Physiol. Genomics AJP: Renal Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 24: 86-96, 2006. First published November 8, 2005; doi:10.1152/physiolgenomics.00149.2005
1094-8341/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary material
Right arrow All Versions of this Article:
24/2/86    most recent
00149.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kanumilli, S.
Right arrow Articles by Usowicz, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kanumilli, S.
Right arrow Articles by Usowicz, M. M.
Received 27 June 2005; accepted in final form 7 November 2005.
Physiological Genomics 24:86-96 (2006)
1094-8341/05 $8.00 © 2006 American Physiological Society

Alternative splicing generates a smaller assortment of CaV2.1 transcripts in cerebellar Purkinje cells than in the cerebellum

Srinivasan Kanumilli , Elizabeth W. Tringham , C. Elizabeth Payne , Jonathan R. B. Dupere , Kanamarlapudi Venkateswarlu and Maria M. Usowicz

Department of Pharmacology, University of Bristol, Bristol, United Kingdom


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
P/Q-type calcium channels control many calcium-driven functions in the brain. The CACNA1A gene encoding the pore-forming CaV2.1 ({alpha}1A) subunit of P/Q-type channels undergoes alternative splicing at multiple loci. This results in channel variants with different phenotypes. However, the combinatorial patterns of alternative splice events at two or more loci, and hence the diversity of CaV2.1 transcripts, are incompletely defined for specific brain regions and types of brain neurons. Using RT-PCR and splice variant-specific primers, we have identified multiple CaV2.1 transcript variants defined by different pairs of splice events in the cerebellum of adult rat. We have uncovered new splice variations between exons 28 and 34 (some of which predict a premature stop codon) and a new variation in exon 47 (which predicts a novel extended COOH-terminus). Single cell RT-PCR reveals that each individual cerebellar Purkinje neuron also expresses multiple alternative CaV2.1 transcripts, but the assortment is smaller than in the cerebellum. Two of these variants encode different extended COOH-termini which are not the same as those previously reported in Purkinje cells of the mouse. Our patch-clamp recordings show that calcium channel currents in the soma and dendrites of Purkinje cells are largely inhibited by a concentration of {omega}-agatoxin IVA selective for P-type over Q-type channels, suggesting that the different transcripts may form phenotypic variants of P-type calcium channels in Purkinje cells. These results expand the known diversity of CaV2.1 transcripts in cerebellar Purkinje cells, and propose the selective expression of distinct assortments of CaV2.1 transcripts in different brain neurons and species.

splice variants; P type; calcium channels; Purkinje neurons


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
VOLTAGE-GATED calcium (Ca2+) channels regulate numerous cellular functions, from neuronal electrical activity to intracellular signaling pathways. Diversity of Ca2+ channels in the brain is apparent from the many roles that Ca2+ channels play in different cell types and subcellular compartments (3). The diversity reflects, in part, the existence of nine classes of the pore-forming CaV ({alpha}1) subunit in the brain and alternative pre-mRNA splicing of the gene encoding each class of CaV subunit (12, 17). P/Q-type Ca2+ channels control many functions throughout the brain and contain a CaV2.1 subunit (also known as {alpha}1A). However, information about splicing of the CACNA1A gene encoding CaV2.1 in different brain regions and neurons is incomplete (2, 5, 16, 30, 33, 35, 37). Augmentation of what is currently known about CaV2.1 splicing in the cerebellum and cerebellar Purkinje cells is of particular interest, because P-type currents in Purkinje cells are the prototypical P-type currents against which putative P-type and Q-type currents in other cells are compared, but it is not clear how many CaV2.1 transcript variants there are in Purkinje cells, or which ones harbor the different CACNA1A mutations associated with the loss of Purkinje cells in spinocerebellar ataxia type 6 and familial hemiplegic migraine (27).

Alternative splicing of CACNA1A at multiple loci has been demonstrated by the cloning of CaV2.1 cDNAs from various tissues and cells of different species (2, 8, 9, 14, 23, 31, 35, 35, 41) and by transcript mapping of CaV2.1 cDNAs from different regions of human brain, including the cerebellum (30). The combinatorial patterns of alternate splice events at two or more loci remain largely unidentified for CaV2.1 in the cerebellum, because each transcript analyzed in the transcript mapping study contained only a single splice locus. Furthermore, given the potential for species-specific splicing (26), it is unclear how accurately splicing in human cerebellum predicts splicing in the cerebellum of rodents, which are used for electrophysiological and pharmacological studies of native P/Q-type currents and for manipulation of CACNA1A (18). Similarly, the two CaV2.1 splice variants cloned from mouse Purkinje cells (35) may not be representative of Purkinje cells in other species, or they may not be the only variants in these cells. Here, we begin to address these issues by RT-PCR analysis of patterns of splicing in adult rat cerebellum and rat cerebellar Purkinje cells, and by searching for splice events known to occur in Purkinje cells of the mouse.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Isolation of cerebellar mRNA and PCR.
Adult male Wistar rats [aged >40 postnatal days (P40) or 150–175 g in weight], young male Wistar rats (P8 and P20), and adult male C57BL/6J mice (P42) were killed by cervical dislocation and decapitated in accordance with the Animals (Scientific Procedures) Act 1986, and protocols were approved by the University of Bristol Ethical Review Committee. cDNA was obtained from the cerebellar vermis and amplified by PCR using standard procedures. (For further details, see Supplemental Methods; available at the Physiological Genomics web site.)1

Design and experimental verification of splice variant specificity of primers.
Potential sites of splice variation were identified by aligning the sequences of known rodent CaV2.1 cDNAs (Fig. 1; OMIGA software or DS Gene software, Accelrys, Cambridge, UK). Primers (Table 1) were designed with the aid of Oligo 6.1 software (Molecular Biology Insights, Cascade, CO) and the basic local alignment search tool (BLAST) program at the National Center for Biotechnology Information (NCBI) to be specific for the different isoforms possible at each of the identified splice loci (Fig. 1) and to detect the mouse variant of exon 35 (Fig. 1). However, because the differences in some of the primers were as few as three, five, or six nucleotides, and primers straddling an exon deletion were homologous at their 3'- and 5'-ends to cDNAs without the deletion, there was the possibility that the primers might anneal nonspecifically. Therefore, the specificity of the PCR primers was experimentally confirmed on cloned cDNAs with known splicing patterns (n ≥ 3 for each primer pair; Fig. S1, Supplemental Methods). We also ensured the avoidance of PCR artifacts generated by the phenomenon of template switching through the use of small amounts (0.5–1 pg) of cerebellar cDNA (Fig. S1, Supplemental Methods).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1. Identification of probable sites of alternative splicing in the rodent CACNA1A gene. A: alignment of the sequences of known rodent Cav2.1 cDNAs (identified by GenBank accession no., where known, and tissue/cell of origin) reveals multiple sites of sequence variation, labeled 1–9 (numbered arrows). All the published variations are shown at each site and are portrayed as the presence or absence of amino acids (uppercase letters) or nucleotides (lowercase letters or nos.) or whole exons (e), or as differences in exon sequence (shading or a/b). [Sequences are based on reports or sequences deposited in public databases (2, 8, 14, 35, 40).] (Although not shown in the diagram, the 5'-regions of the partial pancreatic cDNAs deposited in GenBank are thought to be identical to that of the {alpha}1A-a variant.) B: location of the 9 sites of variation mapped onto the predicted secondary structure of Cav2.1, which is made up of 4 domains (I–IV), each consisting of 6 transmembrane segments (S1–6). This implies that the deletion of exon 33 (site 3) would remove much of the IVS5 segment, while differences between rat and mouse exon 35 result in four different amino acids in the P loop thought to line the pore. The insertion or deletion of nucleotides at the 5'-end of exon 47 (site 8) and the deletion of nucleotides (nt) from exon 47 further downstream (site 9) result in dissimilar shifts in the translational reading frame that differentially alter the length and amino acid composition of the COOH-terminus.

 

View this table:
[in this window]
[in a new window]
 
Table 1. PCR primers for analysis of splicing of the CACNA1A gene in the cerebellum and in cerebellar Purkinje cells of the rat

 
Harvesting and RT-PCR of Purkinje cell mRNA.
Parasagittal slices of cerebellar vermis (250 µm) were prepared from adult male Wistar rats (150–175 g, P40–P50; killed by cervical dislocation) as previously described (36). Individual slices were viewed on an FS Axioskop (Carl Zeiss, Welwyn Garden City, UK) and superfused with oxygenated (100% O2) HEPES-buffered solution (composition in mM: 133 NaCl, 2.5 KCl, 2.4 CaCl2, 10 D-glucose, 20 HEPES, 1.3 MgCl2, pH 7.4 with NaOH, filtered through a 0.22-µm filter). A whole cell voltage-clamp configuration was established with a patch pipette on individual Purkinje cells, and the cytoplasm was harvested by applying suction to the pipette. The pipette contents were expelled into a thin-walled PCR tube containing reagents necessary for reverse transcription, and the mRNA was reverse transcribed overnight. The resulting single cell cDNA was then amplified by PCR in two rounds. (For further details, see Supplemental Methods.)

Primers used to amplify across CaV2.1 splice regions and in control PCR reactions.
In addition to the pairs of primers specific for different CaV2.1 splice variations (Tables 1 and 2), other primers were designed to investigate splicing in the exon 31/32 region. The forward (F) and reverse (R) primers flanked this region and were as follows (5'-3'): exon27F, ctgctcacgctctttacggtgtc; exon30/31F, ttctgaattatttccgcgatgcctg; exon31F, acgaggatgtctgtgatgctg; exon35R, actctggtttttggatcccgg. To confirm that the PCR reactions had worked, PCR reactions included pairs of primers targeted against mRNAs differentially expressed by different types of neurons in the cerebellum. These were as follows (5'-3' sequences with predicted size of PCR product shown): calbindin D-28K (F, aggcacgaaagaaggctggat; R, tcccacacattttgattccctg; 432 bp) or the transcription factor zipro 1 (F, ggccctatgactgtaagtgtg; R, gtgtggactctctgatgcttg; 409 bp) or the GABAA{alpha}6 receptor subunit (F, atggactgatgagaggctga; R, tctgggacctctactgaataaagc; 342 bp) or GAD65 (F, tcttttctcctggtggtgcc; R, ccccaagcagcatccacat; 390 bp) or the NR2A and NR2C N-methyl-D-aspartate (NMDA) receptor subunits (F, ggggttctgcatcgacatcc; R, gacagcaaagaaggcccacac; 546 bp).


View this table:
[in this window]
[in a new window]
 
Table 2. Pairs of primers used to detect CaV2.1 splice variations in the cerebellum and in cerebellar Purkinje cells of the rat

 
Analysis of PCR products.
PCR products were usually identified according to size by agarose gel electrophoresis. Some were sequenced, either directly or after subcloning. (For further details, see Supplemental Methods.)

Cell-attached recording of Ca2+ channel currents.
The surface of the soma of a Purkinje cell or of the first dendritic bifurcation of a Purkinje cell was cleaned of overlying debris by applying a stream of extracellular solution from a pipette. Cell-attached recordings were made from the cleaned membrane with pipettes (thick-walled borosilicate glass capillaries; Harvard Apparatus, Kent, UK) filled with a filtered (0.2 µm) solution containing (in mM) 5 BaCl2, 10 CsCl, 10 HEPES, 134 or 150 TEA-Cl, 0.1 EGTA, pH 7.4 with TEA-OH, plus 1 µM TTX. For some recordings, the pipette solution also contained 30 or 100 nM {omega}-agatoxin IVA (Scientific Marketing Associates, Barnet, UK). Pipette resistances were 4–10 M{Omega} for somatic recordings and 6–13 M{Omega} for dendritic recordings. A depolarizing voltage ramp (170 mV, 0.53 mV/ms, starting 30–50 mV negative to the resting cell potential) followed by a repolarizing ramp was applied to the pipette every 5 s using a Cambridge Electronic Design (CED) 1401 plus A/D interface (Cambridge, UK). The evoked currents were low-pass filtered at 2 kHz and acquired at 7 kHz. At the end of cell-attached recording, a whole cell configuration was established to measure the cell resting potential. Patch potentials were calculated as the resting cell potential measured at the end of cell-attached recording (e.g., approximately –60 mV) minus the pipette holding potential (e.g., +40 mV) and minus the applied voltage ramp (from 0 to –170 mV). Thirty currents were recorded from each patch and averaged. A linear leak current was then subtracted to give the mean Ca2+ channel current. Recordings with drug-containing and drug-free pipettes were interleaved throughout each day of recording to ensure that any differences in current size were due to an effect of {omega}-agatoxin IVA and not due to variation arising from the use of different sets of pipettes with and without drug, or from the use of different animals on different days.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
CaV2.1 cDNA analysis and location of splice event-specific primers.
To design primers that would enable an investigation of alternative splicing of the CACNA1A gene in rat cerebellum and in individual cerebellar Purkinje cells with RT-PCR, sites of sequence variation in rodent CaV2.1 cDNAs were identified by aligning the sequences of cloned rodent CaV2.1 cDNAs. This comparison revealed nine sites of variation (Fig. 1A), many of which (1, 2, 6-8 in Fig. 1A) are now established as loci of alternative splicing by rat, mouse, and human genomic and cDNA analysis. Such analysis has determined that the –V, –VG, and VG variations (site 1) arise by the lengthening or shortening of the 5'-end of exon 10 during splicing (2, 30). The –NP and NP variations (site 2) arise by the exclusion or inclusion of a very short (6 nucleotides) exon 31a (2, 16, 30). Exons 37a and 37b (site 6) are alternate exons that are incorporated into transcripts in a mutually exclusive manner (2, 30), and exon 44 (site 7) is a cassette exon (13, 14, 30). Extension of the 5'-end of exon 47 by five nucleotides during splicing (ggcag, site 8) causes a shift in the reading frame that results in the translation of exon 47 and an extended COOH-terminus (9, 10, 13, 14, 28, 30, 33, 41).

The alignment also displays sites or patterns of variation in rodent Cav2.1 cDNAs not reported for other species. These include the coincident exclusion of exons 33, 36, and 37 (sites 3, 5, and 6), removal of three nucleotides (the stop codon, tag) from the 5'-end of exon 47 (site 8), and deletion of 150 nucleotides from exon 47 further downstream (site 9). Exclusion of the "tag" stop codon from the 5'-end of exon 47 during splicing results in the translation of exon 47. This encodes an extended COOH-terminus with no amino acid homology to that of the extended tail generated by the ggcag insertion (35). The mechanisms by which 150 nucleotides are deleted from exon 47 (site 9) remain to be elucidated. Finally, the differences in the sequences of exon 35 (site 4, 17 nucleotides of 151, 4 amino acids of 50) in mouse and rat Cav2.1 cDNAs are thought to be orthologous rather than splicing differences.

The various isoforms identified at the multiple locations are mapped on to the predicted membrane topology of the CaV2.1 subunit in Fig. 1B. To determine which of these variants are present in rat cerebellum and rat cerebellar Purkinje cells, PCR primers were designed to target each variation (Table 1). In addition, primers were designed to detect the inclusion or exclusion of exon 43 or both exons 43 and 44 (site 7, Fig. 1B), because transcripts differing in the presence or absence of these exons have been reported in a human cerebellar CaV2.1 cDNA library, and combinatorial inclusion and exclusion of exons 43 and 44 affect current amplitude and Ca2+-dependent channel inactivation (30).

Multiple CaV2.1 transcripts in rat cerebellum.
Twenty-six pairs of primers were used to investigate the occurrence of various splice events in rat cerebellar vermis (Table 2). Seven of these consisted of a splice isoform-specific primer (–V or –VG or VG; –NP or NP; ggcag or –tag) and a primer located in a nonspliced region (in exon 2 or exon 14 or exon 35 or exon 47). These were used to explore single splice events in different transcripts. One pair (mouse e35/e37aii) contained a forward primer specific for the mouse version of exon 35. In the remaining 18 pairs, each primer was specific for one splice isoform at one splice site. They were used to explore events at two splice sites within individual transcripts. For example, the gel in Fig. 2A depicts an investigation into the pairing of exon 37a or exon 37b with the presence or absence of exon 44 (e37a/e37b with e44/–e44), and the pairing of the presence or absence of the nucleotides encoding NP with the presence or absence of exon 44 (–NP/NP with e44/–e44).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 2. Identification of multiple Cav2.1 transcript variants with different splicing patterns in adult rat cerebellum. A: agarose gel (negative image) illustrating the amplification of transcripts with the PCR primers indicated. The lane marked "calb." depicts the amplification of calbindin D-28K, a positive control for PCR of cerebellar cDNA. B: histogram summarizing the frequency with which PCR products of expected size (Table 2) were generated by the pairs of primers indicated. Nos. in bars indicate the no. of experiments carried out with each pair of primers. Asterisk (*) denotes that the forward ggcag primer and the reverse e47 primer generated a single product (~400 bp) in 7 reactions and 2 products (~400 bp, ~300 bp) in an additional 2 reactions. Crossed circles denote splicing patterns that have not been previously observed in rat cerebellar transcripts. C: schematic diagram of the PCR products generated. Asterisk (*) emphasizes the generation of two ggcag-containing PCR products of distinct size. Numbered arrows refer to the sites of variation identified in Fig. 1.

 
The results of the PCR experiments on adult rat cerebellar cDNA are summarized in Fig. 2, B and C. In total, 19 of the 26 pairs of primers generated a PCR product in the majority of reactions. In agreement with previous in situ hybridization, immunoblotting, and RT-PCR studies (2, 5, 28, 37), the histogram confirms the generation of three isoforms by alternative splicing of nucleotides encoding valine and glycine (e2/–V, –VG/e14, and VG/e14 pairs of primers in Fig. 2B; site 1, Fig. 2C), transcripts with or without the NP-encoding nucleotides (–NP/e35 and NP/e35 pairs of primers in Fig. 2B; site 2, Fig. 2C), transcripts containing exon 37a or exon 37b (e.g., –NP/e37a, –NP/e37b, NP/e37a, NP/e37b pairs of primers in Fig. 2B; site 6, Fig. 2C), transcripts with exon 44 (e.g., e43/e44 pair of primers in Fig. 2B; site 7, Fig. 2C), and ggcag-containing transcripts (ggcag/e47 pair of primers in Fig. 2B; site 8, Fig. 2C). Our results also indicate the existence of transcripts with or without exon 44 in rat cerebellum (Fig. 2B; site 7, Fig. 2C). CaV2.1 transcripts lacking exon 44 have not been observed previously in rat cerebellum but have been detected in rat pancreas (14) and in human cerebellum (10, 30, 33) and human spinal cord (13).

The PCR experiments also uncovered the presence of multiple transcripts in adult rat cerebellum generated by different combinations of known splice events. As shown in Fig. 2, B and C, transcripts were detected containing the following: NP/exon 37a, NP/exon 37b, –NP/exon 37a, and –NP/exon 37b. Therefore, the two isoforms produced at each of these two splice loci occur in all four possible combinations. In addition, PCR detected all four possible combinations of exon 37a or 37b and exon 44 or –exon 44, and all four possible combinations of NP or –NP and exon 44 or –exon 44. Many of these pairings have not been observed previously in rat cerebellum (crossed circles in Fig. 2B). Some have not been observed in brain CaV2.1 transcripts of any species.

The mouse cerebellar Purkinje cell variant (Fig. 1A, AB066608) is characterized by the insertion of ggcag at the 5'-end of exon 47 and the deletion of 150 nucleotides from exon 47. Our experiments with the ggcag(e47)/e47 pair of primers did not provide evidence for such a transcript in rat cerebellum. Rather, these gave a PCR product that was of the size predicted (Table 2) for the ggcag-containing exon 47 of a rat pancreatic variant (Fig. 1A, AF051526) that does not contain the deletion (14). In two of these reactions, an additional smaller product was identified, but its size was marginally greater (~300 bp) than the size predicted (Table 2) by the ~150-nucleotide deletion. Sequencing of these products confirmed their lack of homology with the mouse cerebellar Purkinje cell variants (see below).

The absence of a PCR product in all or most reactions with the remaining seven pairs of primers suggests an absence of transcripts lacking exon 43; both exons 43 and 44; exons 33, 36, and 37; or tag at the 5'-end of exon 47 and an absence of transcripts containing the mouse version of exon 35 in combination with exon 37a. The PCR reactions were repeated on cerebellar cDNA of rats of different age to determine whether the splicing profile changes during postnatal development (4, 37) and whether age-related changes might explain why we were unable to detect some splice events known to occur in human or mouse cerebellum [i.e., –e43 or –e43–e44 or –tag(e47)]. We found that the CaV2.1 splice variations absent from P40 rat cerebellum were also absent from the cerebellum of P8 and P21 rats. However, two transcript variants (–VG and NP/e37b) present at P40 did not occur at P8 (Fig. S2, Supplemental Results), while some transcripts appeared to show a developmental increase in expression (ANOVA, P < 0.05). These were transcripts lacking the nucleotides for valine (–V), transcripts containing nucleotides encoding the NP insert, and transcripts with the combinations NP/exon 37a, NP/exon 37b, exon 37a/–exon 44, and exon 37b/–exon 44.

Further analysis of splicing in domain IV.
The NP insert (exon 31a) in the IVS3-4 extracellular loop (Fig. 1B) is important in determining the sensitivity to block by {omega}-agatoxin IVA and the electrophysiology of CaV2.1 channels (2, 9, 16, 33). We considered the possibility that splicing in this region might generate cerebellar transcripts with the NP-encoding exon flanked by novel sequences or transcripts in which the NP-encoding exon is replaced by other nucleotides, all of which would not be detectable with our NP and –NP primers that assume the simple inclusion and exclusion of a cassette exon. Therefore, PCR amplification was performed across this region with a reverse primer located in exon 35 and different forward primers (exon 27F, exon 30/31F, exon 31F). Subcloning and sequencing of 13 PCR products revealed 10 different splicing patterns, illustrated in Fig. 3. (The inferred splicing mechanisms are shown in Fig. S3, Supplemental Results). The majority (10/13) contained exon 31a, but only a minority of these (4/10) showed the simple incorporation of exon 31a (top 2 entries in Fig. 3). In the others, exon 31a was accompanied by alternative stretches of 24 or 168 nucleotides from the intron between exons 31 and 32 (EMBL-Bank accession nos.: AM040231, AM040232). One also included the intron between exons 33 and 34 (EMBL-Bank, AM040234), while another also lacked exon 33 (EMBL-Bank, AM040233). Additionally, two transcripts lacked exons 29, 30, 31, and 31a (EMBL-Bank, AM040230). The simple exclusion of exon 31a, which has been described previously for rat and human CaV2.1 (15, 30), was only observed in 1 of the 13 transcripts. The inclusion of additional nucleotides from the intron between exons 31a and 32 predicts the introduction of a premature termination codon, located several amino acids after exon 31a (Fig. S3, Supplemental Results). Even when we alter the reading frame of these insertions, as could happen if these splice events are combined with upstream splice events, the insertion of a stop codon is predicted, albeit in a different location.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3. Multiple CaV2.1 transcript variants in adult rat cerebellum generated by alternative splicing between exons 28 and 34. cDNAs were amplified with a variety of forward primers (F; located in exon 31a or at the exon 30/31 junction or in exon 27) and a reverse primer (R) in exon 35. The sequences of 13 cloned PCR products were compared with those of the known rodent CaV2.1 cDNAs and with rat CACNA1A using the Ensembl Genome Browser to deduce the 10 splicing patterns shown. Empty boxes, exons; shaded boxes, introns. Exons and introns are drawn on different scales. The intron lengths shown are according to those in the public rat gene sequence, except for introns between exons 29 and 30 and between exons 30 and 31, which remain to be defined (unknown lengths denoted by breaks). The no. immediately to the right of each variant indicates the no. of products (1 or 2) with that particular splicing pattern. The pairs of primers used to amplify these products are indicated further to the right.

 
CaV2.1 alternative splicing in single cerebellar Purkinje cells.
Having used RT-PCR to investigate splicing of CACNA1A in rat cerebellum, we used the same primers to investigate CaV2.1 splice variants in individual cerebellar Purkinje neurons of adult rat with single cell RT-multiplex PCR. To confirm that the PCR products were generated from Purkinje cell mRNA, and that there was no contamination from the numerous neighboring granule neurons, each reaction contained primers designed to amplify cDNAs for the transcription factor zipro 1 or the GABAA {alpha}6-receptor subunit, both of which are present only in granule cells (38, 39), and for calbindin D-28K, which is found almost exclusively in Purkinje cells (1). Some reactions also included primers that would amplify GAD65, which is expressed in all GABAergic neurons but not in granule cells, or NR2A/C NMDA receptor subunits, which are differentially expressed in adult rat cerebellar granule (NR2A, NR2C) and Purkinje cells (NR2C) (32). The ability of these primers to distinguish between Purkinje and granule neurons is demonstrated in Fig. 4.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4. Genotyping of cerebellar Purkinje cells. The PCR products shown in the agarose gels (negative images) were amplified from cDNA of the cerebellar vermis, a single Purkinje cell, and a single granule cell. A: all cDNAs were detected in the cerebellar vermis. B: as predicted for a Purkinje cell, there was amplification of calbindin D-28K and GAD65 but no amplification of GABAA receptor-{alpha}6 and zipro 1. C: in direct contrast with B, and as predicted for a granule cell, there was amplification of GABAA receptor-{alpha}6 and zipro 1 but not of calbindin D-28K and GAD65. In A, B, and C, there was the generation of an NR2 product, which serves as a positive control.

 
Single cell RT-multiplex PCR experiments with the CaV2.1 splice isoform-specific primers demonstrated the expression of multiple alternative CaV2.1 transcripts in single Purkinje neurons. This is exemplified by the simultaneous amplification of PCR products containing alternative splice combinations (exemplar gel in Fig. 5A) and of multiple (2 or 3) ggcag(e47)-containing products of distinct size (asterisk in Fig. 5, B and C). However, only 8 of 26 pairs of primers (Fig. 5, B and C) amplified a product in a majority of cells (67–89%). Six pairs generated PCR products in a minority of cells (12–15%; dashed lines in Fig. 5C), which may represent rare transcripts or false-positive results. This is in marked contrast with our finding that 19 pairs of primers generated a product from cerebellar cDNA in 65–100% reactions (Fig. 2B). For instance, of the three isoforms produced in the cerebellum by alternative splicing at the 5'-end of exon 10 (Fig. 2), the –V isoform was detected in the majority of Purkinje cells, the –VG isoform was undetected, and the VG isoform was detected in only 15% of cells. Likewise, of the NP and –NP isoforms produced in the cerebellum by the inclusion or exclusion of exon 31a, only the –NP isoform was detected in the majority of Purkinje cells. These results suggest that, although each Purkinje cell can expresses multiple transcript variants, regulation of alternative splicing at the level of the individual Purkinje cell results in a smaller range of CaV2.1 transcripts than in the whole cerebellum.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5. Individual cerebellar Purkinje neurons express a smaller assortment of multiple Cav2.1 variants than the cerebellum. A: representative gel (negative image) depicting the amplification of multiple transcripts from a single rat cerebellar Purkinje cell with pairs of primers designed against the splice variations indicated. B: histogram summarizing the frequency with which PCR products of expected size (Table 2) were generated by the pairs of primers indicated. Nos. in bars denote the no. of cells used for reactions with each pair of primers. Compare with histogram in Fig. 2. Asterisk (*) denotes that, in all successful reactions with the ggcag forward primer and the e47 reverse primer, multiple products of distinct size were amplified. C: schematic diagram of the transcripts detected. Solid lines, transcripts observed in 67–89% of cells; dotted lines, transcripts detected in 12–15% of cells. Asterisk (*) emphasizes the generation of 3 products containing the ggcag insert. The numbered arrows refer to the sites of variation identified in Fig. 1.

 
An inconsistency in the single cell RT-PCR data is that it was not possible to routinely amplify transcripts containing the splice combination –NP/exon 37b, even though we readily detected –NP transcripts (with –NP/e35 and –NP/e37a primer pairs) and exon 37b transcripts (with e37b/e44 or e37b/–e44 primer pairs). This discrepancy could arise if novel splicing events occur in the exon 30/32 region of transcripts containing exon 37b and are not detectable with our NP and –NP primers. In view of this, and because we found novel splicing events between exons 28 and 34 in the cerebellum, splicing in Purkinje cells was further investigated with primers located in exon 27 (forward) and exon 35 (reverse). Agarose gel electrophoresis revealed only a single band (n = 6 cells). The sequences of these PCR products (not shown), obtained by direct sequencing (n = 4 cells) or by subcloning and then sequencing (n = 5 cells), were identical to the equivalent regions in the known NP-lacking Cav2.1 cDNAs (Fig. 1). None of the products contained exon 31a and none displayed any of the novel forms of splicing between exons 28 and 34 detected in the cerebellum. Therefore, splicing in this region does not explain our inability to amplify cDNAs from Purkinje cells with the –NP and exon 37b splice combination. An alternative explanation that requires future investigation is that the sequence of exon 37b in these elusive transcripts is not the same as that in the cDNAs described to date and contains the sequence for the exon 37b forward primer but not for the exon 37b reverse primer, which is located downstream from the forward primer.

Our finding that the majority of CaV2.1 transcripts in Purkinje cells lack the NP-encoding exon is consistent with electrophysiological studies reporting almost complete block (90–95%) of Ca2+ channel currents in the soma of rat Purkinje cells (22) by concentrations of {omega}-agatoxin IVA considered to be selective for P-type (≤100 nM) over Q-type channels (≥100 nM) (21, 29, 34). However, because these previous electrophysiological studies were carried out on cells isolated from immature rats (20, 22), whereas our study was on CaV2.1 splicing in Purkinje cells in adult rat, we examined the sensitivity of Ca2+ channels in mature Purkinje cells to 30 nM {omega}-agatoxin IVA. Cell-attached recordings of Ca2+ channel currents (Fig. 6A) from the soma or the first dendritic bifurcation with drug-free pipettes or drug-containing pipettes (6, 36) demonstrated inhibition of the majority of the somatic Ca2+ channel current (92%, Fig. 6B) and of the dendritic current (91%, Fig. 6C). Increasing the concentration 10-fold to 300 nM did not increase block of somatic currents (n = 12), which suggests that other types of {omega}-agatoxin IVA-sensitive channels, such as Q-type channels, make no clear contribution to the remaining somatic current. It remains possible, however, that a higher concentration of {omega}-agatoxin IVA might have blocked this current, but we did not investigate further the pharmacological identity of this current or of the dendritic current resistant to block by 30 nM {omega}-agatoxin IVA.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 6. Confirmation that the majority of Ca2+ channel currents in mature rat cerebellar Purkinje cells is inhibited by P-type-selective concentrations of {omega}-agatoxin IVA. A: example of cell-attached recording. The black trace is the mean of 30 currents (superimposed gray traces) evoked by a voltage ramp (top) applied at 0.2 Hz to a single patch. The leak current (dotted line) was estimated by fitting a straight line to the linear part of the mean current and extrapolating it over the full range of the ramp. B: average current-voltage relationships recorded with drug-free pipette solution from 24 somatic patches (each patch was in a different cell) and with pipettes containing 30 nM {omega}-agatoxin IVA from 26 somatic patches. These were obtained by subtracting the leak current from the mean current obtained from each patch, plotting the current against patch potential, and averaging the resultant current-voltage relationships across patches. Vertical bars represent SE and, for clarity, are shown every ~10 mV rather than for every data point. C: average current-voltage relationships recorded with drug-free pipette solution from 32 dendritic patches and with pipettes containing 30 nM {omega}-agatoxin IVA from 9 dendritic patches.

 
Identity of CaV2.1 COOH-termini.
The largest of the PCR products containing the ggcag insert (exon 47) amplified from individual Purkinje cells (n = 5 cells) was identical in sequence (EMBL-Bank, AM040229) to that of the ggcag-containing exon 47 of the rat pancreatic AF05126 variant (14) (Fig. S4, Supplemental Results). The smaller product represents a novel transcript that contains a deletion of 123 nucleotides (Fig. S4; EMBL-Bank, AM040228). We identified the same exon 47 variants in cerebellar cDNA [and also confirmed the cerebellar expression of a transcript variant with a stop codon (tag) at the start of exon 47 (not shown), as in the rat brain M64373 variant; Fig. 1], using PCR primers flanking the 5'-end of exon 47 and the 123-nucleotide deletion (sequence not shown). The 123-nucleotide deletion is downstream from the epitope for an exon 47-specific antibody used previously to detect the translation of exon 47 in rat cerebellar Purkinje cells and in multiple rat cerebellar CaV2.1 protein isoforms (28). It is in a similar position to the 150-nucleotide deletion in the AB066608 variant cloned from mouse Purkinje neurons (35). The similar location supports the notion that the deletions arise by alternative splicing (35), but we could not compare the cDNA sequences with mouse or rat CACNA1A genes, because this region of the genes is incomplete in public genomic databases. The predicted amino acid sequences for the two exon 47 variants (Fig. 7) imply that, like mouse cerebellar Purkinje cells (35), rat cerebellar Purkinje cells may express at least two Cav2.1 variants with extended COOH-termini. However, these have little amino acid homology with the extended COOH-termini in cerebellar Purkinje cells of the mouse (Fig. 7) or with extended COOH-termini of human or rabbit CaV2.1 transcripts (9, 10, 13, 23, 28, 30, 33, 41).



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 7. Distinct amino acid sequences of predicted alternative extended CaV2.1 termini in rat cerebellar Purkinje cells. Predicted amino acid sequences for the ggcag-containing cDNAs amplified from cerebellar Purkinje cells (i and ii) are compared with the equivalent regions in the extended COOH-termini in a rat pancreatic variant and in 2 mouse cerebellar Purkinje cell variants (protein accession nos. indicated). The vertical arrow denotes the exon 46/47 boundary. Gray shading highlights identical amino acids in 2 or more sequences. Asterisk (*) identifies a stop codon.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study identifies multiple transcript variants of the CaV2.1 subunit in rat cerebellum, which are distinguished by different combinations of splice events and by novel splicing events. Our detection of a variety of splice variations in rat cerebellum (–V or –VG or VG, exon 10; –NP or NP, exon 31a; exon 37a or exon 37b; exon 44; ggcag or –ggcag, exon 47) confirms previous studies of rat cerebellar CaV2.1 mRNA, cDNA, and protein (2, 5, 28, 37). We also detect the lack of exon 44 in some transcripts, which was known to occur in rat pancreas (14) but not in rat cerebellum. CaV2.1 splice variations not previously documented in rat cerebellum, or in any other tissue or species, are the introduction of alternative premature stop codons shortly after the NP insert via the incorporation of alternative sections of the intron between exons 31a and 32, the inclusion of the intron between exons 33 and 34, the coincident exclusion of exons 29–31a, or the deletion of 123 nucleotides from within exon 47. We find that two alternative splicing events at exon 31a (NP or –NP) and exon 37 (a or b) occur in all four possible combinations. Likewise, two alternative splicing events at exon 37 (a or b) and exon 44 (exon 44 or –exon 44) occur in all four possible combinations. Different patterns of splicing at these three sites (exon 31a, exon 37, exon 44) may therefore generate eight distinct transcript variants. The actual number of variants in rat cerebellum may be higher, if each of the eight splicing patterns can take place within a transcript with any of the splice events identified at other sites, as well as with splice events not identified in this study.

Multiple CaV2.1 transcript variants are also present in individual mature Purkinje cells, but the range of splice variations is smaller than in the cerebellum: –V (exon 10), –NP (exon 31a), exon 37a or b, exon 44 or –exon 44, ggcag insert (exon 47), deletion of 123 nucleotides (exon 47). All of the splicing events and patterns identified in Purkinje cells occur in an individual cell. There appears to be no mutual exclusion of the two extended versions of exon 47, or of exon 37a and exon 37b, from individual neurons. Recent work (4) has suggested that exon 37a-containing transcripts predominate in Purkinje cells of young animals (P12), and in adult Purkinje cells, exon 37a protein is restricted to the soma, whereas exon 37b protein is in the soma and in dendrites. Our finding that the majority of CaV2.1 transcripts in mature rat Purkinje cells lack the NP-encoding exon is in agreement with an earlier prediction (2) and with the isolation of transcripts lacking the NP-encoding exon from mouse Purkinje cells (33, 35). The scarcity in rat Purkinje cells of splicing events that introduce a premature stop codon after the NP-encoding exon 31a in some cerebellar transcripts predicts a higher level of CaV2.1 protein expression in Purkinje cells than in other cerebellar cells, if the truncated CaV2.1 proteins encoded by these transcripts act in a dominant negative manner to inhibit the expression of full-length CaV2.1 proteins (12, 24, 25). A further difference between the cerebellum and Purkinje cells is that, in Purkinje cells, the two splice events at exon 37 (a or b) and the two splice events at exon 44 (inclusion or exclusion) do not occur in all four possible combinations. The exon 37a/–exon 44 combination was not detected.

Our finding that the exon 47 variants in cerebellar Purkinje cells of the rat are not the same as those in cerebellar Purkinje cells of the mouse (35) suggests species-specific alternative splicing at the level of the individual type of cell. The expression of the exon 47 variants found in rat or mouse Purkinje cells has not been intentionally explored in human cerebellar Purkinje cells, but none of the CaV2.1 cDNAs cloned from human cerebellum contains these variations. Differences in the COOH-terminus of CaV2.1 cDNAs obtained from various tissues and species indicate that this is a region of functional specialization that may underly species-specific differences in CaV2.1 channel expression and function (12, 17). We do not yet know what influence the predicted extended COOH-termini have on the expression or function of Ca2+ channels in rat cerebellar Purkinje cells. However, the two extended COOH-termini found in mouse cerebellar Purkinje cells have no effect on the electrophysiological properties or the sensitivity to block by {omega}-agatoxin IVA (35). Alternative roles for different COOH-termini may be the differential subcellular localization of the variants or differential interaction of the variants with intracellular proteins (19). Intriguingly, the position of the 123-nucleotide deletion in rat cerebellar Purkinje cells and the 150-nucleotide deletion in mouse cerebellar Purkinje cells coincides with the nucleotides encoding a polyglutamine tract in some human CaV2.1 protein isoforms (11, 41). Expansion of this tract by a gene mutation is associated with the neurological condition spinocerebellar ataxia 6 and selective degeneration of Purkinje cells (10, 41).

We have not yet investigated which of the transcript variants identified in rat cerebellum and rat Purkinje cells generate functional Ca2+ channels, nor the influence of the different patterns of splicing on channel properties. However, previous studies have investigated the functional impact of alternative splicing at exon 10, exon 31a, exon 37, or exon 44. They have shown that CaV2.1 channels without V in the I-II linker inactivate more rapidly, have briefer openings, are more readily blocked by G proteins, and are upregulated less by protein kinase C than channels with VG in the I-II linker (2). The absence of NP (exon 31a) in the IVS3-4 linker enhances the affinity of the channel for {omega}-agatoxin IVA, shifts the voltage dependence of activation and inactivation to more negative potentials, and speeds inactivation kinetics (2, 9, 16, 33). Inclusion of exon 37, a or b, generates two variants of an EF hand-like domain in the COOH-terminus that alter calcium/calmodulin-dependent facilitation of the channels, without affecting calcium/calmodulin-dependent inhibition (5). Exclusion of exon 44 from the COOH-terminus results in more rapid inactivation kinetics (13). These previous studies suggest that the multiplicity of transcript variants in the cerebellum that results from different combinations of splice events at multiple loci may be manifest as a broad range of phenotypic variants of P-type and Q-type Ca2+ channels with different but overlapping functional profiles (2). The smaller transcript diversity in Purkinje cells, together with the relatively low abundance in Purkinje cells of NP-containing transcripts (Ref. 35 and this study) and the block of ~90% of Ca2+ channel currents in immature (20) and adult Purkinje cells (this study) by P-type-selective concentrations of {omega}-agatoxin IVA, predicts the expression of subtypes of P-type channels in cerebellar Purkinje cells with different functional properties. These may underlie the distinct Ca2+ channel currents previously identified in cell-attached recordings from cerebellar Purkinje cells (Refs. 6, 7, and 36 and E. W. Tringham, C. E. Payne, and M. M. Usowicz, unpublished observations).


    GRANTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by the United Kingdom Medical Research Council (MRC) and the Royal Society. E. W. Tringham was in receipt of a University of Bristol PhD scholarship. C. E. Payne was in receipt of an MRC PhD scholarship. J. R. B. Dupere was in receipt of a Wellcome Trust PhD scholarship. K. Venkateswarlu was supported by a David Phillips Research Fellowship from the United Kingdom Biotechnology and Biological Sciences Research Council.


    ACKNOWLEDGMENTS
 
M. M. Usowicz is particularly grateful to A. C. Dolphin and K. M. Page for practical training in the early stages of this project. We are grateful for technical advice from L. Hall, J. Rossier, and B. Cauli. We thank B. Ligon, K. Dunlap, and T. P. Snutch for the gifts of CaV2.1 cDNA clones. A few experiments were carried out by R. Stewart or H. Gurney.

Present address of E. W. Tringham: NeuroMed Technologies Inc., Don Rix Bldg., 301-2389 Health Sciences Hall, Vancouver, British Columbia, V6T 1Z4, Canada.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: M. M. Usowicz, Dept. of Pharmacology, Univ. of Bristol, Univ. Walk, Bristol BS8 1TD, UK (e-mail: m.m.usowicz{at}bris.ac.uk)

10.1152/physiolgenomics.00149.2005.

1 The Supplemental Material for this article is available online at http://physiolgenomics.physiology.org/cgi/content/full/00149.2005/DC1. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Bastianelli E. Distribution of calcium-binding proteins in the cerebellum. Cerebellum 2: 242–262, 2003.[CrossRef][Web of Science][Medline]
  2. Bourinet E, Soong TW, Sutton K, Slaymaker S, Mathews E, Monteil A, Zamponi GW, Nargeot J, and Snutch TP. Splicing of {alpha}1A subunit gene generates phenotypic variants of P- and Q-type calcium channels. Nat Neurosci 2: 407–415, 1999.[CrossRef][Web of Science][Medline]
  3. Catterall WA. Structure and regulation of voltage-gated Ca2+ channels. Annu Rev Cell Dev Biol 16: 521–555, 2000.[CrossRef][Web of Science][Medline]
  4. Chaudhuri D, Alseikhan BA, Chang SY, Soong TW, and Yue DT. Developmental activation of calmodulin-dependent facilitation of cerebellar P-type Ca2+ current. J Neurosci 25: 8282–8294, 2005.[Abstract/Free Full Text]
  5. Chaudhuri D, Chang SY, DeMaria CD, Alvania RS, Soong TW, and Yue DT. Alternative splicing as a molecular switch for Ca2+/calmodulin-dependent facilitation of P/Q-type Ca2+ channels. J Neurosci 24: 6334–6342, 2004.[Abstract/Free Full Text]
  6. Dupere JR, Moya E, Blagbrough IS, and Usowicz MM. Differential inhibition of Ca2+ channels in mature rat cerebellar Purkinje cells by sFTX-3.3 and FTX-33. Neuropharmacology 35: 1–11, 1996.[CrossRef][Web of Science][Medline]
  7. Dupere JRB and Usowicz MM. Multiple types of Ca2+ channels in the soma and dendrites of adult rat cerebellar Purkinje cells. J Physiol 494P: 84–85, 1996.
  8. Fletcher CF, Lutz CM, O'Sullivan TN, Shaughnessy JD Jr, Hawkes R, Frankel WN, Copeland NG and Jenkins NA. Absence epilepsy in tottering mutant mice is associated with calcium channel defects. Cell 87: 607–617, 1996.[CrossRef][Web of Science][Medline]
  9. Hans M, Urrutia A, Deal C, Brust PF, Stauderman K, Ellis SB, Harpold MM, Johnson EC, and Williams ME. Structural elements in domain IV that influence biophysical and pharmacological properties of human {alpha}1A-containing high-voltage-activated calcium channels. Biophys J 76: 1384–1400, 1999.[Web of Science][Medline]
  10. Ishikawa K, Fujigasaki H, Saegusa H, Ohwada K, Fujita T, Iwamoto H, Komatsuzaki Y, Toru S, Toriyama H, Watanabe M, Ohkoshi N, Shoji S, Kanazawa I, Tanabe T, and Mizusawa H. Abundant expression and cytoplasmic aggregations of {alpha}1A voltage-dependent calcium channel protein associated with neurodegeneration in spinocerebellar ataxia type 6. Hum Mol Genet 8: 1185–1193, 1999.[Abstract/Free Full Text]
  11. Jodice C, Mantuano E, Veneziano L, Trettel F, Sabbadini G, Calandriello L, Francia A, Spadaro M, Pierelli F, Salvi F, Ophoff RA, Frants RR, and Frontali M. Episodic ataxia type 2 (EA2) and spinocerebellar ataxia type 6 (SCA6) due to CAG repeat expansion in the CACNA1A gene on chromosome 19p. Hum Mol Genet 6: 1973–1978, 1997.[Abstract/Free Full Text]
  12. Jurkat-Rott K and Lehmann-Horn F. The impact of splice isoforms on voltage-gated calcium channel {alpha}1 subunits. J Physiol 554: 609–619, 2004.[Abstract/Free Full Text]
  13. Krovetz HS, Helton TD, Crews AL, and Horne WA. C-terminal alternative splicing changes the gating properties of a human spinal cord calcium channel {alpha}1A subunit. J Neurosci 20: 7564–7570, 2000.[Abstract/Free Full Text]
  14. Ligon B, Boyd AE 3rd, and Dunlap K. Class A calcium channel variants in pancreatic islets and their role in insulin secretion. J Biol Chem 273: 13905–13911, 1998.[Abstract/Free Full Text]
  15. Lin Z, Haus S, Edgerton J, and Lipscombe D. Identification of functionally distinct isoforms of the N-type Ca2+ channel in rat sympathetic ganglia and brain. Neuron 18: 153–166, 1997.[CrossRef][Web of Science][Medline]
  16. Lin Z, Lin Y, Schorge S, Pan JQ, Beierlein M, and Lipscombe D. Alternative splicing of a short cassette exon in {alpha}1B generates functionally distinct N-type calcium channels in central and peripheral neurons. J Neurosci 19: 5322–5331, 1999.[Abstract/Free Full Text]
  17. Lipscombe D, Pan JQ, and Gray AC. Functional diversity in neuronal voltage-gated calcium channels by alternative splicing of Cav{alpha}1. Mol Neurobiol 26: 21–44, 2002.[CrossRef][Web of Science][Medline]
  18. Liu L, Zwingman TA, and Fletcher CF. In vivo analysis of voltage-dependent calcium channels. J Bioenerg Biomembr 35: 671–685, 2003.[CrossRef][Web of Science][Medline]
  19. Maximov A, Sudhof TC, and Bezprozvanny I. Association of neuronal calcium channels with modular adaptor proteins. J Biol Chem 274: 24453–24456, 1999.[Abstract/Free Full Text]
  20. Mintz IM, Adams ME, and Bean BP. P-type calcium channels in rat central and peripheral neurons. Neuron 9: 85–95, 1992.[CrossRef][Web of Science][Medline]
  21. Mintz IM and Bean BP. Block of calcium channels in rat neurons by synthetic omega-Aga-IVA. Neuropharmacology 32: 1161–1169, 1993.[CrossRef][Web of Science][Medline]
  22. Mintz IM, Venema VJ, Swiderek KM, Lee TD, Bean BP, and Adams ME. P-type calcium channels blocked by the spider toxin {omega}-Aga-IVA. Nature 355: 827–829, 1992.[CrossRef][Medline]
  23. Mori Y, Friedrich T, Kim MS, Mikami A, Nakai J, Ruth P, Bosse E, Hofmann F, Flockerzi V, and Furuichi T. Primary structure and functional expression from complementary DNA of a brain calcium channel. Nature 350: 398–402, 1991.[CrossRef][Medline]
  24. Okagaki R, Izumi H, Okada T, Nagahora H, Nakajo K, and Okamura Y. The maternal transcript for truncated voltage-dependent Ca2+ channels in the ascidian embryo: a potential suppressive role in Ca2+ channel expression. Dev Biol 230: 258–277, 2001.[CrossRef][Web of Science][Medline]
  25. Page KM, Heblich F, Davies A, Butcher AJ, Leroy J, Bertaso F, Pratt WS, and Dolphin AC. Dominant-negative calcium channel suppression by truncated constructs involves a kinase implicated in the unfolded protein response. J Neurosci 24: 5400–5409, 2004.[Abstract/Free Full Text]
  26. Pan Q, Bakowski MA, Morris Q, Zhang W, Frey BJ, Hughes TR, and Blencowe BJ. Alternative splicing of conserved exons is frequently species-specific in human and mouse. Trends Genet 21: 73–77, 2005.[CrossRef][Web of Science][Medline]
  27. Pietrobon D. Calcium channels and channelopathies of the central nervous system. Mol Neurobiol 25: 31–50, 2002.[CrossRef][Web of Science][Medline]
  28. Restituito S, Thompson RM, Eliet J, Raike RS, Riedl M, Charnet P, and Gomez CM. The polyglutamine expansion in spinocerebellar ataxia type 6 causes a ß subunit-specific enhanced activation of P/Q-type calcium channels in Xenopus oocytes. J Neurosci 20: 6394–6403, 2000.[Abstract/Free Full Text]
  29. Sidach SS and Mintz IM. Low-affinity blockade of neuronal N-type Ca channels by the spider toxin {omega}-agatoxin-IVA. J Neurosci 20: 7174–7182, 2000.[Abstract/Free Full Text]
  30. Soong TW, DeMaria CD, Alvania RS, Zweifel LS, Liang MC, Mittman S, Agnew WS, and Yue DT. Systematic identification of splice variants in human P/Q-type channel {alpha}12.1 subunits: implications for current density and Ca2+-dependent inactivation. J Neurosci 22: 10142–10152, 2002.[Abstract/Free Full Text]
  31. Starr TV, Prystay W, and Snutch TP. Primary structure of a calcium channel that is highly expressed in the rat cerebellum. Proc Natl Acad Sci USA 88: 5621–5625, 1991.[Abstract/Free Full Text]
  32. Thompson CL, Drewery DL, Atkins HD, Stephenson FA, and Chazot PL. Immunohistochemical localization of N-methyl-D-aspartate receptor NR1, NR2A, NR2B and NR2C/D subunits in the adult mammalian cerebellum. Neurosci Lett 283: 85–88, 2000.[CrossRef][Web of Science][Medline]
  33. Toru S, Murakoshi T, Ishikawa K, Saegusa H, Fujigasaki H, Uchihara T, Nagayama S, Osanai M, Mizusawa H, and Tanabe T. Spinocerebellar ataxia type 6 mutation alters P-type calcium channel function. J Biol Chem 275: 10893–10898, 2000.[Abstract/Free Full Text]
  34. Tottene A, Moretti A, and Pietrobon D. Functional diversity of P-type and R-type calcium channels in rat cerebellar neurons. J Neurosci 16: 6353–6363, 1996.[Abstract/Free Full Text]
  35. Tsunemi T, Saegusa H, Ishikawa K, Nagayama S, Murakoshi T, Mizusawa H, and Tanabe T. Novel Cav2.1 splice variants isolated from Purkinje cells do not generate P-type Ca2+ current. J Biol Chem 277: 7214–7221, 2002.[Abstract/Free Full Text]
  36. Usowicz MM, Sugimori M, Cherksey B, and Llinas R. P-type calcium channels in the somata and dendrites of adult cerebellar Purkinje cells. Neuron 9: 1185–1199, 1992.[CrossRef][Web of Science][Medline]
  37. Vigues S, Gastaldi M, Massacrier A, Cau P, and Valmier J. The {alpha}1A subunits of rat brain calcium channels are developmentally regulated by alternative RNA splicing. Neuroscience 113: 509–517, 2002.[CrossRef][Web of Science][Medline]
  38. Wisden W, Korpi ER, and Bahn S. The cerebellum: a model system for studying GABAA receptor diversity. Neuropharmacology 35: 1139–1160, 1996.[CrossRef][Web of Science][Medline]
  39. Yang XW, Zhong R, and Heintz N. Granule cell specification in the developing mouse brain as defined by expression of the zinc finger transcription factor RU49. Development 122: 555–566, 1996.[Abstract]
  40. Yu AS, Hebert SC, Brenner BM, and Lytton J. Molecular characterization and nephron distribution of a family of transcripts encoding the pore-forming subunit of Ca2+ channels in the kidney. Proc Natl Acad Sci USA 89: 10494–10498, 1992.[Abstract/Free Full Text]
  41. Zhuchenko O, Bailey J, Bonnen P, Ashizawa T, Stockton DW, Amos C, Dobyns WB, Subramony SH, Zoghbi HY, and Lee CC. Autosomal dominant cerebellar ataxia (SCA6) associated with small polyglutamine expansions in the {alpha}1A-voltage-dependent calcium channel. Nat Genet 15: 62–69, 1997.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
BloodHome page
X. Wu, J. R. Darce, S. K. Chang, G. S. Nowakowski, and D. F. Jelinek
Alternative splicing regulates activation-induced cytidine deaminase (AID): implications for suppression of AID mutagenic activity in normal and malignant B cells
Blood, December 1, 2008; 112(12): 4675 - 4682.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
E. W. Tringham, J. R. B. Dupere, C. E. Payne, and M. M. Usowicz
Protease Treatment of Cerebellar Purkinje Cells Renders {omega}-Agatoxin IVA-Sensitive Ca2+ Channels Insensitive to Inhibition by {omega}-Conotoxin GVIA
J. Pharmacol. Exp. Ther., February 1, 2008; 324(2): 806 - 814.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. C. E. Wykes, C. S. Bauer, S. U. Khan, J. L. Weiss, and E. P. Seward
Differential Regulation of Endogenous N- and P/Q-Type Ca2+ Channel Inactivation by Ca2+/Calmodulin Impacts on Their Ability to Support Exocytosis in Chromaffin Cells
J. Neurosci., May 9, 2007; 27(19): 5236 - 5248.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
E. W. Tringham, C. E. Payne, J. R. B. Dupere, and M. M. Usowicz
Maturation of rat cerebellar Purkinje cells reveals an atypical Ca2+ channel current that is inhibited by {omega}-agatoxin IVA and the dihydropyridine (-)-(S)-Bay K8644
J. Physiol., February 1, 2007; 578(3): 693 - 714.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. J. Castiglioni, J. Raingo, and D. Lipscombe
Alternative splicing in the C-terminus of CaV2.2 controls expression and gating of N-type calcium channels
J. Physiol., October 1, 2006; 576(1): 119 - 134.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary material
Right arrow All Versions of this Article:
24/2/86    most recent
00149.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kanumilli, S.
Right arrow Articles by Usowicz, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kanumilli, S.
Right arrow Articles by Usowicz, M. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.