Physiol. Genomics Genetics/Genomics of Vascular Disease Workshop
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 3: 25-31, 2000;
1094-8341/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (40)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SINN, P. L.
Right arrow Articles by SIGMUND, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SINN, P. L.
Right arrow Articles by SIGMUND, C. D.
Received 31 January 2000; accepted in final form 12 May 2000.
Physiological Genomics 3:25-31 (2000)
1094-8341/00 $5.00 © 2000 American Physiological Society

Identification of three human renin mRNA isoforms from alternative tissue-specific transcriptional initiation

PATRICK L. SINN and CURT D. SIGMUND

Departments of Internal Medicine and Physiology and Biophysics, University of Iowa College of Medicine, Iowa City, Iowa 52242


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Sinn, Patrick L., and Curt D. Sigmund. Identification of three human renin mRNA isoforms from alternative tissue-specific transcriptional initiation. Physiol Genomics 3: 25–31, 2000.—We have reported that mice transgenic for 140- and 160-kb P1 phage artificial chromosomes (PACs) containing the human renin gene express the gene in a highly tissue-restricted and regulated manner. Herein, we demonstrate that the transgene is also expressed appropriately throughout development. In the course of this investigation, we identified the existence of three transcriptional isoforms of human renin mRNA derived from the utilization of alternative transcription start sites. The first isoform is the kidney-specific isoform, which utilizes the classic renin promoter. The second is a brain-specific isoform, which when previously identified in rats and mice was due to a transcription initiation site within intron A. However, the start site in the human gene resides ~1,325 bp upstream of the classic promoter and encodes a new exon 1 (termed exon 1b) that splices directly to exon 2. The third isoform is lung specific and is due to transcriptional initiation 79 bp directly upstream of exon 2, fusing additional DNA within intron A (termed exon 1c) directly to exon 2 without splicing. Importantly, the alternative first exons observed in the PAC transgenic mice were identical to those used to transcribe renin in human fetal kidney, brain, and lung, suggesting these sites are bona fide isoforms of human renin mRNA and not artifacts of transgenesis. Moreover, the subtle differences in tissue-specific transcriptional initiation observed in the renin gene of rats and humans can be faithfully and accurately emulated in a transgenic model.

transgenic mice; brain; gene expression; gene regulation; renin-angiotensin system


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
THE PRIMARY LOCATION of synthesis, storage, processing, and release of renin (REN) is the juxtaglomerular (JG) cells of the kidney (reviewed in Ref. 9). Classic dogma maintains that renin from the kidney is released into the systemic circulation, where it cleaves liver-derived angiotensinogen to produce angiotensin I (ANG I), which is further metabolized into blood-borne ANG II. Although JG cells are the primary site of REN production, several lines of evidence have suggested important roles for tissue-specific REN systems (4, 8). Historically, however, little attention has been devoted to extrarenal sites of REN production. Indeed, the mechanisms regulating REN expression at the molecular level in JG cells and extrarenal sites remain poorly understood.

To develop a model to study human REN (HREN) gene regulation in vivo, we used two independent P1 phage artificial chromosomes (PACs), one 140 kb and one 160 kb, containing HREN to construct transgenic mice (16). We reported that transgene expression was totally restricted to the kidney in lines of mice exhibiting physiological levels of HREN mRNA. Expression of HREN mRNA in the kidney of these mice was proportional to copy number. Within the kidney, HREN expression was restricted to the same subset of JG cells that also expressed endogenous mouse REN (MREN). Importantly, the changes in HREN mRNA in response to all physiological stimuli tested were identical to the changes observed in endogenous MREN expression, strongly supporting that these mice are an ideal model system for studying HREN gene regulation. Only in mice containing a high number of transgene copies and expressing very high levels of renal HREN mRNA did we observe HREN expression in the lung and brain.

The identification of novel tissue-specific transcriptional start sites within intron A, active in adrenal gland and brain, and driving the synthesis of a nonsecreted or intracellular form of active renin was recently reported (3, 13). In the rat brain, an alternative promoter within intron A transcribed a new first exon (termed exon 1b), which then spliced to exon 2 (13). The production of the intracellular form of the protein is due to the presence of an in-frame translation initiation codon in exon 2 that generates a protein lacking the signal peptide and 15 of 43 residues encompassing the pro-peptide. Isoforms of the alternative transcript were also reported to exist in mouse and human brain (13).

Herein, we report the finding that transcription of HREN in transgenic mice containing large PAC clones centered on the HREN gene exhibits a similar pattern of tissue-specific alternative transcription initiation within the brain. Furthermore, we demonstrate the existence of a third alternative HREN transcription start site utilized in the lung. Both the brain-specific and lung-specific transcription initiation sites were observed in human fetal tissue, suggesting that the intracellular form of renin may be important during development or play a role in intracellular generation of ANG II in the adult.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Transgenic mice and animal husbandry.
All experimental mice were fed standard mouse chow and water ad libitum and were killed by CO2 asphyxiation. Care of mice met or exceeded the standards set forth by the National Institutes of Health in the Guide for the Care and Use of Laboratory Animals. All procedures were approved by the University of Iowa Animal Care and Use Committee. Generation and characterization of PAC140 and PAC160 mice was as previously reported (16).

For developmental studies, male PAC140 6680/2 transgenic mice were mated to female C57BL/6 mice. Copulation was confirmed by the presence of a vaginal plug. Plugged females were moved to their own cage, and appropriate weight gain was confirmed. Fetuses were collected at days ranging from 15.5 to 18.5 days postcoitus (pc). In addition, kidneys from newborns (<5 h old), 5-day-old postpartum (pp), and 10-day pp were collected. Fetuses were genotyped by PCR from placental DNA, and newborns were genotyped by PCR from tail DNA as previously described (15).

RNase protection assay.
HREN and MREN mRNA levels were determined with an RNase protection assay (RPA) utilizing a Hyb-Speed RPA kit (Ambion) as previously described (16). Tissue RNAs were purified using TriReagent (Molecular Research Center) and the manufacturer’s protocol. HREN probe Ex1a and MREN probes were partial cDNA sequences cloned into pCR2.1 (Invitrogen) and pGEM-4 (Promega), respectively. Both the 18S and mouse ß-actin probe templates are commercially available (Ambion). HREN probe Ex1c was amplified by 5'-RACE (see below) followed by ligation into pCR2.1. HREN probe Ex1b was derived from first sequencing the 5'-RACE product, generating an oligonucleotide encoding the sequence upstream of exon 2 followed by ligation using a Sau3A restriction site present as the first four nucleotides of exon 2. For both clones, subsequent subcloning into pBluescript SK- was necessary to obtain the desired antisense orientation relative to the T7 promoter. All clones were verified by sequencing.

Rapid amplification of cDNA ends.
Human renin exon 1b and exon 1c were cloned using a SMART RACE cDNA Amplification kit (Clontech) using the protocol, oligonucleotides, and reagents obtained from the manufacturer. Whole RNAs were purified from kidney, lung, and brain of a PAC160 line 7217/2 transgenic mouse and acted as templates for the 5'-RACE reaction. The gene-specific primer (GSP), which hybridizes to a region of HREN exon 3, was as follows: 5'-GGTCTGGGGTGGGGTGCCG-3'.

Reverse transcriptase polymerase chain reaction.
RT-PCR reactions of human fetal RNAs were conducted as previously described (5). Human fetal lung, brain, and kidney polyA RNAs were obtained from Clontech. The specification sheets accompanying the human fetal RNAs indicate that the RNAs were pooled from varying stages of development. The ranges for the lung, brain, and kidney mRNAs were 20–25 wk, 16–32 wk, and 16–32 wk, respectively. The GSP (see above) was used as the downstream primer for PCR amplification for all three isoforms. Upstream primers for the PCR analysis of exon 1a, exon 1b, and exon 1c were GCTTGGCATGGATCAATTCC, ACCACACAACAGCAAG, and GGCCTCAGGGACTCC, respectively. The expected size of the amplification products for exon 1a, exon 1b, and exon 1c were 307 bp, 215 bp, and 271 bp, respectively.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Transgenic mice created with two PAC clones exhibit appropriate tissue-specific HREN expression and are restricted to the JG cells of the kidney (16). We wished to ascertain whether the transgene is appropriately regulated during fetal development. Male PAC140 line 6680/2 mice were mated to female C57BL/6J mice, and fetuses were removed at different days of gestation. Renal HREN mRNA first appeared at day 15.5 pc and peaked between days 17.5 and 18.5 pc. High-level expression of HREN lasted until at least 10 days pp but was still detectable in the adult (Fig. 1). This pattern of expression was quite similar to endogenous MREN mRNA, which first appeared at day 14.5 pc and also reached a peak by day 18.5 pc. Interestingly, both HREN and MREN are much more abundant in fetal and newborn kidneys than in the adult kidney.



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 1. Expression of kidney renin (REN) through development. Shown are RNase protection assays of renin at progressing days of development from day 13.5 pc to adult in PAC140 line 6680/2 transgenic mice. A: human renin (HREN; probe Ex1a) and 18S as a loading control. B: mouse renin (MREN) and actin as a loading control. NB, newborn; 5d, 5 days pp; 10d, 10 days pp; and A, adult. Sizes of the protected products are as follows: HREN, 300 nucleotides; 18S, 80 nucleotides; MREN, 326 nucleotides; ACT, 245 nucleotides. PAC, P1 artificial chromosome; pc, postcoitus; and pp, postpartum.

 
We also investigated developmental expression of the transgene in five other tissues: lung, heart, intestine, brain, and liver, in day 16.5 pc fetal mice, newborn mice, and in mice 5 and 10 days of age (Fig. 2). Expression was assayed by RNase protection using a probe (Ex1a) spanning the exon 1–2 junction, thus generating a 300-nucleotide protected product (Table 1). A 300-nucleotide product was produced in the kidney at all stages examined. In addition, however, we observed a 194-nucleotide protected product in the lung samples derived from fetal and postpartum mice. A much weaker 194-nucleotide product was also observed in kidney at all stages examined. The size of the protected product was consistent with hybridization to the exon 2 portion of the probe but likely reflected the use of a transcription start site other than that upstream of the classic exon 1. There was no evidence for MREN expression in the lung of either fetal or newborn mice (Fig. 3).



View larger version (115K):
[in this window]
[in a new window]
 
Fig. 2. Tissue distribution of human renin expression at different developmental stages. Shown is an RNase protection assay (HREN; probe Ex1a) of PAC140 line 6680/2 transgenic (+) and nontransgenic (-) day 16.5 pc fetuses, transgenic and nontransgenic newborn (NB) mice, 5-day pp (5 d), and a 10-day pp (10 d); 18S is shown as a loading control. Tissues are as follows: Lg, lung; H, heart; K, kidney; I, intestine; B, brain; and L, liver.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Sizes of protected RNase protection and PCR products

 


View larger version (102K):
[in this window]
[in a new window]
 
Fig. 3. Tissue distribution of MREN expression at different developmental stages. Shown is an RNase protection assay of multiple tissues from a day 16.5 pc fetus and a newborn (NB) mouse probed with a MREN-specific probe and actin (ACT) as a loading control. Tissues are as follows: Lg, lung; H, heart; K, kidney; I, intestine; B, brain; and L, liver.

 
We next wished to ascertain whether this observation was restricted to expression during fetal development or whether the use of an alternate first exon was also observed in adult mice. As expression of HREN in the lung was higher during development than in adults, we shifted our analysis to a PAC160 transgenic line 7217/2 containing a high number of transgene copies and exhibiting high-level HREN expression in kidney. It is in this line that HREN expression became detectable in the lung and brain (16). An abundant 300-nucleotide protected fragment was observed in kidney and placenta, whereas an abundant 194-nucleotide fragment was detected in lung and brain (Fig. 4). Lower level expression of the 300-nucleotide product was detected in the heart, spleen, ovary, adipose tissue, and brain; and low-level expression of the 194-nucleotide product was detected in kidney, adipose tissue and placenta.



View larger version (164K):
[in this window]
[in a new window]
 
Fig. 4. Tissue distribution of HREN mRNA in adult in a high-expressing transgenic line. RNase protection assay was performed using Ex1a probe on multiple tissues from a high-expressing PAC160 7217/2 line; 18S is shown as a loading control. Tissues are as follows: KL, left kidney; KR, right kidney; L, liver; H, heart; S, spleen; O, ovary; B, brain; Lg, lung; A, white adipose tissue; Sg, submandibular gland; and P, placenta.

 
Initially, we made the assumption that the HREN transcript in lung and brain used the identical alternative first exon previously termed exon 1b (13). 5'-RACE was performed to identify the transcription start site in these tissues. 5'-RACE of whole brain RNA purified from a PAC160 transgenic mouse resulted in the identification of a 27-bp segment that was identical in sequence to the terminal 27 bp of human exon 1b identified by Lee-Kirsch et al. (13) (Fig. 5C). On the contrary, our 5'-RACE product lacked the first 44 bp identified by them (Fig. 5C). Although the exon 1b sequences from rat and mouse clearly mapped to the first intron (intron A) of the rat and mouse renin genes, respectively, no significant homology to human exon 1b was identified within our sequence of the entire 4,030 bp of HREN intron A (GenBank accession no. AF213461). Instead, the 27-bp segment identified in our RACE reaction is 90% identical to a region in the 5' flanking region of the HREN gene located between -1294 and -1320 (accession no. L34162) (Fig. 5B). Interestingly, there was no significant homology between the additional 44 bp identified by Lee-Kirsch et al. (13) in a scan of the known HREN DNA.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. Sequence and alignment of 5'-RACE products. A: alignment of 5'-RACE product of HREN mRNA from lung and encoding exon 1c aligned with a segment of HREN intron A DNA (GenBank accession no. AF213461). B: alignment of 5'-RACE product of HREN mRNA from brain and encoding exon 1b aligned with a segment of HREN 5' flanking DNA. The bold bar labeled "I" in A and B reflects the internal in-frame ATG proposed to be used to translate renin when exon 1a is missing. C: alignment of exon 1b sequences from Lee-Kirsch et al. (13) and this study.

 
In contrast to the use of exon 1b in the brain, a unique transcription start site 78 bp 5' of exon 2 and lying within intron A was identified in the lung (Fig. 5A). Although this "chimeric exon" is the first exon transcribed in lung, we have termed this sequence exon 1c for the sake of clarity. The sequence of exon 1c was 100% identical to the terminal 78 bp of intron A (Fig. 5A).

To demonstrate the authenticity of the 5'-RACE products, RPA probes were generated to distinguish between the three isoforms (Table 1). RPAs of RNAs isolated from lung, heart, kidney, intestine, brain, and liver from an adult PAC160 line 7217/2 animal were performed with the exon 1-specific probes (Fig. 6). In this assay, the exon-specific transcripts protect a 300-, 175-, or 278-nucleotide product, whereas transcripts not using the specific exon present in the probe only protect the region encompassing exon 2, resulting in truncated protection products of 194, 127, and 194 nucleotides for exon 1a, 1b, and 1c, respectively. Using the exon 1a probe, we see mainly full-length product (exon 1a) in kidney and to a much lesser extent in the brain. Truncated product was observed in lung, kidney, and brain. Using an exon 1b-specific probe results in a full-length product only in the brain, with truncated products in the lung, brain and kidney. Using an exon 1c-specific probe, we observed full-length product in the lung with trace amounts of full-length product in the kidney and brain. These data suggest that the kidney primarily utilizes exon 1a, although traces of exon 1c are observable, the lung primarily uses exon 1c, and the brain uses primarily exon 1b, although traces of exons 1a and 1c were detected.



View larger version (126K):
[in this window]
[in a new window]
 
Fig. 6. Tissue distribution of exon 1a, exon 1b, and exon 1c utilization in an adult high-expressing HREN transgenic line. RNase protection assay was performed with all three exon-specific probes on the identical tissue RNAs from an adult PAC160 line 7217/2 transgenic mouse. Sizes of the protected fragments are as described in Table 1. Lg, lung; H, heart; K, kidney; I, intestine; B, brain; L, liver; and Y, yeast RNA.

 
To determine whether these results were a simple artifact of overexpression in a transgenic mouse model, commercially available human fetal kidney, lung, and brain poly-A RNAs were obtained. RPA detected the utilization of only exon 1a in kidney, but failed to detect renin expression in the brain or lung (Fig. 7A). RT-PCR was utilized to detect HREN mRNA in human fetal lung and brain (Fig. 7B). PCR of first-strand cDNAs obtained from these RNA samples were first subjected to separate PCR reactions using primer sets designed to amplify exon 1a (307 bp), exon 1b (241 bp), and exon 1c (278 bp) (Fig. 7B) and then were subjected to a competitive PCR reaction containing equal amounts of all three primer sets (Fig. 7C). In each case the downstream primer was identical and located within exon 3. The sequence of the competitive RT-PCR products confirmed the data obtained by 5'-RACE. Consistent with our previous observations in transgenic mice, the kidney preferred to utilize exon 1a, the brain preferred to utilize exon 1b, and the lung preferred to utilize exon 1c. The results clearly show a consistent pattern of alternative transcription site utilization in both transgenic mice expressing HREN and in bona fide human tissues.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 7. Exon 1a, exon 1b, and exon 1c utilization in human fetal tissues. A: RNase protection of human fetal tissue RNAs from kidney (K), brain (B), and lung (Lg) examined with the exon 1a- and 1c-specific probes. B: RT-PCR was performed separately with three primer sets designed to amplify all three HREN mRNA isoforms in human fetal kidney, brain, and lung. C: RT-PCR was performed competitively with all three primer sets designed to amplify all three HREN mRNA isoforms in human fetal kidney, brain, and lung. The identification of the specific isoform amplified is shown. Size markers are a 100-bp ladder.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
It has long been a challenge to discern the molecular mechanisms regulating HREN gene expression. This is because there has been a lack of ideal in vitro models with which to study human renin regulation, and therefore we have had to rely more heavily on transgenic models. Many previous models had experimental limitations because the mice exhibited ectopic HREN expression and poor regulation (2, 7, 23). In addition, it has not been possible to identify regulatory elements by simple fusion of the HREN promoter to a reporter gene (17). We created transgenic mice with 140 kb or 160 kb of human genomic DNA containing the HREN gene in an attempt to create an in vivo model of HREN expression that exhibited appropriate cell-type restricted expression and was highly regulated (16). HREN mRNA expression is restricted to the correct tissues and cells and is appropriately regulated in response to changes in dietary sodium, ANG II, and increased arterial pressure. We show herein that HREN expression is also appropriately regulated during fetal development.


Identification of alternative transcription initiation sites.
In the pursuit of characterizing the developmental expression pattern of HREN in our transgenic model, we were interested to find the utilization of an alternate transcription start site and first exon within the lung and brain. In lung, transcription was initiated within intron A, generating a fusion between sequences at the 3' end of intron A with exon 2, making this chimeric exon the first one transcribed in the lung. The closest potential TATA-box sequence is located ~80 bp upstream of exon 1c, but whether this site is utilized remains to be determined. Immunohistochemical studies have revealed that renin is normally expressed in the mesenchyme of the human fetal lung (21). In addition, HREN is expressed in diverse tumor types derived from the lung and in Calu-6 cells derived from a pulmonary carcinoma (11, 22). Moreover, we demonstrated that HREN mRNA in human fetal lung utilized the same chimeric exon 1c/exon 2 as detected in our transgenic model. Therefore, like brain, the lung may have the capacity to synthesize an altered form of the renin protein lacking a secretory peptide and a portion of the pro-segment (discussed below).

5'-RACE of HREN mRNA derived from the brain of our PAC transgenic mice revealed a sequence highly homologous to the exon 1b sequence previously reported by Lee-Kirsch et al. (13), although without the 5' extension observed in their sequence. Nevertheless, the reproducible finding by two different groups using different models, along with our replication of the use of exon 1b in RNA derived from human fetal brain, strongly suggests this is not an experimental artifact. Although we sequenced the entire first intron of the HREN gene, we were puzzled by our inability to identify a homologous sequence within the intron. Interestingly, an additional hint that exon 1b was not located in intron A was obtained from a study of a different transgenic mouse model containing a genomic segment of HREN but including only 149 bp of 5' flanking DNA (18). Because of the use of only a minimal promoter, HREN expression in this model is essentially permissive in all tissues. HREN mRNA was observed in lung, and competitive PCR analysis revealed the utilization of both exon 1a and 1c, but not 1b (data not shown). Since this construct contains intron A, we would have expected the identification of exon 1b in this sample were it contained within the intron. This independent data strongly suggests that exon 1b may lie in a region of HREN DNA not included in the genomic construct containing only 149 bp of 5' flanking DNA. An analysis of 5' flanking DNA revealed a segment (at approximately -1300) with 90% homology to the sequence of exon 1b, but without recognizable TATA homologies in the vicinity.

It is also important to recognize that the utilization of a specific transcription initiation site was not all or none, since exon 1c-containing HREN mRNA was detected in kidney and exon 1a- and exon 1c-containing HREN mRNA was detected in brain (Fig. 6). The molecular mechanism regulating the choice of transcriptional start sites remains unclear and will require additional studies.

Potential physiological relevance.
Typically, translation of HREN begins in exon 1a, resulting in the initial production of preprorenin. The "pre" or signal peptide targets the protein to the secretory pathway and the "pro" peptide inactivates the zymogen until an activating cleavage event occurs during processing in dense core secretory granules in JG cells. An ATG codon 17 bp inside exon 2 is in frame with the rest of the protein, and previous studies reported evidence that an HREN mRNA utilizing exon 1b encodes a nonsecreted active form of HREN (13). Exon 1c does not contain an ATG and therefore would also likely utilize the same exon 2 translation start.

Development of the lung is unique in that cellular reorganization continues well after birth. Exactly how far into childhood alveolar and vascular development continues is not precisely known, but new alveolar formation may occur up to 8 yr of age in humans. It is tempting to speculate that a local nonsecreted form of renin may be required for increased local production of ANG II, which may be required for pulmonary angiogenesis. A role for ANG II as a growth and angiogenic factor has been proposed (1, 6, 12, 14). Production of renin in the brain has been a very controversial issue for years, as the low levels of renin mRNA has made its detection difficult. It is possible that the transgenic mice containing a high number of copies of the PAC construct may provide an opportunity to explore the cellular expression of HREN in the brain. As angiotensinogen is widely synthesized in astrocytes (20) and in some neurons in important cardiovascular control regions (24), it is tempting to speculate that local synthesis of renin provides a mechanism for local ANG II production within the blood-brain barrier. In fact the generation of an intracellular form of the protein is particularly interesting in light of our findings that neurons in the parabrachial nucleus express angiotensinogen mRNA and their nerve terminals, which project to the amygdala, contain ANG II immunoreactivity (24).

Finally, it is interesting to point out that the use of alternative first exons in development is not unique. Human insulin-like growth factor II (IGF-II) contains eight exons, three of which encode transcription start sites (19). Two of those are predominantly expressed in fetal tissues and have been found to be expressed in lung cells of mesenchymal origin. Fetal expression of IGFs is thought to be involved in cellular proliferation and growth. In addition, the Bax inhibitor-1 gene (BI-1) has been found to have the capacity to be encoded by two transcription start sites (10). Like HREN, the two TATA-less promoters generate unique first exons that splice into a common exon 2. The BI-1 distal promoter was found to be developmentally regulated in the prenatal lung, where it is upregulated in the later stages of development. The role of BI-1 in the fetal lung is unknown, but one hypothesis suggests a role in the regulation of apoptosis, which is especially important in eliminating mesenchyme cells from the perinatal lung.

In conclusion, our experimental results along with other recent reports describing the intriguing possibility for an intracellular renin-angiotensin pathway may provide a new paradigm for the function of the system that needs to be tested functionally (3, 13). We have initiated experiments to examine the significance of intracellular production of renin in the central nervous system.


    ACKNOWLEDGMENTS
 
We acknowledge the outstanding technical assistance of Kelly Andringa, Patricia Lovell, Lucy Robbins, and Norma Sinclair, for generation and genotyping of PAC140 and PAC160 transgenic mice, and to Deborah Davis, for assistance with timed breedings.

Funds in support of this work were obtained from the National Institutes of Health (Grants HL-55006, HL-48058, NS-24621, and DK-52617) and the American Heart Association. C. D. Sigmund was an Established Investigator of the American Heart Association. Transgenic mice were generated and maintained at the University of Iowa Transgenic Animal Facility, which is supported in part by the College of Medicine and the Diabetes and Endocrinology Research Center. DNA sequencing was performed at the University of Iowa DNA Core Facility.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: C. D. Sigmund, Molecular Biology Interdisciplinary Program, Transgenic and Gene Targeting Facility, Dept. of Internal Medicine and Physiology and Biophysics, 2191 Medical Laboratory, The Univ. of Iowa College of Medicine, Iowa City, IA 52242 (E-mail: curt-sigmund{at}uiowa.edu).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Andrade SP, Cardoso CC, Machado RDP, and Beraldo WT. Angiotensin-II-induced angiogenesis in sponge implants in mice. Int J Microcirc Clin Exp 16: 302–307, 1996.[Web of Science][Medline]
  2. Bohlender J, Fukamizu A, Lippoldt A, Nomura T, Dietz R, Ménard J, Murakami K, Luft FC, and Ganten D. High human renin hypertension in transgenic rats. Hypertension 29: 428–434, 1997.[Abstract/Free Full Text]
  3. Clausmeyer S, Sturzebecher R, and Peters J. An alternative transcript of the rat renin gene can result in a truncated prorenin that is transported into adrenal mitochondria. Circ Res 84: 337–344, 1999.[Abstract/Free Full Text]
  4. Davisson RL, Ding Y, Stec DE, Catterall JF, and Sigmund CD. Novel mechanism of hypertension revealed by cell-specific targeting of human angiotensinogen in transgenic mice. Physiol Genomics 1: 3–9, 1999.[Abstract/Free Full Text]
  5. Davisson RL, Nuutinen N, Coleman ST, and Sigmund CD. Inappropriate splicing of a chimeric gene containing a large internal exon results in exon skipping in transgenic mice. Nucleic Acids Res 24: 4023–4028, 1996.[Abstract/Free Full Text]
  6. Fogo A, Yoshida Y, Yared A, and Ichikawa I. Importance of angiogenic action of angiotensin II in the glomerular growth of maturing kidneys. Kidney Int 38: 1068–1074, 1990.[Web of Science][Medline]
  7. Fukamizu A, Takimoto E, Sugimura K, Hatae T, Seo MS, Takahashi S, Sugiyama F, Kajiwara N, Yagami K, and Murakami K. Dependence of angiotensin production in transgenic mice carrying either the human renin or human angiotensinogen genes on species-specific kinetics of the renin-angiotensin system. Arzneim Forsch 43: 222–225, 1993.[Medline]
  8. Gyurko R, Wielbo D, and Phillips MI. Antisense inhibition of AT1 receptor mRNA and angiotensinogen mRNA in the brain of spontaneously hypertensive rats reduces hypertension of neurogenic origin. Regul Pept 49: 167–174, 1993.[Web of Science][Medline]
  9. Hackenthal E, Paul M, Ganten D, and Taugner R. Morphology, physiology, and molecular biology of renin secretion. Physiol Rev 70: 1067–1116, 1990.[Free Full Text]
  10. Jean JC, Oakes SM, and Joyce-Brady M. The Bax inhibitor-1 gene is differentially regulated in adult testis and developing lung by two alternative TATA-less promoters. Genomics 57: 201–208, 1999.[Web of Science][Medline]
  11. Lang JA, Yang G, Kern JA, and Sigmund CD. Endogenous human renin expression and promoter activity in a pulmonary carcinoma cell line (Calu-6). Hypertension 25: 704–710, 1995.[Abstract/Free Full Text]
  12. Le Noble FAC, Schreurs NHJS, Van Straaten HWM, Slaaf DW, Smits JFM, Rogg H, and Struijker-Boudier HAJ. Evidence for a novel angiotensin II receptor involved in angiogenesis in chick embryo chorioallantoic membrane. Am J Physiol Regulatory Integrative Comp Physiol 264: R460–R465, 1993.[Abstract/Free Full Text]
  13. Lee-Kirsch MA, Gaudet F, Cardoso MC, and Lindpaintner K. Distinct renin isoforms generated by tissue-specific transcription initiation and alternative splicing. Circ Res 84: 240–246, 1999.[Abstract/Free Full Text]
  14. Otani A, Takagi H, Suzuma K, and Honda Y. Angiotensin II potentiates vascular endothelial growth factor-induced angiogenic activity in retinal microcapillary endothelial cells. Circ Res 82: 619–628, 1998.[Abstract/Free Full Text]
  15. Sigmund CD. Expression of the human renin gene in transgenic mice throughout ontogeny. Pediatr Nephrol 7: 639–645, 1993.[Web of Science][Medline]
  16. Sinn PL, Davis DR, and Sigmund CD. Highly regulated cell-type restricted expression of human renin in mice containing 140 Kb or 160 Kb P1 phage artificial chromosome transgenes. J Biol Chem 274: 35785–35793, 1999.[Abstract/Free Full Text]
  17. Sinn PL and Sigmund CD. Transgenic models as tools for studying the regulation of human renin expression. Regul Pept 86: 77–82, 2000.[Web of Science][Medline]
  18. Sinn PL, Zhang X, and Sigmund CD. Juxtaglomerular cell expression and partial regulation of a human renin genomic transgene driven by a minimal renin promoter. Am J Physiol Renal Physiol 277: F634–F642, 1999.[Abstract/Free Full Text]
  19. Stiles AD and D’Ercole AJ. The insulin-like growth factors and the lung. Am J Respir Cell Mol Biol 3: 93–100, 1990.
  20. Stornetta RL, Hawelu Johnson CL, Guyenet PG, and Lynch KR. Astrocytes synthesize angiotensinogen in brain. Science 242: 1444–1446, 1988.[Abstract/Free Full Text]
  21. Taylor GM, Cook HT, Hanson C, Peart WS, Zondek T, and Zondek LH. Renin in human fetal lung: a biochemical and immunohistochemical study. J Hypertens 6: 845–851, 1988.[Web of Science][Medline]
  22. Taylor GM, Cook HT, Sheffield EA, Hanson C, and Peart WS. Renin in blood vessels in human pulmonary tumors: an immunohistochemical and biochemical study. Am J Pathol 130: 543–551, 1988.[Abstract]
  23. Thompson MW, Smith SB, and Sigmund CD. Regulation of human renin mRNA expression and protein release in transgenic mice. Hypertension 28: 290–296, 1996.[Abstract/Free Full Text]
  24. Yang G, Gray TS, Sigmund CD, and Cassell MD. The angiotensinogen gene is expressed in both astrocytes and neurons in murine central nervous system. Brain Res 817: 123–131, 1999.[Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
X. Zhou, E. T. Weatherford, X. Liu, E. Born, H. L. Keen, and C. D. Sigmund
Dysregulated human renin expression in transgenic mice carrying truncated genomic constructs: evidence supporting the presence of insulators at the renin locus
Am J Physiol Renal Physiol, September 1, 2008; 295(3): F642 - F653.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
J. L. Grobe, D. Xu, and C. D. Sigmund
An Intracellular Renin-Angiotensin System in Neurons: Fact, Hypothesis, or Fantasy
Physiology, August 1, 2008; 23(4): 187 - 193.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. H. Schefe, M. Menk, J. Reinemund, K. Effertz, R. M. Hobbs, P. P. Pandolfi, P. Ruiz, T. Unger, and H. Funke-Kaiser
A Novel Signal Transduction Cascade Involving Direct Physical Interaction of the Renin/Prorenin Receptor With the Transcription Factor Promyelocytic Zinc Finger Protein
Circ. Res., December 8, 2006; 99(12): 1355 - 1366.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Zhoux, D. R. Davis, and C. D. Sigmund
The Human Renin Kidney Enhancer Is Required to Maintain Base-line Renin Expression but Is Dispensable for Tissue-specific, Cell-specific, and Regulated Expression
J. Biol. Chem., November 17, 2006; 281(46): 35296 - 35304.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. E. Dickson and C. D. Sigmund
Genetic Basis of Hypertension: Revisiting Angiotensinogen
Hypertension, July 1, 2006; 48(1): 14 - 20.
[Full Text] [PDF]


Home page
HypertensionHome page
D. I. Diz
Approaches to Establishing Angiotensin II as a Neurotransmitter Revisited
Hypertension, March 1, 2006; 47(3): 334 - 336.
[Full Text] [PDF]


Home page
HypertensionHome page
J. L. Lavoie, X. Liu, R. A. Bianco, T. G. Beltz, A. K. Johnson, and C. D. Sigmund
Evidence Supporting a Functional Role for Intracellular Renin in the Brain
Hypertension, March 1, 2006; 47(3): 461 - 466.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Sherrod, D. R. Davis, X. Zhou, M. D. Cassell, and C. D. Sigmund
Glial-specific ablation of angiotensinogen lowers arterial pressure in renin and angiotensinogen transgenic mice
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2005; 289(6): R1763 - R1769.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Sherrod, X. Liu, X. Zhang, and C. D. Sigmund
Nuclear localization of angiotensinogen in astrocytes
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2005; 288(2): R539 - R546.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. B. Silver, A. C. Reid, C. J. Mackins, T. Askwith, U. Schaefer, D. Herzlinger, and R. Levi
Mast cells: A unique source of renin
PNAS, September 14, 2004; 101(37): 13607 - 13612.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. L. Lavoie, K. D. Lake-Bruse, and C. D. Sigmund
Increased blood pressure in transgenic mice expressing both human renin and angiotensinogen in the renal proximal tubule
Am J Physiol Renal Physiol, May 1, 2004; 286(5): F965 - F971.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. L. Lavoie, M. D. Cassell, K. W. Gross, and C. D. Sigmund
Adjacent Expression of Renin and Angiotensinogen in the Rostral Ventrolateral Medulla Using a Dual-Reporter Transgenic Model
Hypertension, May 1, 2004; 43(5): 1116 - 1119.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
R. Nistala, X. Zhang, and C. D. Sigmund
Differential expression of the closely linked KISS1, REN, and FLJ10761 genes in transgenic mice
Physiol Genomics, March 12, 2004; 17(1): 4 - 10.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J. L. Lavoie, M. D. Cassell, K. W. Gross, and C. D. Sigmund
Localization of renin expressing cells in the brain, by use of a REN-eGFP transgenic model
Physiol Genomics, January 15, 2004; 16(2): 240 - 246.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
R. N. Re
Intracellular Renin and the Nature of Intracrine Enzymes
Hypertension, August 1, 2003; 42(2): 117 - 122.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. L. Lavoie and C. D. Sigmund
Minireview: Overview of the Renin-Angiotensin System--An Endocrine and Paracrine System
Endocrinology, June 1, 2003; 144(6): 2179 - 2183.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. N. Re
Implications of intracrine hormone action for physiology and medicine
Am J Physiol Heart Circ Physiol, March 1, 2003; 284(3): H751 - H757.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Morimoto, M. D. Cassell, and C. D. Sigmund
Glia- and Neuron-specific Expression of the Renin-Angiotensin System in Brain Alters Blood Pressure, Water Intake, and Salt Preference
J. Biol. Chem., August 30, 2002; 277(36): 33235 - 33241.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
N. Seyedi, M. Koyama, C. J. Mackins, and R. Levi
Ischemia Promotes Renin Activation and Angiotensin Formation in Sympathetic Nerve Terminals Isolated from the Human Heart: Contribution to Carrier-Mediated Norepinephrine Release
J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 539 - 544.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
S. Morimoto, M. D. Cassell, and C. D. Sigmund
Neuron-specific expression of human angiotensinogen in brain causes increased salt appetite
Physiol Genomics, May 10, 2002; 9(2): 113 - 120.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Bader and D. Ganten
It's Renin in the Brain: Transgenic Animals Elucidate the Brain Renin-Angiotensin System
Circ. Res., January 11, 2002; 90(1): 8 - 10.
[Full Text] [PDF]


Home page
Circ. Res.Home page
S. Morimoto, M. D. Cassell, and C. D. Sigmund
The Brain Renin-Angiotensin System in Transgenic Mice Carrying a Highly Regulated Human Renin Transgene
Circ. Res., January 11, 2002; 90(1): 80 - 86.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Morimoto, M. D. Cassell, T. G. Beltz, A. K. Johnson, R. L. Davisson, and C. D. Sigmund
Elevated Blood Pressure in Transgenic Mice With Brain-Specific Expression of Human Angiotensinogen Driven by the Glial Fibrillary Acidic Protein Promoter
Circ. Res., August 17, 2001; 89(4): 365 - 372.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (40)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SINN, P. L.
Right arrow Articles by SIGMUND, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SINN, P. L.
Right arrow Articles by SIGMUND, C. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online