|
|
||||||||
Department of Pharmacology, University of Bristol, Bristol, United Kingdom
| ABSTRACT |
|---|
|
|
|---|
1A) subunit of P/Q-type channels undergoes alternative splicing at multiple loci. This results in channel variants with different phenotypes. However, the combinatorial patterns of alternative splice events at two or more loci, and hence the diversity of CaV2.1 transcripts, are incompletely defined for specific brain regions and types of brain neurons. Using RT-PCR and splice variant-specific primers, we have identified multiple CaV2.1 transcript variants defined by different pairs of splice events in the cerebellum of adult rat. We have uncovered new splice variations between exons 28 and 34 (some of which predict a premature stop codon) and a new variation in exon 47 (which predicts a novel extended COOH-terminus). Single cell RT-PCR reveals that each individual cerebellar Purkinje neuron also expresses multiple alternative CaV2.1 transcripts, but the assortment is smaller than in the cerebellum. Two of these variants encode different extended COOH-termini which are not the same as those previously reported in Purkinje cells of the mouse. Our patch-clamp recordings show that calcium channel currents in the soma and dendrites of Purkinje cells are largely inhibited by a concentration of
-agatoxin IVA selective for P-type over Q-type channels, suggesting that the different transcripts may form phenotypic variants of P-type calcium channels in Purkinje cells. These results expand the known diversity of CaV2.1 transcripts in cerebellar Purkinje cells, and propose the selective expression of distinct assortments of CaV2.1 transcripts in different brain neurons and species. splice variants; P type; calcium channels; Purkinje neurons
| INTRODUCTION |
|---|
|
|
|---|
1) subunit in the brain and alternative pre-mRNA splicing of the gene encoding each class of CaV subunit (12, 17). P/Q-type Ca2+ channels control many functions throughout the brain and contain a CaV2.1 subunit (also known as
1A). However, information about splicing of the CACNA1A gene encoding CaV2.1 in different brain regions and neurons is incomplete (2, 5, 16, 30, 33, 35, 37). Augmentation of what is currently known about CaV2.1 splicing in the cerebellum and cerebellar Purkinje cells is of particular interest, because P-type currents in Purkinje cells are the prototypical P-type currents against which putative P-type and Q-type currents in other cells are compared, but it is not clear how many CaV2.1 transcript variants there are in Purkinje cells, or which ones harbor the different CACNA1A mutations associated with the loss of Purkinje cells in spinocerebellar ataxia type 6 and familial hemiplegic migraine (27). Alternative splicing of CACNA1A at multiple loci has been demonstrated by the cloning of CaV2.1 cDNAs from various tissues and cells of different species (2, 8, 9, 14, 23, 31, 35, 35, 41) and by transcript mapping of CaV2.1 cDNAs from different regions of human brain, including the cerebellum (30). The combinatorial patterns of alternate splice events at two or more loci remain largely unidentified for CaV2.1 in the cerebellum, because each transcript analyzed in the transcript mapping study contained only a single splice locus. Furthermore, given the potential for species-specific splicing (26), it is unclear how accurately splicing in human cerebellum predicts splicing in the cerebellum of rodents, which are used for electrophysiological and pharmacological studies of native P/Q-type currents and for manipulation of CACNA1A (18). Similarly, the two CaV2.1 splice variants cloned from mouse Purkinje cells (35) may not be representative of Purkinje cells in other species, or they may not be the only variants in these cells. Here, we begin to address these issues by RT-PCR analysis of patterns of splicing in adult rat cerebellum and rat cerebellar Purkinje cells, and by searching for splice events known to occur in Purkinje cells of the mouse.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Design and experimental verification of splice variant specificity of primers.
Potential sites of splice variation were identified by aligning the sequences of known rodent CaV2.1 cDNAs (Fig. 1; OMIGA software or DS Gene software, Accelrys, Cambridge, UK). Primers (Table 1) were designed with the aid of Oligo 6.1 software (Molecular Biology Insights, Cascade, CO) and the basic local alignment search tool (BLAST) program at the National Center for Biotechnology Information (NCBI) to be specific for the different isoforms possible at each of the identified splice loci (Fig. 1) and to detect the mouse variant of exon 35 (Fig. 1). However, because the differences in some of the primers were as few as three, five, or six nucleotides, and primers straddling an exon deletion were homologous at their 3'- and 5'-ends to cDNAs without the deletion, there was the possibility that the primers might anneal nonspecifically. Therefore, the specificity of the PCR primers was experimentally confirmed on cloned cDNAs with known splicing patterns (n
3 for each primer pair; Fig. S1, Supplemental Methods). We also ensured the avoidance of PCR artifacts generated by the phenomenon of template switching through the use of small amounts (0.51 pg) of cerebellar cDNA (Fig. S1, Supplemental Methods).
|
|
Primers used to amplify across CaV2.1 splice regions and in control PCR reactions.
In addition to the pairs of primers specific for different CaV2.1 splice variations (Tables 1 and 2), other primers were designed to investigate splicing in the exon 31/32 region. The forward (F) and reverse (R) primers flanked this region and were as follows (5'-3'): exon27F, ctgctcacgctctttacggtgtc; exon30/31F, ttctgaattatttccgcgatgcctg; exon31F, acgaggatgtctgtgatgctg; exon35R, actctggtttttggatcccgg. To confirm that the PCR reactions had worked, PCR reactions included pairs of primers targeted against mRNAs differentially expressed by different types of neurons in the cerebellum. These were as follows (5'-3' sequences with predicted size of PCR product shown): calbindin D-28K (F, aggcacgaaagaaggctggat; R, tcccacacattttgattccctg; 432 bp) or the transcription factor zipro 1 (F, ggccctatgactgtaagtgtg; R, gtgtggactctctgatgcttg; 409 bp) or the GABAA
6 receptor subunit (F, atggactgatgagaggctga; R, tctgggacctctactgaataaagc; 342 bp) or GAD65 (F, tcttttctcctggtggtgcc; R, ccccaagcagcatccacat; 390 bp) or the NR2A and NR2C N-methyl-D-aspartate (NMDA) receptor subunits (F, ggggttctgcatcgacatcc; R, gacagcaaagaaggcccacac; 546 bp).
|
Cell-attached recording of Ca2+ channel currents.
The surface of the soma of a Purkinje cell or of the first dendritic bifurcation of a Purkinje cell was cleaned of overlying debris by applying a stream of extracellular solution from a pipette. Cell-attached recordings were made from the cleaned membrane with pipettes (thick-walled borosilicate glass capillaries; Harvard Apparatus, Kent, UK) filled with a filtered (0.2 µm) solution containing (in mM) 5 BaCl2, 10 CsCl, 10 HEPES, 134 or 150 TEA-Cl, 0.1 EGTA, pH 7.4 with TEA-OH, plus 1 µM TTX. For some recordings, the pipette solution also contained 30 or 100 nM
-agatoxin IVA (Scientific Marketing Associates, Barnet, UK). Pipette resistances were 410 M
for somatic recordings and 613 M
for dendritic recordings. A depolarizing voltage ramp (170 mV, 0.53 mV/ms, starting 3050 mV negative to the resting cell potential) followed by a repolarizing ramp was applied to the pipette every 5 s using a Cambridge Electronic Design (CED) 1401 plus A/D interface (Cambridge, UK). The evoked currents were low-pass filtered at 2 kHz and acquired at 7 kHz. At the end of cell-attached recording, a whole cell configuration was established to measure the cell resting potential. Patch potentials were calculated as the resting cell potential measured at the end of cell-attached recording (e.g., approximately 60 mV) minus the pipette holding potential (e.g., +40 mV) and minus the applied voltage ramp (from 0 to 170 mV). Thirty currents were recorded from each patch and averaged. A linear leak current was then subtracted to give the mean Ca2+ channel current. Recordings with drug-containing and drug-free pipettes were interleaved throughout each day of recording to ensure that any differences in current size were due to an effect of
-agatoxin IVA and not due to variation arising from the use of different sets of pipettes with and without drug, or from the use of different animals on different days.
| RESULTS |
|---|
|
|
|---|
The alignment also displays sites or patterns of variation in rodent Cav2.1 cDNAs not reported for other species. These include the coincident exclusion of exons 33, 36, and 37 (sites 3, 5, and 6), removal of three nucleotides (the stop codon, tag) from the 5'-end of exon 47 (site 8), and deletion of 150 nucleotides from exon 47 further downstream (site 9). Exclusion of the "tag" stop codon from the 5'-end of exon 47 during splicing results in the translation of exon 47. This encodes an extended COOH-terminus with no amino acid homology to that of the extended tail generated by the ggcag insertion (35). The mechanisms by which 150 nucleotides are deleted from exon 47 (site 9) remain to be elucidated. Finally, the differences in the sequences of exon 35 (site 4, 17 nucleotides of 151, 4 amino acids of 50) in mouse and rat Cav2.1 cDNAs are thought to be orthologous rather than splicing differences.
The various isoforms identified at the multiple locations are mapped on to the predicted membrane topology of the CaV2.1 subunit in Fig. 1B. To determine which of these variants are present in rat cerebellum and rat cerebellar Purkinje cells, PCR primers were designed to target each variation (Table 1). In addition, primers were designed to detect the inclusion or exclusion of exon 43 or both exons 43 and 44 (site 7, Fig. 1B), because transcripts differing in the presence or absence of these exons have been reported in a human cerebellar CaV2.1 cDNA library, and combinatorial inclusion and exclusion of exons 43 and 44 affect current amplitude and Ca2+-dependent channel inactivation (30).
Multiple CaV2.1 transcripts in rat cerebellum.
Twenty-six pairs of primers were used to investigate the occurrence of various splice events in rat cerebellar vermis (Table 2). Seven of these consisted of a splice isoform-specific primer (V or VG or VG; NP or NP; ggcag or tag) and a primer located in a nonspliced region (in exon 2 or exon 14 or exon 35 or exon 47). These were used to explore single splice events in different transcripts. One pair (mouse e35/e37aii) contained a forward primer specific for the mouse version of exon 35. In the remaining 18 pairs, each primer was specific for one splice isoform at one splice site. They were used to explore events at two splice sites within individual transcripts. For example, the gel in Fig. 2A depicts an investigation into the pairing of exon 37a or exon 37b with the presence or absence of exon 44 (e37a/e37b with e44/e44), and the pairing of the presence or absence of the nucleotides encoding NP with the presence or absence of exon 44 (NP/NP with e44/e44).
|
The PCR experiments also uncovered the presence of multiple transcripts in adult rat cerebellum generated by different combinations of known splice events. As shown in Fig. 2, B and C, transcripts were detected containing the following: NP/exon 37a, NP/exon 37b, NP/exon 37a, and NP/exon 37b. Therefore, the two isoforms produced at each of these two splice loci occur in all four possible combinations. In addition, PCR detected all four possible combinations of exon 37a or 37b and exon 44 or exon 44, and all four possible combinations of NP or NP and exon 44 or exon 44. Many of these pairings have not been observed previously in rat cerebellum (crossed circles in Fig. 2B). Some have not been observed in brain CaV2.1 transcripts of any species.
The mouse cerebellar Purkinje cell variant (Fig. 1A, AB066608) is characterized by the insertion of ggcag at the 5'-end of exon 47 and the deletion of 150 nucleotides from exon 47. Our experiments with the ggcag(e47)/e47 pair of primers did not provide evidence for such a transcript in rat cerebellum. Rather, these gave a PCR product that was of the size predicted (Table 2) for the ggcag-containing exon 47 of a rat pancreatic variant (Fig. 1A, AF051526) that does not contain the deletion (14). In two of these reactions, an additional smaller product was identified, but its size was marginally greater (
300 bp) than the size predicted (Table 2) by the
150-nucleotide deletion. Sequencing of these products confirmed their lack of homology with the mouse cerebellar Purkinje cell variants (see below).
The absence of a PCR product in all or most reactions with the remaining seven pairs of primers suggests an absence of transcripts lacking exon 43; both exons 43 and 44; exons 33, 36, and 37; or tag at the 5'-end of exon 47 and an absence of transcripts containing the mouse version of exon 35 in combination with exon 37a. The PCR reactions were repeated on cerebellar cDNA of rats of different age to determine whether the splicing profile changes during postnatal development (4, 37) and whether age-related changes might explain why we were unable to detect some splice events known to occur in human or mouse cerebellum [i.e., e43 or e43e44 or tag(e47)]. We found that the CaV2.1 splice variations absent from P40 rat cerebellum were also absent from the cerebellum of P8 and P21 rats. However, two transcript variants (VG and NP/e37b) present at P40 did not occur at P8 (Fig. S2, Supplemental Results), while some transcripts appeared to show a developmental increase in expression (ANOVA, P < 0.05). These were transcripts lacking the nucleotides for valine (V), transcripts containing nucleotides encoding the NP insert, and transcripts with the combinations NP/exon 37a, NP/exon 37b, exon 37a/exon 44, and exon 37b/exon 44.
Further analysis of splicing in domain IV.
The NP insert (exon 31a) in the IVS3-4 extracellular loop (Fig. 1B) is important in determining the sensitivity to block by
-agatoxin IVA and the electrophysiology of CaV2.1 channels (2, 9, 16, 33). We considered the possibility that splicing in this region might generate cerebellar transcripts with the NP-encoding exon flanked by novel sequences or transcripts in which the NP-encoding exon is replaced by other nucleotides, all of which would not be detectable with our NP and NP primers that assume the simple inclusion and exclusion of a cassette exon. Therefore, PCR amplification was performed across this region with a reverse primer located in exon 35 and different forward primers (exon 27F, exon 30/31F, exon 31F). Subcloning and sequencing of 13 PCR products revealed 10 different splicing patterns, illustrated in Fig. 3. (The inferred splicing mechanisms are shown in Fig. S3, Supplemental Results). The majority (10/13) contained exon 31a, but only a minority of these (4/10) showed the simple incorporation of exon 31a (top 2 entries in Fig. 3). In the others, exon 31a was accompanied by alternative stretches of 24 or 168 nucleotides from the intron between exons 31 and 32 (EMBL-Bank accession nos.: AM040231, AM040232). One also included the intron between exons 33 and 34 (EMBL-Bank, AM040234), while another also lacked exon 33 (EMBL-Bank, AM040233). Additionally, two transcripts lacked exons 29, 30, 31, and 31a (EMBL-Bank, AM040230). The simple exclusion of exon 31a, which has been described previously for rat and human CaV2.1 (15, 30), was only observed in 1 of the 13 transcripts. The inclusion of additional nucleotides from the intron between exons 31a and 32 predicts the introduction of a premature termination codon, located several amino acids after exon 31a (Fig. S3, Supplemental Results). Even when we alter the reading frame of these insertions, as could happen if these splice events are combined with upstream splice events, the insertion of a stop codon is predicted, albeit in a different location.
|
6-receptor subunit, both of which are present only in granule cells (38, 39), and for calbindin D-28K, which is found almost exclusively in Purkinje cells (1). Some reactions also included primers that would amplify GAD65, which is expressed in all GABAergic neurons but not in granule cells, or NR2A/C NMDA receptor subunits, which are differentially expressed in adult rat cerebellar granule (NR2A, NR2C) and Purkinje cells (NR2C) (32). The ability of these primers to distinguish between Purkinje and granule neurons is demonstrated in Fig. 4.
|
|
Our finding that the majority of CaV2.1 transcripts in Purkinje cells lack the NP-encoding exon is consistent with electrophysiological studies reporting almost complete block (9095%) of Ca2+ channel currents in the soma of rat Purkinje cells (22) by concentrations of
-agatoxin IVA considered to be selective for P-type (
100 nM) over Q-type channels (
100 nM) (21, 29, 34). However, because these previous electrophysiological studies were carried out on cells isolated from immature rats (20, 22), whereas our study was on CaV2.1 splicing in Purkinje cells in adult rat, we examined the sensitivity of Ca2+ channels in mature Purkinje cells to 30 nM
-agatoxin IVA. Cell-attached recordings of Ca2+ channel currents (Fig. 6A) from the soma or the first dendritic bifurcation with drug-free pipettes or drug-containing pipettes (6, 36) demonstrated inhibition of the majority of the somatic Ca2+ channel current (92%, Fig. 6B) and of the dendritic current (91%, Fig. 6C). Increasing the concentration 10-fold to 300 nM did not increase block of somatic currents (n = 12), which suggests that other types of
-agatoxin IVA-sensitive channels, such as Q-type channels, make no clear contribution to the remaining somatic current. It remains possible, however, that a higher concentration of
-agatoxin IVA might have blocked this current, but we did not investigate further the pharmacological identity of this current or of the dendritic current resistant to block by 30 nM
-agatoxin IVA.
|
|
| DISCUSSION |
|---|
|
|
|---|
Multiple CaV2.1 transcript variants are also present in individual mature Purkinje cells, but the range of splice variations is smaller than in the cerebellum: V (exon 10), NP (exon 31a), exon 37a or b, exon 44 or exon 44, ggcag insert (exon 47), deletion of 123 nucleotides (exon 47). All of the splicing events and patterns identified in Purkinje cells occur in an individual cell. There appears to be no mutual exclusion of the two extended versions of exon 47, or of exon 37a and exon 37b, from individual neurons. Recent work (4) has suggested that exon 37a-containing transcripts predominate in Purkinje cells of young animals (P12), and in adult Purkinje cells, exon 37a protein is restricted to the soma, whereas exon 37b protein is in the soma and in dendrites. Our finding that the majority of CaV2.1 transcripts in mature rat Purkinje cells lack the NP-encoding exon is in agreement with an earlier prediction (2) and with the isolation of transcripts lacking the NP-encoding exon from mouse Purkinje cells (33, 35). The scarcity in rat Purkinje cells of splicing events that introduce a premature stop codon after the NP-encoding exon 31a in some cerebellar transcripts predicts a higher level of CaV2.1 protein expression in Purkinje cells than in other cerebellar cells, if the truncated CaV2.1 proteins encoded by these transcripts act in a dominant negative manner to inhibit the expression of full-length CaV2.1 proteins (12, 24, 25). A further difference between the cerebellum and Purkinje cells is that, in Purkinje cells, the two splice events at exon 37 (a or b) and the two splice events at exon 44 (inclusion or exclusion) do not occur in all four possible combinations. The exon 37a/exon 44 combination was not detected.
Our finding that the exon 47 variants in cerebellar Purkinje cells of the rat are not the same as those in cerebellar Purkinje cells of the mouse (35) suggests species-specific alternative splicing at the level of the individual type of cell. The expression of the exon 47 variants found in rat or mouse Purkinje cells has not been intentionally explored in human cerebellar Purkinje cells, but none of the CaV2.1 cDNAs cloned from human cerebellum contains these variations. Differences in the COOH-terminus of CaV2.1 cDNAs obtained from various tissues and species indicate that this is a region of functional specialization that may underly species-specific differences in CaV2.1 channel expression and function (12, 17). We do not yet know what influence the predicted extended COOH-termini have on the expression or function of Ca2+ channels in rat cerebellar Purkinje cells. However, the two extended COOH-termini found in mouse cerebellar Purkinje cells have no effect on the electrophysiological properties or the sensitivity to block by
-agatoxin IVA (35). Alternative roles for different COOH-termini may be the differential subcellular localization of the variants or differential interaction of the variants with intracellular proteins (19). Intriguingly, the position of the 123-nucleotide deletion in rat cerebellar Purkinje cells and the 150-nucleotide deletion in mouse cerebellar Purkinje cells coincides with the nucleotides encoding a polyglutamine tract in some human CaV2.1 protein isoforms (11, 41). Expansion of this tract by a gene mutation is associated with the neurological condition spinocerebellar ataxia 6 and selective degeneration of Purkinje cells (10, 41).
We have not yet investigated which of the transcript variants identified in rat cerebellum and rat Purkinje cells generate functional Ca2+ channels, nor the influence of the different patterns of splicing on channel properties. However, previous studies have investigated the functional impact of alternative splicing at exon 10, exon 31a, exon 37, or exon 44. They have shown that CaV2.1 channels without V in the I-II linker inactivate more rapidly, have briefer openings, are more readily blocked by G proteins, and are upregulated less by protein kinase C than channels with VG in the I-II linker (2). The absence of NP (exon 31a) in the IVS3-4 linker enhances the affinity of the channel for
-agatoxin IVA, shifts the voltage dependence of activation and inactivation to more negative potentials, and speeds inactivation kinetics (2, 9, 16, 33). Inclusion of exon 37, a or b, generates two variants of an EF hand-like domain in the COOH-terminus that alter calcium/calmodulin-dependent facilitation of the channels, without affecting calcium/calmodulin-dependent inhibition (5). Exclusion of exon 44 from the COOH-terminus results in more rapid inactivation kinetics (13). These previous studies suggest that the multiplicity of transcript variants in the cerebellum that results from different combinations of splice events at multiple loci may be manifest as a broad range of phenotypic variants of P-type and Q-type Ca2+ channels with different but overlapping functional profiles (2). The smaller transcript diversity in Purkinje cells, together with the relatively low abundance in Purkinje cells of NP-containing transcripts (Ref. 35 and this study) and the block of
90% of Ca2+ channel currents in immature (20) and adult Purkinje cells (this study) by P-type-selective concentrations of
-agatoxin IVA, predicts the expression of subtypes of P-type channels in cerebellar Purkinje cells with different functional properties. These may underlie the distinct Ca2+ channel currents previously identified in cell-attached recordings from cerebellar Purkinje cells (Refs. 6, 7, and 36 and E. W. Tringham, C. E. Payne, and M. M. Usowicz, unpublished observations).
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
Present address of E. W. Tringham: NeuroMed Technologies Inc., Don Rix Bldg., 301-2389 Health Sciences Hall, Vancouver, British Columbia, V6T 1Z4, Canada.
| FOOTNOTES |
|---|
Address for reprint requests and other correspondence: M. M. Usowicz, Dept. of Pharmacology, Univ. of Bristol, Univ. Walk, Bristol BS8 1TD, UK (e-mail: m.m.usowicz{at}bris.ac.uk)
10.1152/physiolgenomics.00149.2005.
1 The Supplemental Material for this article is available online at http://physiolgenomics.physiology.org/cgi/content/full/00149.2005/DC1. ![]()
| REFERENCES |
|---|
|
|
|---|
1A subunit gene generates phenotypic variants of P- and Q-type calcium channels. Nat Neurosci 2: 407415, 1999.[CrossRef][ISI][Medline]
1A-containing high-voltage-activated calcium channels. Biophys J 76: 13841400, 1999.
1A voltage-dependent calcium channel protein associated with neurodegeneration in spinocerebellar ataxia type 6. Hum Mol Genet 8: 11851193, 1999.
1 subunits. J Physiol 554: 609619, 2004.
1A subunit. J Neurosci 20: 75647570, 2000.
1B generates functionally distinct N-type calcium channels in central and peripheral neurons. J Neurosci 19: 53225331, 1999.
1. Mol Neurobiol 26: 2144, 2002.[CrossRef][ISI][Medline]
-Aga-IVA. Nature 355: 827829, 1992.[CrossRef][Medline]
-agatoxin-IVA. J Neurosci 20: 71747182, 2000.
12.1 subunits: implications for current density and Ca2+-dependent inactivation. J Neurosci 22: 1014210152, 2002.
1A subunits of rat brain calcium channels are developmentally regulated by alternative RNA splicing. Neuroscience 113: 509517, 2002.[CrossRef][Medline]
1A-voltage-dependent calcium channel. Nat Genet 15: 6269, 1997.[CrossRef][ISI][Medline]This article has been cited by other articles:
![]() |
E. W. Tringham, J. R. B. Dupere, C. E. Payne, and M. M. Usowicz Protease Treatment of Cerebellar Purkinje Cells Renders {omega}-Agatoxin IVA-Sensitive Ca2+ Channels Insensitive to Inhibition by {omega}-Conotoxin GVIA J. Pharmacol. Exp. Ther., February 1, 2008; 324(2): 806 - 814. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. E. Wykes, C. S. Bauer, S. U. Khan, J. L. Weiss, and E. P. Seward Differential Regulation of Endogenous N- and P/Q-Type Ca2+ Channel Inactivation by Ca2+/Calmodulin Impacts on Their Ability to Support Exocytosis in Chromaffin Cells J. Neurosci., May 9, 2007; 27(19): 5236 - 5248. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. W. Tringham, C. E. Payne, J. R. B. Dupere, and M. M. Usowicz Maturation of rat cerebellar Purkinje cells reveals an atypical Ca2+ channel current that is inhibited by {omega}-agatoxin IVA and the dihydropyridine (-)-(S)-Bay K8644 J. Physiol., February 1, 2007; 578(3): 693 - 714. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Castiglioni, J. Raingo, and D. Lipscombe Alternative splicing in the C-terminus of CaV2.2 controls expression and gating of N-type calcium channels J. Physiol., October 1, 2006; 576(1): 119 - 134. [Abstract] [Full Text] |