Physiol. Genomics Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 24: 181-190, 2006. First published December 20, 2005; doi:10.1152/physiolgenomics.00255.2005
1094-8341/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemtary Table and Figure
Right arrow All Versions of this Article:
24/3/181    most recent
00255.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, F.
Right arrow Articles by Qin, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, F.
Right arrow Articles by Qin, S.
Received 17 October 2005; accepted in final form 13 December 2005.
Physiological Genomics 24:181-190 (2006)
American Physiological Society © 2006 American Physiological Society

Call For Papers: Comparative Genomics

Genome-wide analysis of restriction-modification system in unicellular and filamentous cyanobacteria

Fangqing Zhao1, Xiaowen Zhang1, Chengwei Liang1, Jinyu Wu2, Qiyu Bao2 and Song Qin1

1 Institute of Oceanology, Chinese Academy of Sciences, Qingdao, China
2 Institute of Biomedical Informatics, Wenzhou Medical College, Wenzhou, China


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cyanobacteria are an ancient group of gram-negative bacteria with strong genome size variation ranging from 1.6 to 9.1 Mb. Here, we first retrieved all the putative restriction-modification (RM) genes in the draft genome of Spirulina and then performed a range of comparative and bioinformatic analyses on RM genes from unicellular and filamentous cyanobacterial genomes. We have identified 6 gene clusters containing putative Type I RMs and 11 putative Type II RMs or the solitary methyltransferases (MTases). RT-PCR analysis reveals that 6 of 18 MTases are not expressed in Spirulina, whereas one hsdM gene, with a mutated cognate hsdS, was detected to be expressed. Our results indicate that the number of RM genes in filamentous cyanobacteria is significantly higher than in unicellular species, and this expansion of RM systems in filamentous cyanobacteria may be related to their wide range of ecological tolerance. Furthermore, a coevolutionary pattern is found between hsdM and hsdR, with a large number of site pairs positively or negatively correlated, indicating the functional importance of these pairing interactions between their tertiary structures. No evidence for positive selection is found for the majority of RMs, e.g., hsdM, hsdS, hsdR, and Type II restriction endonuclease gene families, while a group of MTases exhibit a remarkable signature of adaptive evolution. Sites and genes identified here to have been under positive selection would provide targets for further research on their structural and functional evaluations.

coevolution; comparative genomics; horizontal gene transfer; molecular evolution; Spirulina platensis


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
CYANOBACTERIA ARE AMONG the oldest life on Earth with the capacity of oxygenic photosynthesis similar to the process found in higher plants. Cyanobacteria may be unicellular or filamentous, and they can be found in many different environments ranging from marine to freshwater habitats and also in soil, on rocks, and on plants. Spirulina, a nonheterocystous, filamentous cyanobacterium, is proposed as an important mariculture crop for both food and food supplement and as a potential chemical factory for a variety of useful products if effective genetic engineering can be accomplished. Unlike other unicellular (e.g., Synechococcus and Synechocysits) and filamentous cyanobacteria (e.g., Anabaena), genetic transformation of Spirulina has had limited success to date (18, 52). The predominant barrier appears to be the presence of restriction-modification (RM) systems in Spirulina platensis, which may decrease or prevent the uptake of exogenous DNA (53).

RM systems comprise a restriction endonuclease (REase) activity that specifically cleaves DNA and a corresponding methyltransferase (MTase) activity that specifically methylates the host DNA, thereby protecting it from cleavage (4, 55). RM systems can be subdivided into four groups (I, II, III, and IV) based on the subunit composition, cofactor requirements, sequence specificity, and cleavage position (40, 55). Moreover, those MTases not associated with REases are termed solitary MTases. RM systems in the host genome have been viewed as a defense mechanism against DNA invasion or as the parasitic selfish genetic elements (22, 42). The selfish gene hypothesis is now well supported by much evidence from genome analysis and experimentation (23). The traditional method used to screen for REases is to culture individual strains and test their extracts for the ability to produce specific fragments from small DNA molecules (55). A large number of both filamentous and unicellular cyanobacteria have been shown to contain one or more Type II site-specific REases (29). Lyra et al. (29) employed principal component analysis to demonstrate the relationship between certain REases and their hosts and found that all 28 cyanobacterial strains studied contain Type II REases, with the most common cyanobacterial REase types being AvaII, AvaI, and AsuII. Matveyev et al. (31) used experimental and bioinformatics approaches to give a full insight on the MTases of the cyanobacterium Anabaena sp. PCC7120, which has four Type II MTases associated with REases (AvaI–IV) and five solitary MTases. Comparative analysis of cyanobacterial MTases revealed that the solitary ones appear to be of ancient origin in cyanobacteria, while the Type II MTases appear to have arrived by horizontal gene transfer (31).

Now 15 cyanobacterial genomes have been fully sequenced, 3 in the draft format, and >20 are in the process of being sequenced (http://img.jgi.doe.gov/pub/main.cgi?page=restrictedMicrobes&domain=Bacteria; http://www.ncbi.nlm.nih.gov/). These genome-sequencing projects undoubtedly bring a great convenience to the search for novel RM genes using bioinformatic tools. We have generated >7-Mbp genomic sequences with 8x coverage of redundancy from the shotgun genome-sequencing project of S. platensis (Spirulina Genome Sequencing Consortium, unpublished data). Genome-wide identification of RM systems in Spirulina will help to develop an efficient gene transfer system in this organism. Here, we reported all the putative RM superfamily from the draft genome of S. platensis and presented a comparative genomic analysis of RM genes in the unicellular and filamentous cyanobacteria.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Computational search for novel RM genes.
The cyanobacteria species examined included Synechocystis, Synechococcus, Prochlorococcus, Anabaena, Nostoc, Spirulina, and Trichodesmium. An initial set of RM genes was obtained from CyanoBase (http://www.kazusa.or.jp/cyano/cyano.html) and Integrated Microbial Genomes (IMG) v.1.1 (http://img.jgi.doe.gov/v1.1/main.cgi). This data set, including well-characterized and putative cyanobacterial RMs, was used to construct a query protein set. Each protein in this query data set was used to search the potential novel sequences in all cyanobacteria species with whole genome sequences available, by using the basic local alignment search tool (BLAST)P and TBLASTN programs, with e-value <1E-10; the searches were iterated until convergence. Hits produced by different query sequences were combined, and duplicate records, which were identified on the basis of accession, were removed. Because RM genes tend to form clusters (55), all cyanobacterial genomic clusters containing RM sequences were also retrieved and translated into six open reading frames (ORFs) and examined manually for the presence of the RM motifs to discover potential sequences with distant homology. Then profile recognition programs (45, 46), including PFAM (http://pfam.wustl.edu/) and simple modular architecture research tool (SMART; http://smart.embl-heidelberg.de/), were used to determine the presence of RM motifs, and multiple sequence alignments were used to finally classify a protein as RM homolog. Overall, six motifs (HSDR_N, DEXDc, Methylase_M, Methylase_S, N6_Mtase, and MethyltransfD12) were used in this study. All the putative RM genes identified in Spirulina genome have been submitted to the GenBank. Accession numbers are as follows: DQ239732DQ239748.

RT-PCR analysis of RM genes in Spirulina.
Total RNA was extracted from fresh Spirulina using RNeasy Mini kit (Qiagen) by following the manufacturer's protocol. Residual DNA in RNA preparations was eliminated by digestion with RNase-free DNase (Promega). The absence of DNA was checked by PCR. The purified total RNA was reverse transcribed into cDNA using AMV RT (Takara). The following primers used for RT-PCR were designed based on the coding region of each gene: I-hsdM: forward primer CGATGCGACGGAGTTTAG, reverse primer GCTTTTGTTCCGCCTTTT; II-hsdM: forward primer TACTCGGCACGCTGTTTT, reverse primer CCCTGCCAACCCTTTTAG; III-hsdM: forward primer GCGTTCCTGTTTTTGCAG, reverse primer TGGTCTTGCCCATATTGC; IV-hsdM: forward primer GGCATTATCGGCTTACCC, reverse primer GTGGAGGTCTTCCGGTTC; IV-MTase: forward primer GACCCCTTTGCAGGTAGC, reverse primer TGTTCGGAATAGGGCAGA; V-hsdM: forward primer GCCTAAATCAGCCCCATC, reverse primer GCCTCACAATCAGCTTGC; V-MTase: forward primer ATCACAATCACCACAGAACC, reverse primer ATGTTGAGCCAAAAAGAGC; VI-hsdR: forward primer TATCGCCTGCTGCGTTAT, reverse primer: GCGGAGTCCTTGGGTATC; MTase1: forward primer GACGTAGCAACACACTTTC, reverse primer GCAAATAGAAAAGCCTTGG; MTase2: forward primer TTAACCCACGAATCAATCC, reverse primer CGAGAGACTGTAAAACCTCC; MTase3: forward primer GGGAAAAACTTACAACCAC, reverse primer GGCTAATAAAGGGGGAAC; MTase4: forward primer TGCCCAGTGATAGTTTTTC, reverse primer CCAGGGCATCAATTACC; MTase5: forward primer TCGCCTTTATCCCTATCG, reverse primer CATACCATCAGGAGGAACC; MTase6: forward primer GGCCAGAAGCTGAAACC, reverse primer GAACCCACCAACTCAAACC; MTase7: forward primer AAATTATGCCTCCAAGC, reverse primer CCTGCCACATATTCAGC; MTase8: forward primer CCAAACGATAACAGCACC, reverse primer CCAGCGACAGAAAAACC; MTase9: forward primer TTATCCGCCGCCAATTACC, reverse primer TGTCCATTTCGCACGTCG; MTase10: forward primer TTGCAGATCCTCCCTACA, reverse primer AATTAATTTACGTTGTGCG; MTase11: forward primer TAGCAATTCGCTTGACC, reverse primer AGCATCACCTTGACTCC.

Multiple sequence alignment and phylogenetic analysis.
Multiple sequence alignments were carried out using the Clustal W program (48) and then adjusted manually. Graphical representations of the multiple amino acid sequence alignments, the sequence logos, were presented using WebLogo (7). To maximize the number of sites available for analysis, partial sequences and certain sequences with large deletions were excluded from the analysis. The neighbor-joining (NJ) method and maximum parsimony method in MEGA3 (28) were used to construct the phylogenetic tree, and the reliability of each branch was tested by 1,000 bootstrap replications.

Molecular evolutionary analysis.
Detecting structural interactions and statistical covariance among separate amino acid sites is of great significance for understanding protein structure and evolution (2, 38). Such analyses are based on the assumption that functionally significant coordinated residues in proteins result from physicochemical interactions (e.g., hydrophobic, electrostatic). These interactions are dependent on the physicochemical properties (e.g., volume, charge, and hydrophobicity) of the residues (50). Here, we estimated the pairwise correlation of residue substitutions among several motifs in hsdM and hsdR. This approach, based on the estimation of the linear correlation coefficients between the amino acid physicochemical property values, was fully described by Afonnikov and Kolchanov (1). Different characteristics of amino acids (volume, hydrophobicity, and polarity) were chosen for coevolution analysis that reflect physical and chemical interactions between residues. Different sequence weighting methods (14, 54) were also used in these tests to avoid sequence bias.

One of the most stringent methods to detect positive selection is a comparison of the rate of nonsynonymous substitutions (dN) to the rate of synonymous substitution (dS). The ratio between these rates ({omega} = dN/dS) is a reliable measure of the selective pressure acting on a protein-coding gene, with {omega} = 1 indicating neutral evolution, {omega} < 1 purifying selection, and {omega} > 1 positive selection (57). Likelihood ratio tests (LRTs) were performed using Codeml with the site-specific models (M1/M2, M7/M8) of the phylogenetic analysis by maximum likelihood (PAML) package (59). When parameter estimates under a model allowing positive selection suggested the presence of a number of sites with {omega} > 1, Bayes' theorem was used to calculate their posterior probabilities (56).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The RM superfamily in Spirulina.
To identify all members of the RM superfamily, we performed TBLASTN searches of the Spirulina in-finishing genome database with RM genes for the bacterial and archaebacterial homologs. Similar searches were run with the Pfam domains (HSDR_N, DEXDc, Methylase_M, N6_Mtase, Methylase_S, and MethyltransfD12) of the RM proteins to avoid the exclusion of highly diverged sequences with just limited conserved motifs. PFAM and SMART domain analyses with the derived sequences employed as queries were then carried out to eliminate false positives. After the above analyses, a total of 30 putative RM genes were obtained from the Spirulina genome database (Fig. 1 and Supplemental Table S1; available at the Physiological Genomics web site).1Type I RM systems comprise three closely linked subunits, which can distinguish them obviously from other type of RM genes without further experimental research. In this study, the symbol for Type I RM system was hsd, and thus the genes were hsdR, hsdM, and hsdS, whereas other types of RM genes or the solitary MTases were uniformly termed as REase or MTase.


Figure 1
View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. Organization of the gene clusters potentially encoding restriction-modification (RM) system of Spirulina platensis. Arrows represent the direction of translation and the relative sizes of open reading frames (ORFs) deduced from analysis of the nucleotide sequence. Gene names are given at top of corresponding region. Open arrows indicate the flanking ORFs; other types of arrows indicate different subfamilies of RM system. "x" in the arrow indicates the nonsense codon. Gene clusters encoding Type I RM genes are marked as clusters I–VI; the putative Type II RM genes or solitary methyltransferases (MTases) are marked nos. 1–11. REase, restriction endonuclease.

 
Six clusters of the Spirulina genome, ranging from 4.7 to 11.7 kb, were found containing the putative Type I RM systems (Fig. 1). In cluster I, hsdM [688 amino acids (aa)] and hsdS (392 aa) should be cotranscribed from the same promoter, with a four-nucleotide overlap. The hsdR gene was downstream of the hsdM/S gene partitioned by two ORFs (putative ATP-binding protein and orf1). In cluster II, the hsdS subunit was interrupted by a stop codon (DQ239733, 2642-TAAATCGTG) in the coding frame, which resulted in two separate but frame-integrated specificity domains (target recognition domains; TRDs). Downstream of this hsdS gene, a pin homolog encoding a site-specific recombinase was found on the opposite strand, which could mediate DNA inversion and phase variation in prokaryotes (10, 51). Two RM loci were found in cluster IV: one was the putative Type I hsdM/S genes, and the other was composed of two ORFs encoding the m4C type of MTase (IV-MTase) and DUF820. DUF820 sequences form a family of hypothetical proteins from bacteria that have greatly expanded in a number of cyanobacterial species. Kinch et al. (19) identified that this family should belong to a novel REase with the conserved motifs that make up the nuclease active site. Hence, this ORF should be the cognate REase of IV-MTase, although it showed little significant resemblance to any known Type II REases. All the HsdR and HsdM identified in the Spirulina genome shared high similarity with the RM proteins in other prokaryotic organisms. HsdS, however, shared less sequence similarity (5%-33%) from counterparts in cyanobacteria. Some of the RM genes in Spirulina should be defective, as judged by the nonsense mutation (e.g., II-hsdS) or the loss of conserved motifs (e.g., V-hsdM, MTase11).

We also searched the potential type II or solitary MTases containing conserved MTase sequence motifs (Pfam: MethyltransfD12) and the adjacent putative REases. Because the sequences of type II MTases possess a moderate level of sequence conservation, most of them should be identified with the computational searches. In contrast, REases only share sequence similarity when they have similar recognition specificities (43). Therefore, only four MTases could be identified to possess cognate REases in the Spirulina genome (Fig. 1), and whether other closely linked ORFs function as the endonucleases can be clarified by an experimental approach. Four cognate REases (REase1, -2, -6, and -7) share significant sequence similarities with known AvaIVAP (GCTNAGC, P value = 8E-37), AgeI (ACCGGT, P value = 2E-81), BsuBI (CTGCAG, P value = 2E-50), and HindVP (GRCGYC, P value = 1E-82), respectively. These MTases can be annotated into three groups: m4C (IV-MTase, V-MTase), m5C (MTase1–9), and m6A (MTase10, -11) based on querying the Restriction Enzyme database (REBASE) (41).

RT-PCR analysis of RM genes in Spirulina.
Because gene expression patterns can provide important clues for gene function, we employed RT-PCR experiments to characterize gene expression profiles of the Spirulina MTases. Previous studies revealed that many of the RM systems in Anabaena sp. 7120 or Helicobacter pylori J99 were partially or completely inactive (25, 31). Similar results were also found in the RM systems of S. platensis. As shown in Fig. 2, 6 of 18 MTase genes were not expressed in Spirulina. Notably, the hsdM gene in the II-hsd system was expressed, whereas its cognate hsdS gene was defective, with a stop codon in the coding frame resulting in two split TRD domains. Most of the HsdS subunits carry two separate TRDs, providing symmetry for their interaction with the bipartite, asymmetric DNA target (21). Such mutation in hsdS may cause the inactivation of the RM system. However, MacWilliams and Bickle (30) found that a truncated HsdS subunit comprising a single TRD and a set of conserved motifs could also function as a dimer, specifying the bipartite, symmetric DNA target. Moreover, HsdS subunits can be exchanged between two families of Type I RMs (44). In some cases, HsdM seems to be functional with a defective cognate HsdR, which may serve to protect the genome from the attack by RM systems (15, 47). The expression of II-hsdM indicated that frameshift or missense mutations in one subunit could not always lead to the inactivation of the whole RM system. Therefore, this points out the need for a cautious approach in evaluating the activity of each subunit in RM systems.


Figure 2
View larger version (35K):
[in this window]
[in a new window]
 
Fig. 2. RT-PCR analysis of the expression of RM genes in S. platensis. See MATERIALS AND METHODS for details.

 
Genomic distribution and sequence analysis of RM genes.
Computer-based nucleotide and protein searches were performed using different BLAST search programs at the National Center for Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov/BLAST) and Joint Genome Institute (JGI; http://img.jgi.doe.gov/v1.1/main.cgi?page=geneSearchForm). Protein sequences of RM genes previously described in REBASE were used as queries for database. All the putative RMs are listed in Supplemental Table S1. To elucidate the complete genomic structure of the RM genes, we mapped them onto the unicellular and filamentous cyanobacterial genomes (Fig. 3). Because the S. platensis genomic sequences were still in the draft format, all the putative RMs were then mapped onto the chromosome evenly, and did not represent their actual locations.


Figure 3
View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3. Genomic organization of RM genes in unicellular (D: Synechocystis sp. 6803; E: Synechococcus elongtus) and filamentous cyanobacteria (A: S. platensis; B: Anabaena variabilis ATCC 29413; C: Anabaena sp. 7120). Vertical bars show the locations of RM genes, with different colors representing different Pfam domains: red, Methylase_S; light green, HSDR_N; purple, DEXDc; blue, Methylase_M; black, N6_Mtase; orange, MethyltransfD12; dark green, REase (not the Pfam nomenclature). Long horizontal line indicates the chromosome, whereas short horizontal lines denote the extranuclear plasmids. A vertical bar above a horizontal line indicates the transcriptional direction opposite to that below a horizontal line. Positions and orders of RM genes in B–E were drawn based on their genome assemblies. Note that Spirulina genome (A) was still in draft format, and RM genes were mapped onto the chromosome evenly. Connecting lines represent similar domains (BLASTP search, score > 90, e-value < E-9) between genomes. Sequence similarities among Type I RM genes from C, D, and E were implied from the dendrogram constructed through the neighbor-joining (NJ) method, shown in black. The value in this dendrogram represents the bootstrap value.

 
Sequences giving the better reciprocal BLAST hits were tentatively assumed to identify homologous counterparts in two species if they could be aligned over, at minimum, a BLAST score >90 and an e-value <1E-10. By these criteria, all the RM domains derived from the genome of S. platensis, Anabaena sp. 7120, and Anabaena variabilis ATCC 29413 were examined to have quite different sequence similarities. Some MTases (MTase1–3) in A. variabilis ATCC 29413 had more homologs with high similarities in the other two filamentous cyanobacteria, while other MTases had less or no counterparts in Spirulina and Anabaena sp. 7120. Moreover, no obvious similarities (usually <20%) were found among the specificity genes (HsdS), which encode polypeptide sequences responsible for the recognition of the target sequence. A striking example of evolutionary conservation is provided by the genes encoding Type I RMs in Anabaena sp. 7120 (hsd2 and hsd3) and A. variabilis ATCC 29413 (hsd2). The amino sequences of these gene products (HsdR and HsdM) are nearly identical in Anabaena sp. 7120; 96% identity was preserved in HsdR/M between Anabaena sp. 7120 and A. variabilis ATCC 29413. Interestingly, all three Type I RMs in A. variabilis ATCC 29413 shared some similarities with the HsdR/M in Anabaena sp. 7120, whereas the Type I RMs in Spirulina exhibited much less sequence similarity with those in the Anabaena species.

Phylogenetic analysis.
RMs identified from cyanobacteria and other prokaryotic organisms, such as proteobacteria, archaea, chlorobi, firmicutes, spirochaetes, and actinobacteria, were used to construct phylogenies to discern the evolutionary history of RM system. The 16s rDNA phylogeny clearly showed separation of prokaryotes into several monophyletic clades, and all these branches had significant statistical support (see Fig. 5A). The hsdM and hsdR phylogenies illustrated in Fig. 4, however, exhibited quite different topologies, where different sources of hsd genes scattered throughout the tree. Although several monophyletic groups were inferred with strong bootstrap support, these groups did not correspond to their 16s rDNA phylogeny. Furthermore, in the filamentous species of cyanobacteria, the hsd genes were usually present in several copies, and, based on the tree topology and their genomic organization, these copies might have quite different evolutionary histories. For example, hsd2 and hsd3 of Anabaena sp. 7120 were adjacent to each other along the chromosome and were nearly identical at the amino acids level. These two copies most likely have evolved through recent duplication, whereas evolution of other RMs (hsd1, hsd4, and hsd5) is more complex and probably involves horizontal gene transfers.


Figure 4
View larger version (32K):
[in this window]
[in a new window]
 
Fig. 4. The concordance of HsdM (left) and HsdR (right) protein phylogeny constructed with the NJ method. Dashed lines link the cognate hsdM and hsdR genes in the same gene cluster. Colored branches and symbols indicate different sources of RM genes (red, {alpha}-proteobacteria; light green, ß-proteobacteria; brown, {gamma}-proteobacteria; purple, {delta}-proteobacteria; light blue, {epsilon}-proteobacteria; green, firmicutes; grey blue, spirochaetes; grey, chlorobi; blue, cyanobacteria; dark, archaea).

 
Unlike the wide, dispersed distribution of hsd genes through the phylogeny, most of the cyanobacterial MTases in Fig. 5B formed a separate clade (77% bootstrap value), with the exception of six sequences (A7-MTase1, A7-MTase3, Se-MTase1, Se-MTase2, S6-MTase2, and S6-MTase3). The archaebacterial sequences were located elsewhere on the tree. Most of the {gamma}-proteobacterial sequences formed a separate clade with 99% bootstrap support. The exception was the sequences from Moraxella bovis (PG-BAA03071) and Chromohalobacter salexigens (PG-ZP_00473324), which grouped with other prokaryotes. Moreover, two viral MTases were clustered with four ß-proteobacterial sequences (100% bootstrap value), in which Burkholderia (ZP_00500806) was the host of the bacteriophage phiE125 (YP_164085). The MTases in both genomes shared a great similarity (>99%), indicating the horizontal transfer of MTases between the bacterial host and the phage. These results evidently suggested multiple lateral transfers of RM genes both within and between the major clades of the tree (Figs. 4 and 5).


Figure 5
View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5. Unrooted NJ tree for 16s rDNA (A) and MTase (B) in prokaryotic organisms. Colored branches and symbols indicate different sources of RM genes (red, {alpha}-proteobacteria; light green, ß-proteobacteria; brown, {gamma}-proteobacteria; purple, {delta}-proteobacteria; light blue, {epsilon}-proteobacteria; green, firmicutes; grey blue, spirochaetes; grey, chlorobi; blue, cyanobacteria; dark, archaea).

 
We also performed phylogenetic analysis separately for each Pfam domain of HsdR and HsdM (HSDR_N, DEXDc, Methylase_M, and N6_Mtase), and phylogenies obtained from these different domains were quite similar to the phylogenetic trees illustrated in Fig. 4 (data not shown). By contrast, phylogenetic analyses using different domains of HsdS gave different phylogenetic topologies with no strong bootstrap support (data not shown). HsdS usually contains two Pfam domain (Methylase_S) repeats, and little similarity exists outside of these motifs. The diversification of hsdS genes to achieve maximal variation of specificity should be driven by strong selective pressures (55).

Evolutionary analysis of RM genes.
HsdM and HsdR, as with interacting domains, must coevolve to form an integral and active complex with HsdS subunit. Phylogenetic trees (Fig. 4) based on the NJ method showed, extensively, similarity in clustering of cognate hsdM and hsdR genes, also indicating the coevolution of two subunits of Type I RMs. Previous studies revealed several conserved motifs in HsdM, among which motif I (D/E/SXFXGXG) can bind the AdoMet and motif IV (N/DPPF/Y/W) can be involved in substrate binding or in the catalytic activity (34). As for HsdR, several conserved motifs were also found in the DEAD-box domain, which formed a nucleoside triphosphate (NTP)-binding pocket and a portion of a nucleic acid-binding site (13, 34).

We estimated the pairwise correlation of five domains containing the above functional motifs. Different sequence weighting methods (14, 54) used to avoid sequence bias gave similar results, and only the results derived from the Vingron and Argos (54) approach were shown. We first considered such amino acid properties as volume (size) for coevolution analysis. From Fig. 6, we can see that many site pairs are highly correlated in a positive or negative way at the 99.9% level. In the hsdM-motif I, seven sites (sites 7–11, 13, 15) were correlated with the sites in the other hsdR-motifs, and these sites mostly resided in or were surrounding the featured residues. Similar results were found in the hsdM-motif IV. Sites close in the primary sequence are likely to be close in the tertiary structure and are therefore likely to have coevolved. In this study, however, the observed numbers of positively or negatively coevolving site pairs within the distant sites were significantly higher than those close pairs, indicating that the amino acids size interactions, especially those distant site pairs, should play an important role in the tertiary structure formation. Another amino acid characteristic, hydrophilicity, was also used to perform the coevolution analyses. From a structural and functional perspective, correlated amino acid replacements may have occurred among sites to maintain the same hydrophilicity properties, size constraints, electrostatic charges, etc. Many pairs of residues showed high correlations, and nearly one-third of the coevolving site pairs (70 of 212) were identical to those computed for the residue size effect analysis (Fig. 6). The hydrophilicity effect, however, was different with the size correlations in the hsdM-motif I, where much fewer coevolving site pairs were found in this domain. Nearly all the sites in the hsdR-motifs I, Ia, II, and III exhibited strong positive or negative correlations, revealing the great significance of these sites to form a hydrophobic hydrolysis pocket.


Figure 6
View larger version (126K):
[in this window]
[in a new window]
 
Fig. 6. Pairwise matrix representation of the coevolving site pairs in hsdM and hsdR. Two amino acid characteristics, size (below the diagonal) and hydrophilicity (above the diagonal), were used for coevolution analysis. Red, positively coevolving site pairs; blue, negatively coevolving site pairs. Critical value for the correlation coefficients is 0.5253 at the 99.9% level. Logos representation of an alignment of the hsdM-motifs I and IV and hsdR-motifs I, Ia, II, and III from the sequences listed in Fig. 4. Several mostly conserved sites, excluded from coevolution analysis, were added below the logo alignment. Invariable residues are uppercase and variable sites are lowercase, with the short black line indicating their locations. Blue shading shows the coevolving site pairs between hsdM and hsdR, which were fully discussed in RESULTS.

 
To analyze the possibility of positive selection acting on specific codons in the RM family, likelihood ratio test (LRT) was used to test for variation in the dN/dS ratio among sites in sets of closely related RM genes. However, most of them were highly divergent, and it was problematic to align such cases with confidence. For these reasons, we performed most of our analyses with local clades of 10–15 sequences, which could keep genetic divergence reasonably small and keep alignments robust for LRT analysis. In the hsdM, hsdS, hsdR, and Type II REase gene families, all site-specific models provided little or no evidence for positive selection (data not shown).

In contrast, with the MTase gene family, we obtained results indicating positive selection, and it was estimated that a total of 10.2% sites were likely to be positively selected ({omega} = 31.1, P < 0.001). Twelve highly homologous MTases (Sp-Mtase1, Sp-Mtase4, Av-Mtase2, A7-Mtase5, A7-Mtase10, A7-Mtase8, S6-Mtase1, Np-402028720, AAA50432, YP_199246, BAC81824, ZP_00517809), which could keep the alignment robust for LRT analysis, were used to construct a phylogenetic tree. Codon usage bias is known to affect the estimation of synonymous and nonsynonymous substitution rates (58). Thus two different codon usage bias models were used in all of our analyses: F3x4 and F61. The results under these two models were quite similar, and those under F3x4 were presented only. To examine the relationship of sites under positive selection to the protein structure, we mapped these sites onto the MTase tertiary structure (Fig. 7). First, the sequence alignment of MTase protein sequences (m5C family) previously used for PAML analysis was submitted to the protein-modeling server: SWISS-MODEL (http://swissmodel.expasy.org//SWISS-MODEL.html) with PDB-1dctA (39) as the modeling template. The derived structure using Av-MTase2 as the target sequence is shown in Fig. 7A. Several positively selected residues (482S, 484M, 494G, 507S, 508S) were located at the MTase COOH-terminal extension of ~50 aa, where no coordinate residues were found in the template (1dctA), and thus they could not be mapped onto the tertiary structure. Although the other predicted positively selected sites appeared to be relatively uniformly distributed along the protein sequence, a clear pattern was revealed when the sites were examined in relation to the tertiary structure: they were all exposed amino acids, and were clustered on one face of the dimer toward the nucleic acids (Fig. 7B). Two sites were located in the DNA-binding pocket: one was site 376A at the scaffold region of the small domain; another site, 197T, was located at one of the DNA backbone-binding motifs adjacent to the active site (39). Thus these sites were available to participate in DNA-protein interactions. Moreover, other sites were located at the helix D (206Q, 213E, 217N) or the coil linking ß3 and ß4 (126S, 131I).


Figure 7
View larger version (53K):
[in this window]
[in a new window]
 
Fig. 7. Mapping of the positively selected sites (in blue) in MTase onto their tertiary structures. A: ribbon diagram of AV-Mtase2 derived from homology modeling. B: a representation of the molecular surface of the MTase dimer. DNA molecules are in orange. Swiss-PDBviewer (12) and Grasp2 (35) were used for all structural manipulations.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
To date, more than 100 cyanobacterial strains are known to produce REases (41). Generally, only one or two REases were found in each strain of cyanobacteria through conventional methods to test the crude cell extracts for their restriction activity (29, 37). The main reason is the difficulty of detecting Type I RMs or solitary DNA MTases by biochemical or genetic assay (34, 41). Genome-wide screening of RM systems based on the genome-sequencing project, however, leads to a virtual explosion in the number of putative RM genes, which provides us a new and comprehensive insight into the cyanobacterial RM systems.

In this study, we have identified and analyzed a large number of putative RM genes from all the finished or ongoing cyanobacterial genomes. From Fig. 2 and Supplemental Table S1, we can see that more RM genes are found in filamentous cyanobacteria (Anabaena, Spirulina, Nostoc) than in unicellular species (Synechocystis, Synechococcus, Prochlorococcus). We also found that the bacterial or archaebacterial genomes in REBASE with a tremendously large number of RM genes are usually pathogenic bacteria (e.g., Campylobacter jejuni, H. pylori, Neisseria gonorrhoeae) or extremophiles (e.g., Chloroflexus aurantiacus, Methanocaldococcus jannaschii). Despite a wide variation in RM contents among closely related species, these pathogenic bacteria or extremophiles have a significantly higher number of RMs than the other species (t-test; P < 0.001). It is considered that such disproportionate expansion of certain gene families allows these organisms to adapt to a wider range of environmental conditions, or exploit a greater variety of nutrient sources (26). When we ruled out the chromosome size effect and calculated the relative number of defense-related genes out of the putative cluster of orthologous groups (COGs) in cyanobacteria, it is still significantly greater than that in unicellular species, and similar results were also found in the cyanobacterial signal transduction systems (P < 0.001; data not shown). Unicellular Prochlorococcus living in the oligotrophic open ocean possesses no, or a limited number of, RM systems, as well as other genes involved in environmental sensing and regulatory systems. Dufresne et al. (9) assumed that the major driving force behind genome reduction within the Prochlorococcus radiation has been a selective process favoring the adaptation of this organism to its environment. Most filamentous cyanobacteria exhibit a wide range of ecological tolerance and are found in freshwater, marine, and terrestrial habitats. A good example is Nostoc punctiforme, a filamentous nitrogen-fixing cyanobacterium that displays an extraordinarily wide range of vegetative cell developmental alternatives, physiological properties, and ecological niches, including broad symbiotic competences with plants and fungi (32). The identification of a new family of putative PD-(D/E)XK nucleases in various cyanobacteria also indicated that the expansion of such a nuclease family should be correlated with their host's ecological plasticity (11).

Nobusato et al. (36) analyzed all of the RM genes identified from the complete genome sequences of two H. pylori strains and found that these genes were scattered among diverse groups of bacteria in the phylogeny. Horizontal gene transfer may have a considerable influence on the widespread distribution of RM systems among bacteria (23). Similar results were found in the phylogenies of cyanobacterial RMs. However, most of the Type II or the solitary MTases in cyanobacterial genomes seemed to form a separate clade, in contrast to the wide, dispersed distribution of Type I RMs in the phylogeny. Matveyev et al. (31) considered the solitary MTases to be the ancient origin within cyanobacteria. Here, the MTases that fell out of the cyanobacterial clade were all solitary ones (Fig. 5), which shared higher similarities with their homologs in proteobacteria or firmicutes, whereas the solitary MTases in A. variabilis ATCC 29413 and S. platensis were all tightly grouped with the Type II MTases, indicating the horizontal gene transfer of the solitary MTases between cyanobacteria and other bacteria. In Spirulina, most of the MTases were identified to be orphan genes with the absence of their cognate REases in the closely linked loci. One explanation may be a failure in detection of the REase gene because of its high divergence or pseudogenization. The other concern was that RM genes were sequentially transferred into the host genome, with the modification gene being transferred first. These solitary genes may acquire a unique function compared with other MTases in RM systems (23, 47). Most of the Type I RM systems in cyanobacteria, however, seemed to be transferred en bloc. Three subunits of the Type I RM system, hsdM, hsdS, and hsdR, are usually closely linked. As shown in Figs. 4 and 6, the similar phylogenies of HsdM and HsdR and several highly coevolved motifs between two subunits suggest that en bloc lateral transfer of such linked genes and cooperative evolution should be more common in the Type I RM systems. After the host acquires the novel RM genes, sequence permutation or gene duplication seems to be the major mechanism in the diversification of RM systems (5, 16).

In Type I RM system, HsdR, HsdM, and HsdS form a complex (R2M2S1) to perform both endonuclease and MTase activities (4, 34, 55). Compared with the extensive literatures describing the conserved motifs in HsdM and HsdR and elucidating their functions, covariation analyses of both subunits are rare. Previous studies identified seven conserved motifs in the DEAD-Box of HsdR, and all these motifs are involved in the ATP binding/hydrolysis reaction (13). Here, we applied the CRASP method (1) to estimate correlation coefficients of six conserved domains in hsdM and hsdR proteins, and found a significant (at the 99.9% level) pairwise correlation among these domains. In the hsdR subunit, motifs I and II are directly involved in catalyzing the NTP hydrolysis reaction; motif Ia interacts with the sugar-phosphate backbone, whereas motif III is involved in hydrogen bond and stacking interactions with the DNA bases (13). Korolev et al. (27) found that residues in motifs Ia and III are in close proximity to a loop containing the aspartate and glutamate residues in motif II, suggesting a potential role for these regions in the transduction of energy from the ATPase site to the DNA molecule. Site-directed mutations in these motifs usually result in greatly decreased ATP hydrolysis and eliminated helicase activity (8, 13). Here, we identified that a large number of site pairs in these motifs are positively or negatively correlated, indicating these residues should function in forming a flexible hydrophobic hydrolysis pocket. It appears likely that subtle changes in ATP or DNA binding characteristics might arise through minor conformational changes associated with the structural interactions among these motifs. However, further experiments are required to examine such amino acid changes for their functional implications.

RM genes seem to be frequently exchanged between species (24) and to evolve quickly after invading the new host (17). To elucidate the selective pressure under the diversification of RM genes, the likelihood ratio test was employed to identify whether those common ancestral genes were under positive selection after they were transferred into the new hosts. Unlike the "arms race" effect occurring on other defense-related genes, no signature of adaptive evolution was found in the RM systems except some groups of MTases. Although we cannot rule out that some groups of genes in these families are under positive selection, it is the case in fact that many genes, especially for Type I RM systems, are pseudogenes in various states of decomposition (25, 31). Pairwise dN/dS analysis of Type I RM genes from closely related species also showed strong signatures of relaxed selective constraints rather than positive selection (data not shown). These findings strongly suggest that the evolution of RM genes does not follow the same pattern as most of the defense-related genes.

An exception is the MTase gene family, which has a total of 10.2% sites with elevated rates of nonsynonymous substitution. The majority of these residues could be precisely located on the MTase tertiary structure, which provides a structural interpretation of adaptive evolution. Two positively selected residues are located in the DNA-binding pocket, whereas the other five residues are located between motifs III and IV (126S, 131I) or VI and VII (206Q, 213E, 217N) when they are mapped onto the secondary structure of M.HaeIII (3, 39). Extensive studies revealed that the variable region between motifs VIII and IX determines specificity (6, 20, 33, 39). However, Timar et al. (49) found that two amino acid replacements between motifs VI and VII resulted in relaxed recognition specificity of SinI DNA-MTase, suggesting that some specificity-determining elements should be located in the large domain. LRT analysis also suggested that these regions were subjected to strong adaptive evolution, and some residue replacements in these motifs might have provided structural variations and thereby generated novel characteristics for the recognition of new target sites. It still remains unclear how positive selection really operated on such specificity-determining domains. Further studies focusing on the intraspecific homologous genes would be useful to address the role of selective pressure in such families.


    GRANTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by grants from the Key Innovative Project (KZCX3-SW-215) of the Chinese Academy of Sciences.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: S. Qin, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, 266071, China, and Q. Bao, Institute of Biomedical Informatics, Wenzhou Medical College, Wenzhou, 325000, China (e-mails: sqin{at}ms.qdio.ac.cn and baoqy{at}genomics.org.cn, respectively)

1 The Supplemental Material for this article (Supplemental Table S1) is available online at http://physiolgenomics.physiology.org/cgi/content/full/00255.2005/DC1. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Afonnikov DA and Kolchanov NA. CRASP: a program for analysis of coordinated substitutions in multiple alignments of protein sequences. Nucleic Acids Res 32: W64–W68, 2004.[Abstract/Free Full Text]
  2. Atchley WR, Wollenberg KR, Fitch WM, Terhalle W, and Dress AW. Correlations among amino acid sites in bHLH protein domains: an information theoretic analysis. Mol Biol Evol 17: 164–178, 2000.[Abstract/Free Full Text]
  3. Bujnicki JM. Homology modelling of the DNA 5mC methyltransferase M.BssHII. Is permutation of functional subdomains common to all subfamilies of DNA methyltransferases? Int J Biol Macromol 27: 195–204, 2000.[CrossRef][Web of Science][Medline]
  4. Bujnicki JM. Understanding the evolution of restriction-modification systems: clues from sequence and structure comparisons. Acta Biochim Pol 48: 935–967, 2001.[Web of Science][Medline]
  5. Bujnicki JM. Sequence permutations in the molecular evolution of DNA methyltransferases. BMC Evol Biol 2: 3, 2002.[CrossRef][Medline]
  6. Cheng X, Kumar S, Posfai J, Pflugrath JW, and Roberts RJ. Crystal structure of the HhaI methyltransferase complexed with S-adenosylmethionine. Cell 74: 299–307, 1993.[CrossRef][Web of Science][Medline]
  7. Crooks GE, Hon G, Chandonia JM, and Brenner SE. WebLogo: A sequence logo generator [Online]. http://weblogo.berkeley.edu [2004].
  8. Davies GP, Powell LM, Webb JL, Cooper LP, and Murray NE. EcoKI with an amino acid substitution in any one of seven DEAD-box motifs has impaired ATPase and endonuclease activities. Nucleic Acids Res 26: 4828–4836, 1998.[Abstract/Free Full Text]
  9. Dufresne A, Garczarek L, and Partensky F. Accelerated evolution associated with genome reduction in a free-living prokaryote. Genome Biol 6: R14, 2005.[CrossRef][Medline]
  10. Enomoto M, Oosawa K, and Momota H. Mapping of the pin locus coding for a site-specific recombinase that causes flagellar-phase variation in Escherichia coli K-12. J Bacteriol 156: 663–668, 1983.[Abstract/Free Full Text]
  11. Feder M and Bujnicki JM. Identification of a new family of putative PD-(D/E)XK nucleases with unusual phylogenomic distribution and a new type of the active site. BMC Genomics 6: 21, 2005.[CrossRef][Medline]
  12. Guex N, Diemand A, and Peitsch MC. Protein modelling for all. Trends Biochem Sci 24: 364–367, 1999.[CrossRef][Web of Science][Medline]
  13. Hall MC and Matson SW. Helicase motifs: the engine that powers DNA unwinding. Mol Microbiol 34: 867–877, 1999.[CrossRef][Web of Science][Medline]
  14. Henikoff S and Henikoff JG. Position-based sequence weights. J Mol Biol 243: 574–578, 1994.[CrossRef][Web of Science][Medline]
  15. Ibanez M, Alvarez I, Rodriguez-Pena JM, and Rotger R. A ColE1-type plasmid from Salmonella enteritidis encodes a DNA cytosine methyltransferase. Gene 196: 145–158, 1997.[CrossRef][Web of Science][Medline]
  16. Jeltsch A. Circular permutations in the molecular evolution of DNA methyltransferases. J Mol Evol 49: 161–164, 1999.[CrossRef][Web of Science][Medline]
  17. Jeltsch A and Pingoud A. Horizontal gene transfer contributes to the wide distribution and evolution of type II restriction-modification systems. J Mol Evol 42: 91–96, 1996.[CrossRef][Web of Science][Medline]
  18. Kawata Y, Yano S, Kojima H, and Toyomizu M. Transformation of Spirulina platensis strain C1 (Arthrospira sp. PCC9438) with Tn5 transposase-transposon DNA-cation liposome complex. Mar Biotechnol 6: 355–363, 2004.[CrossRef][Medline]
  19. Kinch LN, Ginalski K, Rychlewski L, and Grishin NV. Identification of novel restriction endonuclease-like fold families among hypothetical proteins. Nucleic Acids Res 33: 3598–3605, 2005.[Abstract/Free Full Text]
  20. Klimasauskas S, Nelson JL, and Roberts RJ. The sequence specificity domain of cytosine-C5 methylases. Nucleic Acids Res 19: 6183–6190, 1991.[Abstract/Free Full Text]
  21. Kneale GG. A symmetrical for the domain structure of type I DNA methyltransferases. J Mol Biol 243: 1–5, 1994.[CrossRef][Web of Science][Medline]
  22. Kobayashi I. Behavior of restriction-modification systems as selfish mobile elements and their impact on genome evolution. Nucleic Acids Res 29: 3742–3756, 2001.[Abstract/Free Full Text]
  23. Kobayashi I. Restriction-modification systems as minimal forms of life. In: Restriction Endonucleases, edited by Pingoud A. Berlin: Springer-Verlag, 2004, p.19–62.
  24. Kobayashi I, Nobusato A, Kobayashi-Takahashi N, and Uchiyama I. Shaping the genome restriction-modification systems as mobile genetic elements. Curr Opin Genet Dev 9: 649–656, 1999.[CrossRef][Web of Science][Medline]
  25. Kong H, Lin LF, Porter N, Stickel S, Byrd D, Posfai J, and Roberts RJ. Functional analysis of putative restriction-modification in the Helicobacter pylori J99 genome. Nucleic Acids Res 28: 3216–3223, 2000.[Abstract/Free Full Text]
  26. Konstantinidis KT and Tiedje JM. Trends between gene content and genome size in prokaryotic species with larger genomes. Proc Natl Acad Sci USA 101: 3160–3165, 2004.[Abstract/Free Full Text]
  27. Korolev S, Hsieh J, Gauss GH, Lohman TM, and Waksman G. Major domain swiveling revealed by the crystal structures of complexes of E. coli Rep helicase bound to single-stranded DNA and ADP. Cell 90: 635–647, 1997.[CrossRef][Web of Science][Medline]
  28. Kumar S, Tamura K, and Nei M. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform 5: 150–163, 2004.[Abstract/Free Full Text]
  29. Lyra C, Halme T, Torsti AM, Tenkanen T, and Sivonen K. Site-specific restriction endonucleases in cyanobacteria. J Appl Microbiol 89: 979–991, 2000.[CrossRef][Medline]
  30. MacWilliams MP and Bickle TA. Generation of new DNA binding specificity by truncation of the type IC EcoDXXI hsdS gene. EMBO J 15: 4775–4783, 1996.[Web of Science][Medline]
  31. Matveyev AV, Young KT, Meng A, and Elhai J. DNA methyltransferases of the cyanobacterium Anabaena PCC7120. Nucleic Acids Res 29: 1491–1506, 2001.[Abstract/Free Full Text]
  32. Meeks JC, Elhai J, Thiel T, Potts M, Larimer F, Lamerdin J, Predki P, and Atlas R. An overview of the genome of Nostoc punctiforme, a multicellular symbiotic cyanobacterium. Photosynth Res 70: 85–106, 2001.[CrossRef][Web of Science][Medline]
  33. Mi S and Roberts RJ. How M.MspI and M.HpaII decide which base to methylate. Nucleic Acids Res 20: 4811–4816, 1992.[Abstract/Free Full Text]
  34. Murray NE. Type I restriction systems: sophisticated molecular machines (a legacy of Bertani and Weigle). Microbiol Mol Biol Rev 64: 412–434, 2000.[Abstract/Free Full Text]
  35. Nicholls A, Sharp KA, and Honig B. Protein folding and association: insights from the interfacial and thermodynamic properties of hydrocarbons. Proteins 11: 281–296, 1991.[CrossRef][Web of Science][Medline]
  36. Nobusato A, Uchiyama I, and Kobayashi I. Diversity of restriction-modification gene homologues in Helicobacter pylori. Gene 259: 89–98, 2000.[CrossRef][Web of Science][Medline]
  37. Piechula S, Waleron K, Swiatek W, Biedrzycka I, and Podhajska AJ. Mesophilic cyanobacteria producing thermophilic restriction endonucleases. FEMS Microbiol Lett 198: 135–140, 2001.[CrossRef][Web of Science][Medline]
  38. Pollock DD and Taylor WR. Effectiveness of correlation analysis in identifying protein residues undergoing correlated evolution. Protein Eng 10: 647–657, 1997.[Abstract/Free Full Text]
  39. Reinisch KM, Chen L, Verdine GL, and Lipscomb WN. The crystal structure of HaeIII methyltransferase convalently complexed to DNA: an extrahelical cytosine and rearranged base pairing. Cell 82: 143–153, 1995.[CrossRef][Web of Science][Medline]
  40. Roberts RJ, Belfort M, Bestor T, Bhagwat AS, Bickle TA, Bitinaite J, Blumenthal RM, Degtyarev SK, Dryden DTF, Dybvig K, Firman K, Gromova ES, Gumport RI, Halford SE, Hattman S, Heitman J, Hornby DP, Janulaitis A, Jeltsch A, Josephsen J, Kiss A, Klaenhammer TR, Kobayashi I, Kong H, Kruger DH, Lacks S, Marinus MG, Miyahara M, Morgan RD, Murray NE, Nagaraja V, Piekarowicz A, Pingoud A, Raleigh E, Rao DN, Reich N, Repin VE, Selker EU, Shaw P, Stein DC, Stoddard BL, Szybalski W, Trautner TA, Van Etten JL, Vitor JMB, Wilson GG, and Xu S. A nomenclature for restriction enzymes, DNA methyltransferases, homing endonucleases and their genes. Nucleic Acids Res 31: 1805–1812, 2003.[Abstract/Free Full Text]
  41. Roberts RJ, Vincze T, Posfai J, and Macelis D. REBASE—restriction enzymes and DNA methyltransferases. Nucleic Acids Res 33: D230–D232, 2005.[Abstract/Free Full Text]
  42. Rocha EPC, Danchin A, and Viari A. Evolutionary role of restriction/modification systems as revealed by comparative genome analysis. Genome Res 11: 946–958, 2001.[Abstract/Free Full Text]
  43. Ruan H, Lunnen KD, Scott ME, Moran LS, Slatko BE, Pelletier JJ, Hess EJ, Benner J, Wilson GG, and Xu SY. Cloning and sequence comparison of AvaI and BsoBI restriction-modification systems. Mol Gen Genet 252: 695–699, 1996.[Web of Science][Medline]
  44. Schouler C, Gautier M, Duusko Ehrlich S, and Chopin MC. Combinational variation of restriction modification specificities in Lactococcus lactis. Mol Microbiol 28: 169–178, 1998.[CrossRef][Web of Science][Medline]
  45. Schultz J, Milpetz F, Bork P, and Ponting CP. SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci USA 95: 5857–5864, 1998.[Abstract/Free Full Text]
  46. Sonnhammer ELL, Eddy SR, Birney E, Bateman A, and Durbin R. Pfam: multiple sequence alignments and HMM-profiles of protein domains. Nucleic Acids Res 26: 320–322, 1998.[Abstract/Free Full Text]
  47. Takahashi N, Naito Y, Handa N, and Kobayashi I. A DNA methyltransferase can protect the genome from postdisturbance attack by a restriction-modification gene complex. J Bacteriol 184: 6100–6108, 2002.[Abstract/Free Full Text]
  48. Thompson JD, Higgins DG, and Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680, 1994.[Abstract/Free Full Text]
  49. Timar E, Groma G, Kiss A, and Venetianer P. Changing the recognition specificity of a DNA-methyltransferase by in vitro evolution. Nucleic Acids Res 32: 3898–3903, 2004.[Abstract/Free Full Text]
  50. Tomii K and Kanehisa M. Analysis of amino acid indices and mutation matrices for sequence comparison and structure prediction of proteins. Protein Eng 9: 27–36, 1996.[Abstract/Free Full Text]
  51. Tominaga A. The site-specific recombinase encoded by pinD in Shigella dysenteriae is due to the presence of a defective Mu prophage. Microbiology 143: 2057–2063, 1997.[Abstract/Free Full Text]
  52. Toyomizu M, Suzuki K, Kawata Y, Kojima H, and Akiba Y. Effective transformation of the cyanobacterium Spirulina platensis using electroporation. J Appl Phycol 13: 209–214, 2001.[CrossRef]
  53. Tragut V, Xiao J, Bylina EJ, and Borthakur D. Characterization of DNA restriction-modified systems in Spirulina platensis strain pacifica. J Appl Phycol 7: 561–564, 1995.[CrossRef]
  54. Vingron M and Argos P. A fast and sensitive multiple sequence alignment algorithm. Comput Appl Biosci 5: 115–121, 1989.[Abstract/Free Full Text]
  55. Wilson GG and Murray NE. Restriction and modification systems. Annu Rev Genet 25: 585–627, 1991.[CrossRef][Web of Science][Medline]
  56. Wong WSW, Yang ZH, Goldman N, and Nielsen R. Accuracy and power of statistical methods for detecting adaptive evolution in protein coding sequences and for identifying positively selected sites. Genetics 168: 1041–1051, 2004.[Abstract/Free Full Text]
  57. Yang Z and Bielawski JP. Statistical methods for detecting molecular adaptation. Trends Ecol Evol 15: 496–503, 2000.[CrossRef][Medline]
  58. Yang Z, Nielsen R, Goldman N, and Pedersen AM. Codon substitution models for heterogeneous selection pressure at amino acid sites. Genetics 15: 1600–1611, 2000.
  59. Yang ZH. PAML: a program package for phylogenetic analysis by maximum likelihood. Comput Appl Biosci 13: 555–556, 1997.[Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemtary Table and Figure
Right arrow All Versions of this Article:
24/3/181    most recent
00255.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, F.
Right arrow Articles by Qin, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, F.
Right arrow Articles by Qin, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.