Physiol. Genomics Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 26: 8-14, 2006. First published February 28, 2006; doi:10.1152/physiolgenomics.00155.2005
1094-8341/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
26/1/8    most recent
00155.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mezei, O.
Right arrow Articles by Shay, N. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mezei, O.
Right arrow Articles by Shay, N. F.
Received 30 June 2005; accepted in final form 22 February 2006.
Physiological Genomics 26:8-14 (2006)
1094-8341/06 $8.00 © 2006 American Physiological Society

Translational Physiology

Dietary isoflavone supplementation modulates lipid metabolism via PPAR{alpha}-dependent and -independent mechanisms

Orsolya Mezei , Yilan Li , Eimear Mullen , Jennifer S. Ross-Viola and Neil F. Shay

Department of Biological Sciences, University of Notre Dame, Notre Dame, Indiana


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Intake of soy protein has been associated with improvements in lipid metabolism, with much attention being focused on the serum cholesterol-lowering property of soy. The component or components of soy that are responsible for improvements in lipid metabolism have been investigated and their specific actions debated. One component, the isoflavones, has been shown to have weak estrogenic activity, and recently, several research groups have suggested that isoflavones are activating peroxisome proliferator-activated receptors (PPARs). The three different isoforms of PPARs ({alpha}, {gamma}, and {delta}) have overlapping tissue distributions and functions associated with lipid metabolism. The goal of the present study was to investigate the hypothesis that the effect of isoflavones is mediated through the PPAR{alpha} receptor. Male and female 129/Sv mice were obtained, including both wild-type and genetically altered PPAR{alpha} knockout mice. Groups of mice were fed high-fat atherogenic diets containing soy protein +/- isoflavones and PPAR{alpha} agonist fenofibrate for 6 wk. At the end of 6 wk, serum and tissue lipid levels were measured along with hepatic gene expression. Most notably, serum triglycerides were reduced by isoflavone consumption. Compared with intake of a low-isoflavone basal diet, isoflavone intake reduced serum triglyceride levels by 36 and 52% in female and male wild-type mice, respectively, compared with 55 and 52% in fenofibrate-treated mice. Isoflavones also improved serum triglyceride levels in knockout mice, whereas fenofibrate did not, suggesting that two different regulatory mechanisms may be affected by isoflavone intake. Isoflavone intake resembled action of fenofibrate on PPAR{alpha}-regulated gene expression, although less robustly compared with fenofibrate. We suggest that, at the levels consumed in this study, isoflavone intake is altering lipid metabolism in a manner consistent with activation of PPAR{alpha} and also via a PPAR{alpha}-independent mechanism as well.

peroxisome proliferator-activated receptor; triglycerides; cholesterol


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
THE INFLUENCE OF DIET ON BLOOD LIPID levels is well recognized. While consumption of high total fat or high saturated fat may be hypercholesterolemic, intake of mono- or polyunsaturated fats may contribute to reductions in serum lipid levels. Recent studies indicate that a portfolio diet, including components such as soy, nuts, fiber, and plant sterols, may be especially effective in providing cholesterol-reducing agents to humans (11). With respect to soy, a past meta-analysis suggested improvements in blood cholesterol levels related to soy intake, especially for hypercholesterolemic individuals (1). A more recent analysis assessing eight different randomized controlled trials using human subjects indicated that intake of isoflavones has LDL cholesterol-lowering effects independent of soy protein intake (30). The bioactivity of isoflavones is controversial and a subject of current debate: e.g., the recent study of Lichtenstein et al. (16) evaluated 42 human subjects and found no effect of isoflavone intake on plasma lipid levels. Other studies have demonstrated different results when intake of intact high isoflavone-containing soy protein was compared with intake of low isoflavone-containing soy supplemented with added isoflavones (5).

Dietary isoflavone supplementation results in detectable serum levels of isoflavones. Human tests have included single low-dose (50 mg) and high-dose studies including doses up to 16 mg isoflavone/kg body wt; maximal serum isoflavone concentrations ranged from 4 µmol/l (26) to ~10 µmol/l (2). In a long-term study, subjects consuming ~100 mg isoflavones/day for 10 wk had steady-state levels of plasma isoflavones >1 µmol/l (28).

Although consumption of high levels of isoflavones has been demonstrated to have estrogenic activity (23), recent evidence suggests that isoflavones along with other botanical compounds may be agonists or activators of the "promiscuous" nuclear receptors regulating cellular lipid metabolism, most notably the peroxisome proliferator activator receptors (4, 12, 13, 17, 24). Other dietary constituents shown to interact with these receptors include conjugated linoleic acids (20), resveratrol (10), and tocopherols (3). Results of in vitro studies demonstrate that the soy isoflavones, particularly genistein and daidzein, were able to activate both peroxisome proliferator-activated receptor (PPAR){alpha}- and PPAR{gamma}-mediated gene expression; in vivo studies demonstrated effects of isoflavone intake on physiological parameters such as glucose tolerance (17). Furthermore, the soy isoflavone genistein has been identified as a ligand of the PPAR{gamma} receptor (4). Gene profiling suggests that genistein is regulating gene expression through PPAR{alpha}, which acts to stimulate mitochondrial fatty acid oxidation (12). In the present study, both male and female mice were studied to determine whether the estrogen receptor and high circulating estrogen levels would be sufficient to produce changes in lipid levels associated with isoflavone consumption. Alternately, changes in lipid levels might be independent of sex, or there may be an interaction between sex and the presence of the PPAR{alpha} receptor.

In vivo studies indicate that isoflavone intake resembles actions of both PPAR{alpha} and PPAR{gamma} agonists, improving blood and hepatic triglyceride concentrations and glucose tolerance, respectively (17). The former are typically under the influence of the PPAR{alpha}, whereas the latter is typically improved by activation of PPAR{gamma} (6). In the present study, we provided diets containing high or low levels of dietary isoflavones with or without the PPAR{alpha} agonist fenofibrate to wild-type and genetically altered PPAR{alpha} knockout mice (15). The phenotype of PPAR{alpha} knockout mouse includes excessive weight gain, elevated blood and hepatic lipids, and male-specific liver lipid abnormalities (8). Fenofibrate, commercially known as Tricor (Abbott, Abbott Park, IL), is used primarily to treat hypertriglyceridemia refractive to other therapies. Our experimental design allowed us to evaluate contributions of isoflavone intake to lipid metabolism in mice with (+/+) and without (–/–) PPAR{alpha} regulation. The present study addresses the potential of isoflavones to act as triglyceride-lowering agents; if isoflavones have an in vivo action similar to fenofibrate, it would be expected that isoflavone intake should lower serum triglyceride levels and perhaps contribute secondarily to reductions in serum cholesterol levels.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals.
All animal protocols were approved in advance by the University of Notre Dame Institutional Animal Care Committee. Two homozygous PPAR{alpha} –/– mice breeder pairs from an 129S4/SvJae background were obtained (The Jackson Laboratory, Bar Harbor, ME) and produced offspring, used in this study. A total of 64 PPAR{alpha} –/– mice and 72 129S4/SvJae (referred to from this point simply as 129/Sv) wild-type mice were used for the study. All mice were housed under controlled temperature (22°C) and lighting (12:12-h light-dark cycle), and typically three to five mice were housed together in cages. PPAR{alpha} –/– mice had free access to water and diet (Purina no. 5015) after weaning until the animals were 11 wk of age. Control mice were received at 5 wk of age and had free access to water and the Purina diet until they were 11 wk of age.

Diets.
Once animals were 11 wk of age, male and female PPAR{alpha} –/– and +/+ mice were randomly assigned into one of four diet groups. All groups were fed the basal low-isoflavone soy protein diet for 1 wk as acclimation to the powdered experimental diets. These high-fat diets were isonitrogenous and utilized nonnutritive alphacel (cellulose) to balance diet ingredient content. At 12 wk of age, mice were switched to one of four experimental diets and consumed the diet for 6 consecutive wk; mice were weighed weekly. Diet composition is detailed in Table 1; all diets utilized soy as the source of protein. One diet contained negligible levels of isoflavones and is typically referred to as the low isoflavone-containing soy diet (S); one diet consisted of soy protein containing 1.82 g isoflavones (aglycone equivalent)/kg diet (S+I), one diet consisted of low-isoflavone soy protein plus 0.2% (wt/wt) PPAR{alpha} agonist fenofibrate (S+F), and one diet consisted of soy protein containing 1.82 g isoflavones/kg diet plus 0.2% fenofibrate (S+I+F). All other diet components were identical; isoflavone content was present as "intact" isoflavone naturally present in soy protein rather than isolated isoflavones mixed into diets as an additive (5). On the last day of the sixth week, mice were killed ~8 h into the light phase. Diet was withheld from mice for this 8-h period. Trunk blood was collected immediately and processed for serum isolation. Liver tissue and aortic tissue were collected and stored at –80°C. A portion of the liver tissue was also immediately used for total RNA isolation.


View this table:
[in this window]
[in a new window]
 
Table 1. Composition of Experimental diets

 
Serum isolation.
Blood samples collected were centrifuged at 1,000 g for 5 min. The translucent supernatant was collected as serum samples and stored at –80°C until further analysis.

RNA isolation.
Total RNA from liver was isolated by use of an RNeasy isolation kit, following the manufacturer’s protocol (Qiagen, Valencia, CA).

Gene expression.
A Northern analysis protocol was used for initial measurements of relative mRNA levels, following a protocol from our laboratory previously described in Ref. 18; during the latter portion of this project, the real-time PCR method was utilized to measure mRNA levels. For real-time PCR, 3 µg of hepatic total RNA from each mouse were used to make first-strand cDNA with Moloney murine leukemia virus (M-MLV) RT (Invitrogen), using random primers. Real-time PCR reactions were performed with 1 µl of cDNA using Sybr green PCR master mix (Applied Biosystems) in an ABI Prism 7700 (Applied Biosystems), following Ref. 14. The primers of mouse Cpt1{alpha} were obtained from Superarray (catalog no. PPM25930A; Frederick, MD), and the sequence of mouse 18S primers was forward 5'-AGTCCCTGCCCTTTGTACACA-3' and reverse 5'GATCCGAGGGCCTCACTAAAC3' (Superarray). Cycle threshold (Ct) was plotted as a standard curve for Cpt1{alpha} or 18S separately, and then Cpt1{alpha} expression was expressed as a ratio to 18S rRNA levels.

Neutral lipid extraction from liver and aorta.
A 100-mg piece of frozen tissue was immersed in 0.4 ml of chloroform-methanol (2:1, vol/vol), and samples were homogenized for 45 s each. Tissue homogenates were vortexed and stored at 4°C overnight. The next day, samples were filtered using no. 2 Whatman filter paper and brought up to 1 ml using chloroform-methanol (2:1, vol/vol); 0.25 ml of 0.5 mol/l NaCl was then added to all samples. All samples were vortexed twice for 15 s and centrifuged at 20,000 g at room temperature for 10 min. The upper aqueous phase was removed and discarded. The lower lipid-containing phase of each sample was mixed with 0.5 ml of 0.36 mol/l CaCl2-methanol (1:1, vol/vol). Samples were vortexed twice for 15 s and centrifuged at 20,000 g at room temperature for 10 min. Final lipid extracts were washed once more with 0.5 ml of 0.36 mol/l CaCl2-methanol (1:1), and lipid extracts were evacuated for 30 min until all liquid was evaporated and a dry pellet remained. The lipid pellet was resuspended for 1 h at 37°C in 1x PBS containing 1% bovine serum albumin. Samples were immediately analyzed for total cholesterol and triglyceride content.

Cholesterol and triglyceride assays.
Total cholesterol and triglyceride concentrations were measured in serum and liver and aortic tissues. Concentrations were measured by absorbance, following the manufacturer’s protocol, using commercially available colorimetric cholesterol and triglyceride reagents (Pointe Scientific, Lincoln Park, MI).

Statistical analysis.
Three-way ANOVA was utilized to assess the experimental factors (sex, genotype, and diet), using SigmaStat v3.1. The P value was set to 0.05, and data were considered statistically significant when P < 0.05. When a post hoc test was warranted, ANOVA was used to compare sets of data (e.g., Figs. 1Go3); for metabolic data, pairs of data for +/+ and –/– groups were compared, and a t-test was used for the post hoc test (Table 2).


Figure 1
View larger version (14K):
[in this window]
[in a new window]
 
Fig. 1. Serum triglyceride levels in female peroxisome proliferator-activated receptor (PPAR){alpha} +/+ and –/– 129S4/SvJae (129/Sv) mice fed either an isoflavone-stripped soy protein diet (S), an isoflavone-containing soy protein diet (S+I), an isoflavone-stripped soy protein diet with 0.2% (wt/wt) fenofibrate (S+F), or an isoflavone-containing soy protein diet with 0.2% (wt/wt) fenofibrate (S+I+F). Values are means ± SE; n = 8–9. Values that do not share a letter differ (P < 0.05).

 

Figure 2
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2. Serum triglyceride levels in male PPAR{alpha} +/+ and –/– 129/Sv mice fed either an S, S+I, S+F, or S+I+F diet (for diet group details, see legend to Fig. 1). Values are means ± SE; n = 6–9. Values that do not share a letter differ (P < 0.05).

 

Figure 3
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3. Hepatic carnitine palmitoyl transferase-1{alpha} (CPT1{alpha}) mRNA-to-18S rRNA ratios in PPAR{alpha} +/+ and –/– mice fed either an S, S+I, S+F, or S+I+F diet (for diet group details, see legend to Fig. 1). WT, wild type; KO, knockout. Values are means ± SE; n = 6–9. Values that do not share a letter differ (P < 0.05).

 

View this table:
[in this window]
[in a new window]
 
Table 2. Body weights, percent body weight change, and liver weight in female and male PPAR{alpha} +/+ and –/– mice

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Body weight, liver weight, and lipid content of liver and aorta in PPAR{alpha} –/– and +/+ mice fed atherogenic soy protein diets containing different levels of isoflavones and fenofibrate.
The specific diet consumed impacted weight gain during the 6-wk study. Consumption of a fenofibrate-containing diet (S+F or S+I+F) in +/+ mice with functional PPAR{alpha} receptors was associated with a decrease in body weight during the 6-wk study (P < 0.05). All +/+ mice consuming fenofibrate-free diets gained weight during the study. Regardless of the diet consumed, all –/– mice gained weight during the study (Table 2).

Peroxisome proliferators such as fenofibrate are known to cause hepatomegaly in mice, and this was demonstrated in this study, as fenofibrate-fed male and female +/+ mice showed increased relative liver weight (Table 2). As expected, absence of the PPAR{alpha} receptor in –/– mice eliminated fenofibrate-induced hepatomegaly. Hepatic triglyceride levels were significantly reduced by the presence of PPAR{alpha} within each sex (P < 0.05). The absence of PPAR{alpha} caused the liver triglyceride levels to be significantly elevated in every diet group regardless of sex (P < 0.05). Female +/+ mice fed the S+F or S+I+F diet had significantly reduced (P < 0.05) liver triglyceride levels compared with groups fed the S or S+I diet (e.g., 1.8 and 2.4 vs. 9.5 and 11.8 mg triglyceride/g liver, respectively; P < 0.05, Table 3). However, hepatic triglyceride content in experimental groups of PPAR{alpha} –/– mice were not significantly different from levels measured in the control diet-fed (S) mice (e.g., 45.0, 20.1, and 42.8 vs. 27.7 mg triglyceride/g liver; Table 3). The S+I- and S+I+F-fed groups of –/– mice did have significantly higher hepatic triglyceride content compared with the S+F-fed group (45.0 and 42.8, respectively, vs. 20.1 mg triglyceride/g liver; Table 3), indicating that isoflavones may be hypertriglyceridemic in the liver when PPAR{alpha} is not present. Similar to the female mice, +/+ male mice fed the S+F or S+I+F diet had significantly (P < 0.05) decreased liver triglyceride levels compared with the S or S+I group (1.9 and 2.8 vs. 3.1 and 7.2 mg triglyceride/g liver, respectively; P < 0.05, Table 3). Generally, levels of triglycerides measured in aorta followed the same trends as observed for hepatic triglycerides.


View this table:
[in this window]
[in a new window]
 
Table 3. Tissue and serum TG and cholesterol in female and male PPAR{alpha} +/+ and +/– mice

 
There were significant differences in hepatic total cholesterol between diet groups and the presence of PPAR{alpha} in female and male mice. As discussed above, for triglycerides, the presence of PPAR{alpha} always corresponded to lower hepatic cholesterol content. Generally, there were not significant differences observed for aortic cholesterol content in +/+ vs. –/– mice.

Serum total triglycerides in PPAR{alpha} –/– and +/+ mice fed atherogenic soy protein diets with different levels of isoflavones and fenofibrate.
Analysis of serum triglyceride levels indicated significant differences between diet groups and the presence of PPAR{alpha} in female and male mice (Table 3 and Figs. 1 and 2; P < 0.05). Female +/+ mice fed the S+F or S+I+F diet had significantly decreased serum triglyceride levels compared with the S or S+I group (e.g., 42.0 and 36.7 vs. 93.1 and 59.3 mg/dl, respectively; P < 0.05), confirming the potent hallmark effect of PPAR{alpha} agonists such as fenofibrate on circulating triglyceride levels. However, in +/+ females, the S+I group also had significantly decreased levels of serum triglycerides compared with the S group (59.3 vs. 93.1 mg/dl, respectively; P < 0.05), indicating that intake of soy isoflavones is hypotriglyceridemic in serum of +/+ female mice. In –/– females, the S+I group had significantly lower (P < 0.05) serum triglyceride levels compared with the S or S+F group (123.6 vs. 245.6 and 272.9 mg/dl, respectively; P < 0.05), indicating that one action of isoflavone intake is distinct from fenofibrate and can reduce serum triglyceride level independently of PPAR{alpha}. Furthermore, when comparing female +/+ and –/– mice fed isoflavones (S+I), there was also an effect specific to PPAR{alpha}: serum triglyceride levels were 59.3 mg/dl in +/+ mice and 123.6 mg/dl in –/– mice (P < 0.05); thus isoflavone action is consistent with PPAR{alpha} agonist action, reducing serum triglyceride levels in the presence of PPAR{alpha} (Table 2 and Fig. 1). In females, the effect of dietary isoflavone intake was slightly less potent than that of fenofibrate, decreasing serum triglycerides by 36% compared with a 55% reduction observed in fenofibrate-fed mice.

Male +/+ mice fed the S+I, S+F, or S+I+F diet also had significantly decreased serum triglyceride levels compared with the S-fed group (53.7, 53.5, and 56.6, respectively, vs. 112.5 mg/dl; P < 0.05, Table 2 and Fig. 2). As a percent reduction, intake of either isoflavones or fenofibrate reduced serum triglycerides by ~52% (P < 0.05). As in the female mice, PPAR{alpha} –/– male mice showed reductions in serum triglyceride only in the S+I group. Thus there again appears to be a positive effect of isoflavone intake on serum triglyceride levels in the absence of PPAR{alpha} (112.6 vs. 244.3 mg/dl; P < 0.05). However, the presence of PPAR{alpha} also contributed to reduced serum triglyceride levels due to isoflavone intake: loss of the PPAR{alpha} receptor in S+I-fed male mice raised serum triglyceride levels from 53.7 mg/dl (+/+) to 122.6 mg/dl (–/–) (P < 0.05, Table 3 and Fig. 2).

Serum cholesterol in PPAR{alpha} –/– and +/+ mice fed atherogenic soy protein diets with different levels of isoflavones and fenofibrate.
Significant differences existed in serum total cholesterol levels between diet groups and the presence of PPAR{alpha} in both female and male mice (P < 0.05). As a main effect, the loss of the PPAR{alpha} receptor led to increased serum cholesterol levels (P < 0.05). Female +/+ mice fed the S+I diet had significantly (P < 0.05) decreased serum cholesterol levels compared with the S, S+F, or S+I+F group (163.4 vs. 192.2, 268.4, and 218.9 mg/dl, respectively; P < 0.05; Table 3), indicating a cholesterol-lowering effect of soy intake in these mice fed an atherogenic diet.

Male +/+ mice fed the S+F or S+I+F diet also had significantly (P < 0.05) increased cholesterol levels compared with the S or S+I group (289.8 and 251.6 vs. 168.2 and 173.8 mg/dl, respectively; P < 0.05, Table 3). However, the reduction of serum cholesterol by soy isoflavone intake was female specific: intake of soy isoflavones did not significantly affect serum cholesterol levels in the +/+ male mice.

Expression of PPAR{alpha}-regulated genes in +/+ and –/– PPAR{alpha} mice fed atherogenic soy protein diets with different levels of isoflavones and fenofibrate.
Carnitine palmitoyl transferase-1{alpha} (CPT1{alpha}) is responsible for the mitochondrial uptake of fatty acids, committing fatty acids transported into mitochondria to the ß-oxidation pathway. The CPT1{alpha} gene is tightly regulated by PPAR{alpha} (9) and is an excellent marker to confirm the action of fenofibrate as a hepatic PPAR{alpha} agonist and to determine whether isoflavones are inducing CPT1{alpha} mRNA levels in a PPAR{alpha}-dependent fashion. CPT1{alpha} and 18S rRNA levels were measured in RNA samples obtained from the liver of female and male PPAR{alpha} +/+ and –/– mice, using a Sybr green real-time quantitative PCR method (14). The levels of CPT1{alpha} mRNA were normalized to the 18S rRNA. Expression of CPT1{alpha} was significantly (P < 0.05) induced in both male and female wild-type mice fed fenofibrate-containing diets (Fig. 3). This effect was completely abolished in both male and female –/– mice, confirming the necessity of the PPAR{alpha} receptor to mediate this action of fenofibrate. Isoflavone intake increased CPT1{alpha} mRNA levels, consistent with an action of isoflavones as a PPAR{alpha} agonist, although with reduced potency compared with fenofibrate. In +/+ mice consuming isoflavones, CPT1{alpha} mRNA levels were increased by 60% in female mice and 120% in male mice. In contrast, in mice fed fenofibrate, CPT1{alpha} mRNA levels were raised 220 and 280%, respectively (Fig. 3). Although not statistically significant, in female mice, every group had greater CPT1{alpha} mRNA levels when isoflavones were present at high levels in the diet (i.e., S+I > S, S+I+F > S+F). In male mice, this trend was continued with CPT1{alpha} levels being elevated in S+I vs. S-fed mice; however, there was a contrary trend in fenofibrate-fed male mice, where CPT1{alpha} levels were higher in S+F- vs. S+I+F-fed mice. No similar trends associated with isoflavones were observed in PPAR{alpha} –/– mice, indicating the increases in CPT1{alpha} mRNA expression associated with isoflavone intake are PPAR{alpha} specific. In addition to CPT1{alpha}, acyl-CoA oxidase (ACO) mRNA levels were evaluated by Northern analyses (data not shown). ACO is similarly regulated by PPAR{alpha}, and ACO mRNA levels were found to be regulated by diet in a fashion that entirely resembled the pattern of regulation shown in Fig. 3 for CPT1{alpha}.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Because soy isoflavones were found to induce PPAR{alpha}-mediated activity in cell culture models (17, 13, 24), and intake of genistein induced PPAR{alpha}-directed gene expression in vivo (12), we wished to evaluate the activity of isoflavone intake in an in vivo design allowing the presence of PPAR{alpha} to be controlled. The present study could help clarify the relationship between regulation of lipid metabolism and the consumption of either low- or high isoflavone-containing soy protein.

Male and female PPAR{alpha} +/+ and –/– mice were utilized. Slightly fewer PPAR{alpha} –/– mice were used because of the lower viability of the male –/– mice. Mice were fed one of four soy protein-based, high-fat, high-cholesterol diets for 6 wk. An atherogenic high-fat, high-cholesterol diet was chosen, since the hypocholesterolemic effect of soy is more pronounced in hypercholesterolemic animals and humans, and we hypothesized that diet-induced changes in lipid levels would be more easily identified with these diets. Although fenofibrate is an approved drug for human use, it has been noted that use of fibrates in rodents may cause liver pathologies, observed as hepatomegaly and associated with robust proliferation of cellular peroxisomes. It is not known whether botanical compounds with PPAR{alpha} agonist activity produce the same peroxisome proliferation; the isoflavones are considered safe for human consumption well into high-milligram dose ranges (19).

As a percentage of total body weight, liver weight of PPAR +/+ mice was significantly elevated (P < 0.05) regardless of sex when mice were provided fenofibrate, due to PPAR{alpha}-mediated peroxisome proliferation. Fenofibrate proved to have potent effects on triglyceride metabolism and lesser effects on cholesterol levels in +/+ mice (Table 2).

In –/– mice, liver weight was slightly elevated in the female and male groups fed the isoflavone-containing S+I diet and in the male group fed the S+I+F diet (Table 2). These increases associated with isoflavone intake may be caused by increased liver lipids, perhaps due to the lipogenic activity of PPAR{gamma} (6). Isoflavone activation of hepatic PPAR{gamma} in the absence of PPAR{alpha} may cause this increase in hepatic lipid. Liver triglycerides and cholesterol were generally elevated in all –/– mice fed an isoflavone-containing diet (Table 2). In +/+ mice, this effect is not as pronounced, likely due to PPAR{alpha} action on lipolysis in the liver (27).

In humans using PPAR{alpha} agonist drugs such as fibrates, the hallmark response is a robust decrease in serum triglyceride levels. In +/+ mice, this response was also observed. Serum triglyceride levels were significantly lower in both male and female +/+ mice fed a fenofibrate-containing diet (Table 2 and Figs. 1 and 2). Significantly lower total triglyceride levels were also observed in +/+ mice fed the S+I diet compared with mice fed the low-isoflavone S diet. These data are consistent with an effect of soy isoflavones as activators of PPAR{alpha}, although isoflavones produced a less robust effect compared with fenofibrate. Interestingly, serum triglycerides were also significantly lower in female –/– mice fed the S+I compared with S diets and lower, although not significantly, than in the male –/– mice consuming the S+I vs. S diets. These data are consistent with isoflavones acting through both PPAR{alpha}-independent and PPAR{alpha}-dependent pathways. One possible explanation is again through isoflavone activation of PPAR{gamma}, since increased adipocyte differentiation and tissue lipid accumulation results in initially decreased serum triglycerides (29). Alternatively, the PPAR{alpha}-independent pathway of isoflavone regulation may be occurring via activation of sterol regulatory element-binding protein (SREBP) pathways. We have previously shown that exposure to isoflavones induces SREBP processing in an in vitro model (21).

Serum cholesterol levels were significantly lower in the wild-type female mice fed the S+I diet vs. the S diet but remained unchanged in the male mice fed these two diets (Table 3). In the present study, it appears that isoflavones have significantly more impact on triglyceride levels compared with serum cholesterol. That only female +/+ mice showed a reduction in cholesterol due to isoflavone intake again emphasizes the results of others showing contributions of estrogen receptor to lipid metabolism (22). Because of the unavailability of quantitative food intake data, it cannot be ruled out that this modest reduction in cholesterol in female +/+ mice is related to decreased food intake; however, we note that final body weights for these two groups were not different.

We also note that fenofibrate caused serum cholesterol levels to be elevated in both wild-type and knockout mice regardless of sex. This effect, noted in a previous study (27), found that the fibrate group of PPAR{alpha} activators caused increased accumulation of apolipoprotein (Apo)B48-carrying remnants in ApoE knockout mice, resulting in increased serum cholesterol levels. Because this effect is seen in both wild-type and knockout mice, it is most probably acting via a PPAR{alpha}-independent mechanism. Further investigation found that ciprofibrate causes downregulation of protein expression of hepatic scavenger receptor class B, type I (SR-BI) (7). The ApoB48 remnants are able to bind to the SR-BI receptor, indicating that, aside from being able to bind high-density lipoprotein particles, SR-BI is also a receptor responsible for the clearance of ApoB48 remnants. Because the major focus of our study was PPAR{alpha} action and the impact of isoflavones on triglyceride rather than cholesterol metabolism, we chose not to further evaluate LDL and HDL fractions. Another interesting observation is the fact that reductions in serum triglyceride levels in +/+ mice do not appear to be related to body weight. It could be argued that the decrease in serum triglyceride levels seen in +/+ mice fed fenofibrate is due to the catabolic action of the PPAR{alpha} agonist; however, in +/+ mice fed isoflavones alone, there was a normal increase in body weight for 6 wk occurring with the isoflavone-dependent decrease in serum triglyceride levels. Thus we suggest that decreases in serum triglyceride are not directly due to decreases in body weight.

Last, gene expression measurements were made for the PPAR{alpha}-regulated genes CPT1{alpha} and ACO to determine which, if any, of the diet treatments had a direct effect on gene expression and whether PPAR{alpha} was required for regulation. As expected, the fenofibrate diet treatments caused a significant increase in CPT1{alpha} gene expression in both male and female +/+ mice (Fig. 3). This effect was not seen in –/– mice. Intake of soy isoflavones resembled the effects of a less potent PPAR{alpha} agonist compared with fenofibrate. The additive effect of isoflavones and fenofibrate on CPT1{alpha} mRNA levels observed in female +/+ mice was not seen in male +/+ mice. It has been subsequently found that this difference is caused by enhanced turnover of fenofibrate in male mice fed both isoflavones and fenofibrate (25).

In summary, our study using PPAR{alpha} +/+ and –/– mice fed diets containing different levels of soy isoflavones and the PPAR{alpha} agonist fenofibrate has helped determine the following: first, it appears that significant improvements in serum triglyceride levels are provided by intake of soy isoflavones; second, it appears that these improvements in serum triglycerides are occurring via both PPAR{alpha}-dependent and PPAR{alpha}-independent mechanisms, with the PPAR{alpha}-independent mechanism possibly being mediated by SREBP pathways; and third, intake of isoflavones appears to improve serum cholesterol levels in female but not male +/+ mice. We suggest that these data help clarify the effect of soy isoflavone intake on lipid metabolism but again reinforce the notion that there are aspects of isoflavone intake on lipid metabolism that are yet to be explained.


    GRANTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institutes of Health Grant AT-000862, The Solae Company, and an American Heart Association Predoctoral Fellowship (to O. Mezei).


    ACKNOWLEDGMENTS
 
This work was presented in preliminary form at Experimental Biology 2005, April 4, 2005, San Diego, CA: Mezei O, Ross-Viola J, Mullen E, Li Y, and Shay NF. "Intake of soy isoflavones regulates cholesterol and triglyceride levels in a PPAR{alpha}-dependent and -independent manner (Abstract No. 586.3)."


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: N. F. Shay, W. K. Kellogg Institute for Food and Nutrition Research, Dept. of Nutrition Science, 2 Hamblin Ave., Battle Creek, MI 49017 (e-mail: neil.shay{at}kellogg.com)


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Anderson JW, Johnstone BM, and Cook-Newell ME. Meta-analysis of the effects of soy protein intake on serum lipids. N Engl J Med 333: 276–282, 1995.[Abstract/Free Full Text]
  2. Bloedon LT, Jeffcoat AR, Lopaczynski W, Schell MJ, Black TM, Dix KJ, Thomas BF, Albright C, Busby MG, Crowell JA, and Zeisel SH. Safety and pharmacokinetics of purified soy isoflavones: single-dose administration to postmenopausal women. Am J Clin Nutr 76: 1126–1137, 2002.[Abstract/Free Full Text]
  3. Campbell SE, Stone WL, Whaley SG, Qui M, and Krishnan K. Gamma tocopherol upregulates peroxisome proliferator activated receptor (PPAR) gamma expression in SW 480 human colon cancer cell lines. BMC Cancer 3: 25, 2003.[CrossRef][Medline]
  4. Dang ZC, Audinot V, Papapoulos SE, Boutin JA, and Lowik CW. PPARg as a molecular target for the soy phytoestrogen genistein. J Biol Chem 278: 962–967, 2003.[Abstract/Free Full Text]
  5. Erdman JW Jr, Badger TM, Lampe JW, Setchell KD, and Messina M. Not all soy products are created equal: caution needed in interpretation of research results. J Nutr 134: 1229S–1233S, 2004.[Abstract/Free Full Text]
  6. Evans RM, Barish GD, and Wang YX. PPARs and the complex journey to obesity. Nat Med 10: 355–361, 2004.[CrossRef][Web of Science][Medline]
  7. Fu T, Kozarsky KF, and Borensztajn J. Overexpression of SR-BI by adenoviral vector reverses the fibrate-induced hypercholesterolemia of apolipoprotein E-deficient mice. J Biol Chem 278: 52559–52563, 2003.[Abstract/Free Full Text]
  8. Gonzalez FJ. Recent update on the PPAR alpha-null mouse. Biochimie 79: 139–144, 1997.[Medline]
  9. Hsu MH, Savas U, Griffin KJ, and Johnson EF. Identification of peroxisome proliferator-responsive human genes by elevated expression of the peroxisome proliferator-activated receptor alpha in HepG2 cells. J Biol Chem 276: 27950–27958, 2001.[Abstract/Free Full Text]
  10. Inoue H, Jiang XF, Katayama T, Osada S, Umesono K, and Namura S. Brain protection by reSveratrol and fenofibrate against stroke requires peroxisome proliferator-activated receptor alpha in mice. Neurosci Lett 352: 203–206, 2003.[CrossRef][Web of Science][Medline]
  11. Jenkins DJ, Kendall CW, Marchie A, Faulkner DA, Wong JM, de Souza R, Emam A, Parker TL, Vidgen E, Lapsley KG, Trautwein EA, Josse RG, Leiter LA, and Connelly PW. Effects of a dietary portfolio of cholesterol-lowering foods vs lovastatin on serum lipids and C-reactive protein. JAMA 290: 502–510, 2003.[Abstract/Free Full Text]
  12. Kim S, Shin HJ, Kim SY, Kim JH, Lee YS, Kim DH, and Lee MO. Genistein enhances expression of genes involved in fatty acid catabolism through activation of PPARalpha. Mol Cell Endocrinol 220: 51–58, 2004.[CrossRef][Web of Science][Medline]
  13. Kim S, Sohn I, Lee YS, and Lee YS. Hepatic gene expression profiles are altered by genistein supplementation in mice with diet-induced obesity. J Nutr 135: 33–41, 2005.[Abstract/Free Full Text]
  14. Komurian-Pradel F, Paranhos-Baccala G, Sodoyer M, Chevallier P, Mandrand B, Lotteau V, and Andre P. Quantitation of HCV RNA using real-time PCR and fluorimetry. J Virol Methods 95: 111–119, 2001.[CrossRef][Web of Science][Medline]
  15. Lee SS and Gonzalez FJ. Targeted disruption of the peroxisome proliferator-activated receptor alpha gene, PPAR alpha. Ann NY Acad Sci 804: 524–529, 1996.[Web of Science][Medline]
  16. Lichtenstein AH, Jalbert SM, Adlercreutz H, Goldin BR, Rasmussen H, Schaefer EJ, and Ausman LM. Lipoprotein response to diets high in soy or animal protein with and without isoflavones in moderately hypercholesterolemic subjects. Arterioscler Thromb Vasc Biol 22: 1852–1858, 2002.[Abstract/Free Full Text]
  17. Mezei O, Banz WJ, Steger RW, Peluso MR, Winters TA, and Shay N. Soy isoflavones exert antidiabetic and hypolipidemic effects through the PPAR pathways in obese Zucker rats and murine RAW 264.7 cells. J Nutr 133: 1238–1243, 2003.[Abstract/Free Full Text]
  18. Mezei O, Chou CN, Kennedy KJ, Tovar-Palacio C, and Shay NF. Hepatic cytochrome p450–2A and phosphoribosylpyrophosphate synthetase-associated protein mRNA are induced in gerbils after consumption of isoflavone-containing protein. J Nutr 132: 2538–2544, 2002.[Abstract/Free Full Text]
  19. Miltyk W, Craciunescu CN, Fischer L, Jeffcoat RA, Koch MA, Lopaczynski W, Mahoney C, Jeffcoat RA, Crowell J, Paglieri J, and Zeisel SH. Lack of significant genotoxicity of purified soy isoflavones (genistein, daidzein, and glycitein) in 20 patients with prostate cancer. Am J Clin Nutr 77: 875–882, 2003.[Abstract/Free Full Text]
  20. Moya-Camarena SY, Vanden Heuvel JP, Blanchard SG, Leesnitzer LA, and Belury MA. Conjugated linoleic acid is a potent naturally occurring ligand and activator of PPARalpha. J Lipid Res 40: 1426–1433, 1999.[Abstract/Free Full Text]
  21. Mullen E, Brown RM, Osborne TF, and and Shay NF. Soy isoflavones affect sterol regulatory element binding proteins (SREBPs) and SREBP regulated genes in HepG2 cells. J Nutr 134: 2942–2947, 2004.[Abstract/Free Full Text]
  22. Naaz A, Yellayi S, Zakroczymski MA, Bunick D, Doerge DR, Lubahn DB, Helferich WG, and Cooke PS. The soy isoflavone genistein decreases adipose deposition in mice. Endocrinology 144: 3315–3320, 2003.[Abstract/Free Full Text]
  23. Obst JM and Seamark RF. Hormone studies on ewes grazing an oestrogenic (Yarloop clover) pasture during the reproductive cycle. Aust J Biol Sci 28: 279–290, 1975.[Medline]
  24. Ricketts ML, Moore DD, Banz WJ, Mezei O, and Shay NF. Molecular mechanisms of action of the soy isoflavones includes activation of promiscuous nuclear receptors. J Nutr Biochem 16: 321–330, 2005.[CrossRef][Web of Science][Medline]
  25. Ross-Viola JS, Suckow M, Mezei O, and Shay NF. Reduction of hepatic ischemic injury in fenofibrate-treated mice consuming a soy isoflavone-containing diet (Abstract). FASEB J 19: 845.8, 2005.
  26. Setchell KD, Brown NM, Desai P, Zimmer-Nechemias L, Wolfe BE, Brashear WT, Kirschner AS, Cassidy A, and Heubi JE. Bioavailability of pure isoflavones in healthy humans and analysis of commercial soy isoflavone supplements. J Nutr 131: 1362S–1375S, 2001.[Abstract/Free Full Text]
  27. Staels B, Dallongeville J, Auwerx J, Schoonjans K, Leitersdorf E, and Fruchart JC. Mechanism of action of fibrates on lipid and lipoprotein metabolism. Circulation 98: 2088–2093, 1998.[Abstract/Free Full Text]
  28. Wiseman H, Casey K, Bowey EA, Duffy R, Davies M, Rowland IR, Lloyd AS, Murray A, Thompson R, and Clarke DB. Influence of 10 wk of soy consumption on plasma concentrations and excretion of isoflavonoids and on gut microflora metabolism in healthy adults. Am J Clin Nutr 80: 692–699, 2004.[Abstract/Free Full Text]
  29. Ye JM, Doyle PJ, Iglesias MA, Watson DG, Cooney GJ, and Kraegen EW. Peroxisome proliferator-activated receptor (PPAR)-alpha activation lowers muscle lipids and improves insulin sensitivity in high fat-fed rats: comparison with PPAR-gamma activation. Diabetes 50: 411–417, 2001.[Abstract/Free Full Text]
  30. Zhuo XG, Melby MK, and Watanabe S. Soy isoflavone intake lowers serum LDL cholesterol: a meta-analysis of 8 randomized controlled trials in humans. J Nutr 134: 2395–2400, 2004.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Nutr.Home page
M. J. Ronis, Y. Chen, J. Badeaux, and T. M. Badger
Dietary Soy Protein Isolate Attenuates Metabolic Syndrome in Rats via Effects on PPAR, LXR, and SREBP Signaling
J. Nutr., August 1, 2009; 139(8): 1431 - 1438.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
Y. Li, J. S. Ross-Viola, N. F. Shay, D. D. Moore, and M.-L. Ricketts
Human CYP3A4 and Murine Cyp3A11 Are Regulated by Equol and Genistein via the Pregnane X Receptor in a Species-Specific Manner
J. Nutr., May 1, 2009; 139(5): 898 - 904.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
T. M. Badger, M. J. J. Ronis, G. Wolff, S. Stanley, M. Ferguson, K. Shankar, P. Simpson, and C.-H. Jo
Soy Protein Isolate Reduces Hepatosteatosis in Yellow Avy/a Mice Without Altering Coat Color Phenotype
Experimental Biology and Medicine, October 1, 2008; 233(10): 1242 - 1254.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
A. Orgaard and L. Jensen
The Effects of Soy Isoflavones on Obesity
Experimental Biology and Medicine, September 1, 2008; 233(9): 1066 - 1080.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J. P. Konhilas and L. A. Leinwand
The Effects of Biological Sex and Diet on the Development of Heart Failure
Circulation, December 4, 2007; 116(23): 2747 - 2759.
[Full Text] [PDF]


Home page
J. Nutr.Home page
Y. Li, O. Mezei, and N. F. Shay
Human and Murine Hepatic Sterol-12-{alpha}-Hydroxylase and Other Xenobiotic Metabolism mRNA Are Upregulated by Soy Isoflavones
J. Nutr., July 1, 2007; 137(7): 1705 - 1712.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
26/1/8    most recent
00155.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mezei, O.
Right arrow Articles by Shay, N. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mezei, O.
Right arrow Articles by Shay, N. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.