]
  25. Hayashi Y, Matsuyama K, Takagi K, Sugiura H, Yoshikawa K. Arrest of cell growth by necdin, a nuclear protein expressed in postmitotic neurons. Biochem Biophys Res Commun 213: 317–324, 1995.[CrossRef][Web of Science][Medline]
  26. Heuer JG, Fatemie-Nainie S, Wheeler EF, Bothwell M. Structure and developmental expression of the chicken NGF receptor. Dev Biol 137: 287–304, 1990.[CrossRef][Web of Science][Medline]
  27. Jaillon O, Aury JM, Brunet F, Petit JL, Stange-Thomann N, Mauceli E, Bouneau L, Fischer C, Ozouf-Costaz C, Bernot A, Nicaud S, Jaffe D, Fisher S, Lutfalla G, Dossat C, Segurens B, Dasilva C, Salanoubat M, Levy M, Boudet N, Castellano S, Anthouard V, Jubin C, Castelli V, Katinka M, Vacherie B, Biemont C, Skalli Z, Cattolico L, Poulain J, De Berardinis V, Cruaud C, Duprat S, Brottier P, Coutanceau JP, Gouzy J, Parra G, Lardier G, Chapple C, McKernan KJ, McEwan P, Bosak S, Kellis M, Volff JN, Guigo R, Zody MC, Mesirov J, Lindblad-Toh K, Birren B, Nusbaum C, Kahn D, Robinson-Rechavi M, Laudet V, Schachter V, Quetier F, Saurin W, Scarpelli C, Wincker P, Lander ES, Weissenbach J, Roest Crollius H. Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype. Nature 431: 946–957, 2004.[CrossRef][Medline]
  28. Kenchappa RS, Zampieri N, Chao MV, Barker PA, Teng HK, Hempstead BL, Carter BD. Ligand-dependent cleavage of the P75 neurotrophin receptor is necessary for NRIF nuclear translocation and apoptosis in sympathetic neurons. Neuron 50: 219–232, 2006.[CrossRef][Web of Science][Medline]
  29. Kendall SE, Goldhawk DE, Kubu C, Barker PA, Verdi JM. Expression analysis of a novel p75(NTR) signaling protein, which regulates cell cycle progression and apoptosis. Mech Dev 117: 187–200, 2002.[CrossRef][Web of Science][Medline]
  30. Kimhi Y, Palfrey C, Spector I, Barak Y, Littauer UZ. Maturation of neuroblastoma cells in the presence of dimethylsulfoxide. Proc Natl Acad Sci USA 73: 462–466, 1976.[Abstract/Free Full Text]
  31. Kobayashi M, Taniura H, Yoshikawa K. Ectopic expression of necdin induces differentiation of mouse neuroblastoma cells. J Biol Chem 277: 42128–42135, 2002.[Abstract/Free Full Text]
  32. Kurita M, Kuwajima T, Nishimura I, Yoshikawa K. Necdin downregulates cdc2 expression to attenuate neuronal apoptosis. J Neurosci 26: 12003–12013.
  33. Kuwako K, Taniura H, Yoshikawa K. Necdin-related MAGE proteins differentially interact with the E2F1 transcription factor and the p75 neurotrophin receptor. J Biol Chem 279: 1703–1712, 2004.[Abstract/Free Full Text]
  34. Lee MK, Tuttle JB, Rebhun LI, Cleveland DW, Frankfurter A. The expression and posttranslational modification of a neuron-specific beta-tubulin isotype during chick embryogenesis. Cell Motil Cytoskeleton 17: 118–132, 1990.[CrossRef][Web of Science][Medline]
  35. Loftus B, Anderson I, Davies R, Alsmark UC, Samuelson J, Amedeo P, Roncaglia P, Berriman M, Hirt RP, Mann BJ, Nozaki T, Suh B, Pop M, Duchene M, Ackers J, Tannich E, Leippe M, Hofer M, Bruchhaus I, Willhoeft U, Bhattacharya A, Chillingworth T, Churcher C, Hance Z, Harris B, Harris D, Jagels K, Moule S, Mungall K, Ormond D, Squares R, Whitehead S, Quail MA, Rabbinowitsch E, Norbertczak H, Price C, Wang Z, Guillen N, Gilchrist C, Stroup SE, Bhattacharya S, Lohia A, Foster PG, Sicheritz-Ponten T, Weber C, Singh U, Mukherjee C, El-Sayed NM, Petri WA Jr, Clark CG, Embley TM, Barrell B, Fraser CM, Hall N. The genome of the protist parasite Entamoeba histolytica. Nature 433: 865–868, 2005.[CrossRef][Medline]
  36. Loftus BJ, Fung E, Roncaglia P, Rowley D, Amedeo P, Bruno D, Vamathevan J, Miranda M, Anderson IJ, Fraser JA, Allen JE, Bosdet IE, Brent MR, Chiu R, Doering TL, Donlin MJ, D'Souza CA, Fox DS, Grinberg V, Fu J, Fukushima M, Haas BJ, Huang JC, Janbon G, Jones SJ, Koo HL, Krzywinski MI, Kwon-Chung JK, Lengeler KB, Maiti R, Marra MA, Marra RE, Mathewson CA, Mitchell TG, Pertea M, Riggs FR, Salzberg SL, Schein JE, Shvartsbeyn A, Shin H, Shumway M, Specht CA, Suh BB, Tenney A, Utterback TR, Wickes BL, Wortman JR, Wye NH, Kronstad JW, Lodge JK, Heitman J, Davis RW, Fraser CM, Hyman RW. The genome of the basidiomycetous yeast and human pathogen Cryptococcus neoformans. Science 307: 1321–1324, 2005.[Abstract/Free Full Text]
  37. López-Sánchez N, Frade JM. Control of the cell cycle by neurotrophins: lessons from the p75 neurotrophin receptor. Histol Histopathol 17: 1227–1237, 2002.[Web of Science][Medline]
  38. López-Sánchez N, Müller U, Frade JM. Lengthening of G2/mitosis in cortical precursors from mice lacking beta-amyloid precursor protein. Neuroscience 130: 51–60, 2005.[CrossRef][Web of Science][Medline]
  39. Lucas S, De Plaen E, Boon T. MAGE-B5, MAGE-B6, MAGE-C2, and MAGE-C3: four new members of the MAGE family with tumor-specific expression. Int J Cancer 87: 55–60, 2000.[CrossRef][Web of Science][Medline]
  40. Lucas S, De Smet C, Arden KC, Viars CS, Lethe B, Lurquin C, Boon T. Identification of a new MAGE gene with tumor-specific expression by representational difference analysis. Cancer Res 58: 743–752, 1998.[Abstract/Free Full Text]
  41. Lurquin C, De Smet C, Brasseur F, Muscatelli F, Martelange V, De Plaen E, Brasseur R, Monaco AP, Boon T. Two members of the human MAGEB gene family located in Xp21.3 are expressed in tumors of various histological origins. Genomics 46: 397–408, 1997.[CrossRef][Web of Science][Medline]
  42. Maruyama K, Usami M, Aizawa T, Yoshikawa K. A novel brain-specific mRNA encoding nuclear protein (necdin) expressed in neurally differentiated embryonal carcinoma cells. Biochem Biophys Res Commun 178: 291–296, 1991.[CrossRef][Web of Science][Medline]
  43. McKay SE, Garner A, Calderó J, Tucker RP, Large T, Oppenheim RW. The expression of trkB and p75 and the role of BDNF in the developing neuromuscular system of the chick embryo. Development 122: 715–724, 1996.[Abstract]
  44. Murciano A, Zamora J, López-Sánchez J, Frade JM. Interkinetic nuclear movement may provide spatial clues to the regulation of neurogenesis. Mol Cell Neurosci 21: 285–300, 2002.[CrossRef][Web of Science][Medline]
  45. Muscatelli F, Abrous DN, Massacrier A, Boccaccio I, Le Moal M, Cau P, Cremer H. Disruption of the mouse Necdin gene results in hypothalamic and behavioral alterations reminiscent of the human Prader-Willi syndrome. Hum Mol Genet 9: 3101–3110, 2000.[Abstract/Free Full Text]
  46. Niinobe M, Koyama K, Yoshikawa K. Cellular and subcellular localization of necdin in fetal and adult mouse brain. Dev Neurosci 22: 310–319, 2000.[CrossRef][Web of Science][Medline]
  47. Nishimura I, Shimizu S, Sakoda JY, Yoshikawa K. Expression of Drosophila MAGE gene encoding a necdin homologous protein in postembryonic neurogenesis. Gene Expr Patterns 7: 244–251, 2007.[CrossRef][Medline]
  48. Osterlund C, Tohonen V, Forslund KO, Nordqvist K. Mage-b4, a novel melanoma antigen (MAGE) gene specifically expressed during germ cell differentiation. Cancer Res 60: 1054–1061, 2000.[Abstract/Free Full Text]
  49. Podlesniy P, Kichev A, Pedraza C, Saurat J, Encinas M, Perez B, Ferrer I, Espinet C. Pro-NGF from Alzheimer's disease and normal human brain displays distinctive abilities to induce processing and nuclear translocation of intracellular domain of p75NTR and apoptosis. Am J Pathol 169: 119–131, 2006.[Abstract/Free Full Text]
  50. Pold M, Pold A, Ma HJ, Sjak-Shie NN, Vescio RA, Berenson JR. Cloning of the first invertebrate MAGE paralogue: an epitope that activates T-cells in humans is highly conserved in evolution. Dev Comp Immunol 24: 719–731, 2000.[CrossRef][Web of Science][Medline]
  51. Rapkins RW, Hore T, Smithwick M, Ager E, Pask AJ, Renfree MB, Kohn M, Hameister H, Nicholls RD, Deakin JE, Graves JAM. Recent assembly of an imprinted domain from non-imprinted components. PLoS Genet 2: e182, 2006.[CrossRef][Medline]
  52. Ren J, Lee S, Pagliardini S, Gerard M, Stewart CL, Greer JJ, Wevrick R. Absence of Ndn, encoding the Prader-Willi syndrome-deleted gene necdin, results in congenital deficiency of central respiratory drive in neonatal mice. J Neurosci 23: 1569–1573, 2003.[Abstract/Free Full Text]
  53. Salehi AH, Roux PP, Kubu CJ, Zeindler C, Bhakar A, Tannis LL, Verdi JM, Barker PA. NRAGE, a novel MAGE protein, interacts with the p75 neurotrophin receptor and facilitates nerve growth factor-dependent apoptosis. Neuron 27: 279–288, 2000.[CrossRef][Web of Science][Medline]
  54. Sasaki A, Hinck L, Watanabe K. RumMAGE-D the members: structure and function of a new adaptor family of MAGE-D proteins. J Recept Signal Transduct Res 25: 181–198, 2005.[CrossRef][Medline]
  55. Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD, Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF, Zeeberg B, Buetow KH, Schaefer CF, Bhat NK, Hopkins RF, Jordan H, Moore T, Max SI, Wang J, Hsieh F, Diatchenko L, Marusina K, Farmer AA, Rubin GM, Hong L, Stapleton M, Soares MB, Bonaldo MF, Casavant TL, Scheetz TE, Brownstein MJ, Usdin TB, Toshiyuki S, Carninci P, Prange C, Raha SS, Loquellano NA, Peters GJ, Abramson RD, Mullahy SJ, Bosak SA, McEwan PJ, McKernan KJ, Malek JA, Gunaratne PH, Richards S, Worley KC, Hale S, Garcia AM, Gay LJ, Hulyk SW, Villalon DK, Muzny DM, Sodergren EJ, Lu X, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madan A, Young AC, Shevchenko Y, Bouffard GG, Blakesley RW, Touchman JW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Krzywinski MI, Skalska U, Smailus DE, Schnerch A, Schein JE, Jones SJ, Marra MA. Generation and initial analysis of more than 15, 000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci USA 99: 16899–16903, 2002.[Abstract/Free Full Text]
  56. Taniura H, Taniguchi N, Hara M, Yoshikawa K. Necdin, a postmitotic neuron-specific growth suppressor, interacts with viral transforming proteins and cellular transcription factor E2F1. J Biol Chem 273: 720–728, 1998.[Abstract/Free Full Text]
  57. Tcherpakov M, Bronfman FC, Conticello SG, Vaskovsky A, Levy Z, Niinobe M, Yoshikawa K, Arenas E, Fainzilber M. The p75 neurotrophin receptor interacts with multiple MAGE proteins. J Biol Chem 277: 49101–49104, 2002.[Abstract/Free Full Text]
  58. Uetsuki T, Takagi K, Sugiura H, Yoshikawa K. Structure and expression of the mouse necdin gene. Identification of a postmitotic neuron-restrictive core promoter. J Biol Chem 271: 918–924, 1996.[Abstract/Free Full Text]
  59. Van der Bruggen P, Traversari C, Chomez P, Lurkin C, De Plaen E, Van den Eynde B, Knuth A, Boon T. A gene encoding an antigen recognized by cytolytic T lymphocytes on a human melanoma. Science 254: 1643–1647, 1991.[Abstract/Free Full Text]
  60. Von Bartheld CS, Heuer JG, Bothwell M. Expression of nerve growth factor (NGF) receptors in the brain and retina of chick embryos: comparison with cholinergic development. J Comp Neurol 310: 103–129, 1991.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
J. Neurosci.Home page
K. Hasegawa and K. Yoshikawa
Necdin Regulates p53 Acetylation via Sirtuin1 to Modulate DNA Damage Response in Cortical Neurons
J. Neurosci., August 27, 2008; 28(35): 8772 - 8784.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. M. Taylor, A. C. Copsey, J. J. R. Hudson, S. Vidot, and A. R. Lehmann
Identification of the Proteins, Including MAGEG1, That Make Up the Human SMC5-6 Protein Complex
Mol. Cell. Biol., February 15, 2008; 28(4): 1197 - 1206.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow All Versions of this Article:
30/2/156    most recent
00249.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by López-Sánchez, N.
Right arrow Articles by Frade, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by López-Sánchez, N.
Right arrow Articles by Frade, J. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.