|
|
||||||||
Departments of Internal Medicine and Physiology and Biophysics, University of Iowa College of Medicine, Iowa City, Iowa 52242
| ABSTRACT |
|---|
|
|
|---|
1,325 bp upstream of the classic promoter and encodes a new exon 1 (termed exon 1b) that splices directly to exon 2. The third isoform is lung specific and is due to transcriptional initiation 79 bp directly upstream of exon 2, fusing additional DNA within intron A (termed exon 1c) directly to exon 2 without splicing. Importantly, the alternative first exons observed in the PAC transgenic mice were identical to those used to transcribe renin in human fetal kidney, brain, and lung, suggesting these sites are bona fide isoforms of human renin mRNA and not artifacts of transgenesis. Moreover, the subtle differences in tissue-specific transcriptional initiation observed in the renin gene of rats and humans can be faithfully and accurately emulated in a transgenic model. transgenic mice; brain; gene expression; gene regulation; renin-angiotensin system
| INTRODUCTION |
|---|
|
|
|---|
To develop a model to study human REN (HREN) gene regulation in vivo, we used two independent P1 phage artificial chromosomes (PACs), one 140 kb and one 160 kb, containing HREN to construct transgenic mice (16). We reported that transgene expression was totally restricted to the kidney in lines of mice exhibiting physiological levels of HREN mRNA. Expression of HREN mRNA in the kidney of these mice was proportional to copy number. Within the kidney, HREN expression was restricted to the same subset of JG cells that also expressed endogenous mouse REN (MREN). Importantly, the changes in HREN mRNA in response to all physiological stimuli tested were identical to the changes observed in endogenous MREN expression, strongly supporting that these mice are an ideal model system for studying HREN gene regulation. Only in mice containing a high number of transgene copies and expressing very high levels of renal HREN mRNA did we observe HREN expression in the lung and brain.
The identification of novel tissue-specific transcriptional start sites within intron A, active in adrenal gland and brain, and driving the synthesis of a nonsecreted or intracellular form of active renin was recently reported (3, 13). In the rat brain, an alternative promoter within intron A transcribed a new first exon (termed exon 1b), which then spliced to exon 2 (13). The production of the intracellular form of the protein is due to the presence of an in-frame translation initiation codon in exon 2 that generates a protein lacking the signal peptide and 15 of 43 residues encompassing the pro-peptide. Isoforms of the alternative transcript were also reported to exist in mouse and human brain (13).
Herein, we report the finding that transcription of HREN in transgenic mice containing large PAC clones centered on the HREN gene exhibits a similar pattern of tissue-specific alternative transcription initiation within the brain. Furthermore, we demonstrate the existence of a third alternative HREN transcription start site utilized in the lung. Both the brain-specific and lung-specific transcription initiation sites were observed in human fetal tissue, suggesting that the intracellular form of renin may be important during development or play a role in intracellular generation of ANG II in the adult.
| METHODS |
|---|
|
|
|---|
For developmental studies, male PAC140 6680/2 transgenic mice were mated to female C57BL/6 mice. Copulation was confirmed by the presence of a vaginal plug. Plugged females were moved to their own cage, and appropriate weight gain was confirmed. Fetuses were collected at days ranging from 15.5 to 18.5 days postcoitus (pc). In addition, kidneys from newborns (<5 h old), 5-day-old postpartum (pp), and 10-day pp were collected. Fetuses were genotyped by PCR from placental DNA, and newborns were genotyped by PCR from tail DNA as previously described (15).
RNase protection assay.
HREN and MREN mRNA levels were determined with an RNase protection assay (RPA) utilizing a Hyb-Speed RPA kit (Ambion) as previously described (16). Tissue RNAs were purified using TriReagent (Molecular Research Center) and the manufacturers protocol. HREN probe Ex1a and MREN probes were partial cDNA sequences cloned into pCR2.1 (Invitrogen) and pGEM-4 (Promega), respectively. Both the 18S and mouse ß-actin probe templates are commercially available (Ambion). HREN probe Ex1c was amplified by 5'-RACE (see below) followed by ligation into pCR2.1. HREN probe Ex1b was derived from first sequencing the 5'-RACE product, generating an oligonucleotide encoding the sequence upstream of exon 2 followed by ligation using a Sau3A restriction site present as the first four nucleotides of exon 2. For both clones, subsequent subcloning into pBluescript SK- was necessary to obtain the desired antisense orientation relative to the T7 promoter. All clones were verified by sequencing.
Rapid amplification of cDNA ends.
Human renin exon 1b and exon 1c were cloned using a SMART RACE cDNA Amplification kit (Clontech) using the protocol, oligonucleotides, and reagents obtained from the manufacturer. Whole RNAs were purified from kidney, lung, and brain of a PAC160 line 7217/2 transgenic mouse and acted as templates for the 5'-RACE reaction. The gene-specific primer (GSP), which hybridizes to a region of HREN exon 3, was as follows: 5'-GGTCTGGGGTGGGGTGCCG-3'.
Reverse transcriptase polymerase chain reaction.
RT-PCR reactions of human fetal RNAs were conducted as previously described (5). Human fetal lung, brain, and kidney polyA RNAs were obtained from Clontech. The specification sheets accompanying the human fetal RNAs indicate that the RNAs were pooled from varying stages of development. The ranges for the lung, brain, and kidney mRNAs were 2025 wk, 1632 wk, and 1632 wk, respectively. The GSP (see above) was used as the downstream primer for PCR amplification for all three isoforms. Upstream primers for the PCR analysis of exon 1a, exon 1b, and exon 1c were GCTTGGCATGGATCAATTCC, ACCACACAACAGCAAG, and GGCCTCAGGGACTCC, respectively. The expected size of the amplification products for exon 1a, exon 1b, and exon 1c were 307 bp, 215 bp, and 271 bp, respectively.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
|
To demonstrate the authenticity of the 5'-RACE products, RPA probes were generated to distinguish between the three isoforms (Table 1). RPAs of RNAs isolated from lung, heart, kidney, intestine, brain, and liver from an adult PAC160 line 7217/2 animal were performed with the exon 1-specific probes (Fig. 6). In this assay, the exon-specific transcripts protect a 300-, 175-, or 278-nucleotide product, whereas transcripts not using the specific exon present in the probe only protect the region encompassing exon 2, resulting in truncated protection products of 194, 127, and 194 nucleotides for exon 1a, 1b, and 1c, respectively. Using the exon 1a probe, we see mainly full-length product (exon 1a) in kidney and to a much lesser extent in the brain. Truncated product was observed in lung, kidney, and brain. Using an exon 1b-specific probe results in a full-length product only in the brain, with truncated products in the lung, brain and kidney. Using an exon 1c-specific probe, we observed full-length product in the lung with trace amounts of full-length product in the kidney and brain. These data suggest that the kidney primarily utilizes exon 1a, although traces of exon 1c are observable, the lung primarily uses exon 1c, and the brain uses primarily exon 1b, although traces of exons 1a and 1c were detected.
|
|
| DISCUSSION |
|---|
|
|
|---|
Identification of alternative transcription initiation sites.
In the pursuit of characterizing the developmental expression pattern of HREN in our transgenic model, we were interested to find the utilization of an alternate transcription start site and first exon within the lung and brain. In lung, transcription was initiated within intron A, generating a fusion between sequences at the 3' end of intron A with exon 2, making this chimeric exon the first one transcribed in the lung. The closest potential TATA-box sequence is located
80 bp upstream of exon 1c, but whether this site is utilized remains to be determined. Immunohistochemical studies have revealed that renin is normally expressed in the mesenchyme of the human fetal lung (21). In addition, HREN is expressed in diverse tumor types derived from the lung and in Calu-6 cells derived from a pulmonary carcinoma (11, 22). Moreover, we demonstrated that HREN mRNA in human fetal lung utilized the same chimeric exon 1c/exon 2 as detected in our transgenic model. Therefore, like brain, the lung may have the capacity to synthesize an altered form of the renin protein lacking a secretory peptide and a portion of the pro-segment (discussed below).
5'-RACE of HREN mRNA derived from the brain of our PAC transgenic mice revealed a sequence highly homologous to the exon 1b sequence previously reported by Lee-Kirsch et al. (13), although without the 5' extension observed in their sequence. Nevertheless, the reproducible finding by two different groups using different models, along with our replication of the use of exon 1b in RNA derived from human fetal brain, strongly suggests this is not an experimental artifact. Although we sequenced the entire first intron of the HREN gene, we were puzzled by our inability to identify a homologous sequence within the intron. Interestingly, an additional hint that exon 1b was not located in intron A was obtained from a study of a different transgenic mouse model containing a genomic segment of HREN but including only 149 bp of 5' flanking DNA (18). Because of the use of only a minimal promoter, HREN expression in this model is essentially permissive in all tissues. HREN mRNA was observed in lung, and competitive PCR analysis revealed the utilization of both exon 1a and 1c, but not 1b (data not shown). Since this construct contains intron A, we would have expected the identification of exon 1b in this sample were it contained within the intron. This independent data strongly suggests that exon 1b may lie in a region of HREN DNA not included in the genomic construct containing only 149 bp of 5' flanking DNA. An analysis of 5' flanking DNA revealed a segment (at approximately -1300) with 90% homology to the sequence of exon 1b, but without recognizable TATA homologies in the vicinity.
It is also important to recognize that the utilization of a specific transcription initiation site was not all or none, since exon 1c-containing HREN mRNA was detected in kidney and exon 1a- and exon 1c-containing HREN mRNA was detected in brain (Fig. 6). The molecular mechanism regulating the choice of transcriptional start sites remains unclear and will require additional studies.
Potential physiological relevance.
Typically, translation of HREN begins in exon 1a, resulting in the initial production of preprorenin. The "pre" or signal peptide targets the protein to the secretory pathway and the "pro" peptide inactivates the zymogen until an activating cleavage event occurs during processing in dense core secretory granules in JG cells. An ATG codon 17 bp inside exon 2 is in frame with the rest of the protein, and previous studies reported evidence that an HREN mRNA utilizing exon 1b encodes a nonsecreted active form of HREN (13). Exon 1c does not contain an ATG and therefore would also likely utilize the same exon 2 translation start.
Development of the lung is unique in that cellular reorganization continues well after birth. Exactly how far into childhood alveolar and vascular development continues is not precisely known, but new alveolar formation may occur up to 8 yr of age in humans. It is tempting to speculate that a local nonsecreted form of renin may be required for increased local production of ANG II, which may be required for pulmonary angiogenesis. A role for ANG II as a growth and angiogenic factor has been proposed (1, 6, 12, 14). Production of renin in the brain has been a very controversial issue for years, as the low levels of renin mRNA has made its detection difficult. It is possible that the transgenic mice containing a high number of copies of the PAC construct may provide an opportunity to explore the cellular expression of HREN in the brain. As angiotensinogen is widely synthesized in astrocytes (20) and in some neurons in important cardiovascular control regions (24), it is tempting to speculate that local synthesis of renin provides a mechanism for local ANG II production within the blood-brain barrier. In fact the generation of an intracellular form of the protein is particularly interesting in light of our findings that neurons in the parabrachial nucleus express angiotensinogen mRNA and their nerve terminals, which project to the amygdala, contain ANG II immunoreactivity (24).
Finally, it is interesting to point out that the use of alternative first exons in development is not unique. Human insulin-like growth factor II (IGF-II) contains eight exons, three of which encode transcription start sites (19). Two of those are predominantly expressed in fetal tissues and have been found to be expressed in lung cells of mesenchymal origin. Fetal expression of IGFs is thought to be involved in cellular proliferation and growth. In addition, the Bax inhibitor-1 gene (BI-1) has been found to have the capacity to be encoded by two transcription start sites (10). Like HREN, the two TATA-less promoters generate unique first exons that splice into a common exon 2. The BI-1 distal promoter was found to be developmentally regulated in the prenatal lung, where it is upregulated in the later stages of development. The role of BI-1 in the fetal lung is unknown, but one hypothesis suggests a role in the regulation of apoptosis, which is especially important in eliminating mesenchyme cells from the perinatal lung.
In conclusion, our experimental results along with other recent reports describing the intriguing possibility for an intracellular renin-angiotensin pathway may provide a new paradigm for the function of the system that needs to be tested functionally (3, 13). We have initiated experiments to examine the significance of intracellular production of renin in the central nervous system.
| ACKNOWLEDGMENTS |
|---|
Funds in support of this work were obtained from the National Institutes of Health (Grants HL-55006, HL-48058, NS-24621, and DK-52617) and the American Heart Association. C. D. Sigmund was an Established Investigator of the American Heart Association. Transgenic mice were generated and maintained at the University of Iowa Transgenic Animal Facility, which is supported in part by the College of Medicine and the Diabetes and Endocrinology Research Center. DNA sequencing was performed at the University of Iowa DNA Core Facility.
| FOOTNOTES |
|---|
Address for reprint requests and other correspondence: C. D. Sigmund, Molecular Biology Interdisciplinary Program, Transgenic and Gene Targeting Facility, Dept. of Internal Medicine and Physiology and Biophysics, 2191 Medical Laboratory, The Univ. of Iowa College of Medicine, Iowa City, IA 52242 (E-mail: curt-sigmund{at}uiowa.edu).
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. H. Schefe, M. Menk, J. Reinemund, K. Effertz, R. M. Hobbs, P. P. Pandolfi, P. Ruiz, T. Unger, and H. Funke-Kaiser A Novel Signal Transduction Cascade Involving Direct Physical Interaction of the Renin/Prorenin Receptor With the Transcription Factor Promyelocytic Zinc Finger Protein Circ. Res., December 8, 2006; 99(12): 1355 - 1366. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhoux, D. R. Davis, and C. D. Sigmund The Human Renin Kidney Enhancer Is Required to Maintain Base-line Renin Expression but Is Dispensable for Tissue-specific, Cell-specific, and Regulated Expression J. Biol. Chem., November 17, 2006; 281(46): 35296 - 35304. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Dickson and C. D. Sigmund Genetic Basis of Hypertension: Revisiting Angiotensinogen Hypertension, July 1, 2006; 48(1): 14 - 20. [Full Text] [PDF] |
||||
![]() |
D. I. Diz Approaches to Establishing Angiotensin II as a Neurotransmitter Revisited Hypertension, March 1, 2006; 47(3): 334 - 336. [Full Text] [PDF] |
||||
![]() |
J. L. Lavoie, X. Liu, R. A. Bianco, T. G. Beltz, A. K. Johnson, and C. D. Sigmund Evidence Supporting a Functional Role for Intracellular Renin in the Brain Hypertension, March 1, 2006; 47(3): 461 - 466. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sherrod, D. R. Davis, X. Zhou, M. D. Cassell, and C. D. Sigmund Glial-specific ablation of angiotensinogen lowers arterial pressure in renin and angiotensinogen transgenic mice Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2005; 289(6): R1763 - R1769. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sherrod, X. Liu, X. Zhang, and C. D. Sigmund Nuclear localization of angiotensinogen in astrocytes Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2005; 288(2): R539 - R546. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Silver, A. C. Reid, C. J. Mackins, T. Askwith, U. Schaefer, D. Herzlinger, and R. Levi Mast cells: A unique source of renin PNAS, September 14, 2004; 101(37): 13607 - 13612. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Lavoie, K. D. Lake-Bruse, and C. D. Sigmund Increased blood pressure in transgenic mice expressing both human renin and angiotensinogen in the renal proximal tubule Am J Physiol Renal Physiol, May 1, 2004; 286(5): F965 - F971. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Lavoie, M. D. Cassell, K. W. Gross, and C. D. Sigmund Adjacent Expression of Renin and Angiotensinogen in the Rostral Ventrolateral Medulla Using a Dual-Reporter Transgenic Model Hypertension, May 1, 2004; 43(5): 1116 - 1119. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nistala, X. Zhang, and C. D. Sigmund Differential expression of the closely linked KISS1, REN, and FLJ10761 genes in transgenic mice Physiol Genomics, March 12, 2004; 17(1): 4 - 10. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Lavoie, M. D. Cassell, K. W. Gross, and C. D. Sigmund Localization of renin expressing cells in the brain, by use of a REN-eGFP transgenic model Physiol Genomics, January 15, 2004; 16(2): 240 - 246. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. N. Re Intracellular Renin and the Nature of Intracrine Enzymes Hypertension, August 1, 2003; 42(2): 117 - 122. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Lavoie and C. D. Sigmund Minireview: Overview of the Renin-Angiotensin System--An Endocrine and Paracrine System Endocrinology, June 1, 2003; 144(6): 2179 - 2183. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. N. Re Implications of intracrine hormone action for physiology and medicine Am J Physiol Heart Circ Physiol, March 1, 2003; 284(3): H751 - H757. [Full Text] [PDF] |
||||
![]() |
S. Morimoto, M. D. Cassell, and C. D. Sigmund Glia- and Neuron-specific Expression of the Renin-Angiotensin System in Brain Alters Blood Pressure, Water Intake, and Salt Preference J. Biol. Chem., August 30, 2002; 277(36): 33235 - 33241. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Seyedi, M. Koyama, C. J. Mackins, and R. Levi Ischemia Promotes Renin Activation and Angiotensin Formation in Sympathetic Nerve Terminals Isolated from the Human Heart: Contribution to Carrier-Mediated Norepinephrine Release J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 539 - 544. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Morimoto, M. D. Cassell, and C. D. Sigmund Neuron-specific expression of human angiotensinogen in brain causes increased salt appetite Physiol Genomics, May 10, 2002; 9(2): 113 - 120. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bader and D. Ganten It's Renin in the Brain: Transgenic Animals Elucidate the Brain Renin-Angiotensin System Circ. Res., January 11, 2002; 90(1): 8 - 10. [Full Text] [PDF] |
||||
![]() |
S. Morimoto, M. D. Cassell, and C. D. Sigmund The Brain Renin-Angiotensin System in Transgenic Mice Carrying a Highly Regulated Human Renin Transgene Circ. Res., January 11, 2002; 90(1): 80 - 86. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Morimoto, M. D. Cassell, T. G. Beltz, A. K. Johnson, R. L. Davisson, and C. D. Sigmund Elevated Blood Pressure in Transgenic Mice With Brain-Specific Expression of Human Angiotensinogen Driven by the Glial Fibrillary Acidic Protein Promoter Circ. Res., August 17, 2001; 89(4): 365 - 372. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP |