Physiol. Genomics Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 23: 79-88, 2005. First published July 26, 2005; doi:10.1152/physiolgenomics.00279.2004
1094-8341/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
23/1/79    most recent
00279.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maloyan, A.
Right arrow Articles by Horowitz, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maloyan, A.
Right arrow Articles by Horowitz, M.
Received 23 November 2004; accepted in final form 20 July 2005.
Physiological Genomics 23:79-88 (2005)
1094-8341/05 $8.00 © 2005 American Physiological Society

HIF-1{alpha}-targeted pathways are activated by heat acclimation and contribute to acclimation-ischemic cross-tolerance in the heart

Alina Maloyan 1, Luba Eli-Berchoer 1, Gregg L. Semenza 2, Gary Gerstenblith 3, Michael D. Stern 4 and Michal Horowitz 1

1 Laboratory of Environmental Physiology, Faculty of Dental Medicine, The Hebrew University, Jerusalem, Israel; 2 Vascular Program, Institute for Cell Engineering, 3 Division of Cardiology, Department of Medicine, Johns Hopkins University School of Medicine; and 4 National Institute of Aging, Gerontology Research Center, Baltimore, Maryland


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Hypoxia-inducible factor-1 (HIF-1) is a key regulator of the cellular hypoxic response. We previously showed that HIF-1 activation is essential for heat acclimation (AC) in Caenorhabditis elegans. Metabolic changes in AC rat hearts indicate HIF-1{alpha} activation in mammals as well. Here we characterize the HIF-1{alpha} profile and the transcriptional activation of its target genes following AC and following heat stress (HS) in hearts from nonacclimated (C; 24°C) and AC (34°C, 1 mo) rats. We used Western blot and immunohistochemistry to measure HIF-1{alpha} levels and EMSA and RT-PCR/quantitative RT-PCR to detect expression of the HIF-1{alpha}-targeted genes, including vascular endothelial growth factor (Vegf), heme oxygenase-1 (HO1), erythropoietin (Epo), and Epo receptor (EpoR). EpoR and Epo mRNA levels were measured to determine systemic effects in the kidneys and cross-tolerance effects in C and AC ischemic hearts (Langendorff, 75% ischemia, 40 min). The results demonstrated that 1) after AC, HIF-1{alpha} protein levels were increased, 2) HS alone induced transient HIF-1{alpha} upregulation, and 3) VEGF and HO1 mRNA levels increased after HS, with greater magnitude in the AC hearts. Epo mRNA in AC kidneys and EpoR mRNA in AC hearts were also elevated. In AC hearts, EpoR expression was markedly higher after HS or ischemia. Hearts from AC rats were dramatically protected against infarction after ischemia-perfusion. We conclude that HIF-1 contributes to the acclimation-ischemia cross-tolerance mechanism in the heart by induction of both chronic and inducible adaptive components.

hypoxia-inducible factor-1{alpha}; vascular endothelial growth factor; erythropoietin; erythropoietin receptor; heme oxygenase-1; heat stress


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
HEAT ACCLIMATION, A CONSERVED adaptive response induced by prolonged exposure to increased ambient temperatures, confers protection against acute heat stress (HS) and delays thermal injury (20, 43). Adaptation to one environmental stressor can also induce augmented protective responses to other stressors without preexposure to the new stressors due to the activation of common protective pathways (cross-tolerance) (17). Induction of the heat-acclimated phenotype involves reprogramming of gene expression (8, 20, 39), as well as posttranslational changes (30). A recent study revealed an important heat-acclimatory response involving changes in the expression of genes encoding cytoprotective protein networks, including the anti-apoptotic, anti-oxidation, and heat shock protein protective cascades. Enhancement of these inducible pathways is associated with protection against delayed tissue injury during exposure to acute HS (20).

Biochemical and physiological adaptive modalities of heat acclimation can help us to identify additional molecular adaptations. Metabolic adaptations occurring in the heat-acclimated heart include a doubling of cardiac glycogen reserves, greater glucose uptake (9) and upregulation of the glucose transporters GLUT-1 and -4 (E. Levi and M. Horowitz, unpublished observations), overexpression of 6-phosphofructo-2-kinase-2 (PFK-2) transcript, and enhancement of glyceraldehyde-3-phosphate dehydrogenase activation (6, 9). The heat-acclimated heart also demonstrates a slower rate of glycogen utilization during ischemia (9) compared with the nonacclimated heart. Thus, when oxygen supply is limited, glycolysis-derived ATP supplementation increases long-term performance. This cardioprotection is long lasting (~2 wk; Ref. 6) and is achieved through a "cross-tolerance" between heat acclimation and hypoxic adaptation (9, 20).

Oxygen deprivation evokes a cascade of adaptive responses to compensate for decreased aerobic ATP production, for which the hypoxia-inducible factor-1 (HIF-1) transcriptional system, acting as a master regulator of the expression of oxygen-regulated genes, is responsible (44). Functional HIF-1 is a heterodimer composed of HIF-1{alpha} and HIF-1ß (also called aryl hydrocarbon receptor nuclear translocator or ARNT) subunits that dimerize and bind to DNA by means of basic helix-loop-helix-PAS (bHLH-PAS) domains (22, 41, 44). Whereas HIF-1ß is expressed constitutively in the cell, HIF-1{alpha} levels increase during oxygen deprivation. Activated HIF-1 induces expression of various genes whose products play an adaptive role under hypoxic conditions (44, 51). Genes related to oxygen and energy homeostasis [e.g., erythropoietin (Epo); Ref. 10] and glycolytic enzymes (e.g., Enolase 1, Aldolase A) were the first to be recognized as HIF-1 targets. To date, >70 putative HIF-1 target genes involved in various cytoprotective pathways are known (44, 51). HIF-1 can also mediate adaptations to chronic stressful situations as seen during adaptation to chronic hypoxia (45) or altitude (47). Accumulation of HIF-1{alpha} in the cell and, in turn, its transcriptional activation are also triggered by oxygen-independent pathways, such as several hormones, cytokines, and growth factors (e.g., insulin, insulin-like growth factors) under normoxic conditions (5, 11, 12, 14, 28, 36, 42, 50, 54, 56), and in response to reactive oxygen species (ROS) and nitric oxide signaling (4, 14, 23, 26, 34, 37).

Taken together, this evidence led us to hypothesize that HIF-1 is also associated with the heat-acclimatory metabolic response. Maloyan et al. (31), in preliminary experiments using the rat heart, and Z. Bromberg and M. Horowitz (unpublished observations) and Katschinski et al. (24), using mouse hearts, showed that heat acclimation and HS increase HIF-1{alpha} levels. The molecular chaperoning activity of heat shock protein-90 (HSP90) was associated with its translocation to the nucleus (24). Nevertheless, on the basis of the aldolase A and Glut-1 (an additional HIF-1 target) transcript profile in heat-stressed HepG2 cells, Katchinski et al. concluded that HS does not activate HIF-1{alpha}. In contrast, in a nematode genetic model, our finding that HIF-1 knockout Caenorhabditis elegans cannot acclimate to heat suggests that HIF-1 is essential, but perhaps not sufficient, for heat acclimation (49). Whether the role played by HIF-1 in the pathway to heat acclimation stems from its involvement in metabolic functions is not yet clear. Our findings of increased endothelial nitric oxide synthase (eNOS) production in the vasculature (15), or upregulation of AP1 and p53 (21) following heat acclimation in mammals, also implicate pathways that are not directly related to energy flux.

To substantiate a functional role for HIF-1 in mammalian heat acclimation, the purpose of the present investigation was to 1) characterize the HIF-1{alpha} expression profile during heat acclimation, 2) demonstrate HIF-1 transcriptional activation during heat acclimation and HS, and 3) link HIF-1 activation to heat acclimation-mediated cross-tolerance. We decided to study the HIF-1 target gene Vegf, encoding vascular endothelial growth factor, a stimulator of new blood vessel formation, and HO1, encoding heme oxygenase-1, a small heat stress-induced protein associated with heme proteins and upregulated by oxidative and heat stress (7, 34). The heart, which has been studied more extensively than other organs with respect to heat acclimation (9, 17, 20), was chosen for these experiments. To determine whether HIF-1{alpha} has systemic effects, Epo mRNA levels were measured in the kidney (where erythropoietin is produced), and EpoR (Epo receptor) mRNA levels were measured in the heart (where Epo has been shown to have a protective effect against ischemia-reperfusion injury; Refs. 2, 3, 52).

The results of this investigation provide evidence that, in rats, 1) HIF-1{alpha} levels are increased after long-term heat acclimation, 2) HIF-1{alpha} expression is transiently upregulated after acute HS, and 3) HIF-1 activates target genes after HS with greater magnitude in the heat-acclimated phenotype. We suggest that the hypoxia response pathway is an intrinsic part of the heat acclimation repertoire and that the HIF-1 pathway contributes to cross-tolerance against ischemia.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals and experimental paradigms.
Male 3-wk-old Rattus norvegicus (Zabar strain, albino variety), initially weighing 80–90 g, were fed Ambar laboratory chow with water ad libitum. The animals were randomly assigned to heat-acclimated (AC) and control normothermic (C) groups. Both groups were subdivided into groups that received no additional treatment, those that were subjected to HS and subsequent recovery, and those that were assigned to cross-tolerance experiments. Several experimental paradigms were conducted to study HIF-1{alpha} activation (for details see Fig. 1). These included 1) measurements of HIF-1{alpha} and -1ß levels under the various experimental conditions, 2) HIF-1{alpha} cellular localization, and 3) HIF-1 DNA binding to the hypoxia response element and transcriptional activation of target genes.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. Protocol bar illustrating experimental plan. Transcripts and proteins, unless specified, were measured in the heart. For details, see text. C, controls (at 24°C); AC, long-term heat acclimation (30 days at 34°C); HS, heat stress (at 41°C); Tc, colonic temperature; Normo-P, normoperfusion (at 37°C); GI, global ischemia (at 37°C); WB, Western immunoblot; HIF, hypoxia-inducible factor; VEGF, vascular endothelial growth factor; Epo, erythropoietin; EpoR, erythropoietin receptor; HO1, hemoxygenase-1.

 
All experimental protocols were approved by the Ethics Committee for Animal Experimentation of The Hebrew University, Jerusalem, Israel.

Experimental conditions.
The C group was held at an ambient temperature of 24 ± 1°C; heat acclimation was attained by a continuous exposure to 34 ± 1°C and 30–40% relative humidity in a light-cycled room (12:12 h) for 30 days (long-term acclimation), as previously described (15). The efficacy of this treatment has been previously validated using the decrease in heart rate as a criterion (18). For characterization of the effects of HS on C and AC rats, the animals were subjected to HS at 41°C for 2 h. During HS, the colonic temperature (Tc) was monitored online, using a YL 402 thermistor inserted 6 cm beyond the anal sphincter and attached to a computerized data acquisition system. On termination of each treatment, the animals were allowed to recover for 0, 30, and 60 min at room temperature (at 24°C) and were then killed by cervical dislocation (30, 32). The hearts were removed, and the left ventricles were carefully excised and either stored at –70°C until biochemical analysis or fixed for immunohistochemistry. The kidneys were removed and stored as above.

For the cross-tolerance experiments, hearts of nonacclimated and heat-acclimated rats were rapidly removed as above, mounted on a Langendorff perfusion system, and retrogradely perfused with Krebs-Henseleit buffer containing (in mM) 120 NaCl, 4.7 KCl, 1.2 MgSO4, 1.2 KH2PO4, 1.25 CaCl2, 25 NaHCO3, and 11 glucose, at pH 7.4, and aerated with a mixture of 95% O2-5% CO2 at 37°C (8, 29) at a perfusion pressure of 100 cmH2O. After 10 min of equilibration, the perfusion pressure was decreased by 50, 75, or 100% (global ischemia; GI) for 45 min. The heart was then frozen (–80°C) until analyses were performed. Hearts from each group perfused at a pressure of 100 cmH2O for 45 min served as controls for these experimental groups. To confirm a decrease in PO2 pressure, the oxygen tension in the myocardium was measured using oxygen needle electrode no. 760 (Diamond General, Ann Arbor, MI). To assess differences in ischemic injury between the heat-acclimated and nonacclimated hearts, infarct size was measured. For this purpose, the mounted isolated hearts underwent GI (30 min) followed by 30 min of reperfusion. Immediately thereafter, a 10% 2,3,5-triphenyltetrazolium chloride (TTC) solution in phosphate buffer was infused until the coronary vasculature stained dark red, the hearts were removed, blotted dry, and frozen at –80°C. One-millimeter-wide slices of the heart were fixed in 10% paraformaldehyde for 72 h. The slices were then photographed using a digital camera, and the total slice vs. infarct area was calculated using Adobe Photoshop.

Tissue preparation.
All rats were euthanized by cervical dislocation. For mRNA analysis, the rats were euthanized before and 20, 40, and 60 min after HS; the animals were euthanized 0 and 1 h after the stress to determine protein expression (30, 32). The hearts were rapidly excised and mounted on a Langendorff perfusion apparatus and perfused in a retrograde manner (for 2 min) with Krebs-Henseleit buffer to wash out any remaining blood. The left ventricle was carefully excised, frozen, and stored at –80°C until analysis.

Cellular fractionation.
To prepare whole cell lysates, the left ventricle was homogenized with 20 mM HEPES (pH 7.5), 1.5 mM MgCl2, 0.2 mM EDTA, 0.1 M NaCl, 5 mM DTT, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 1.2 mM Na3VO4. NaCl was added to a final concentration of 0.45 M (53). The homogenate was centrifuged for 30 min at 12,000 rpm, 4°C. The supernatant was mixed with an equal volume of buffer solution, as above, with 40% (vol/vol) glycerol (53).

For cytosolic and nuclear fraction separation, the tissue was homogenized with buffer containing 0.5 M sucrose, 10 mM HEPES (pH 7.9), 1.5 mM MgCl, 10% glycerol, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, and 1.2 mM Na3VO4. The homogenate was centrifuged for 5 min at 10,000 rpm, 4°C. The supernatant (cytosolic fraction) was removed and stored at –80°C until analysis. The pellet was washed twice in detergent-free buffer (as above) and dissolved in buffer containing 20 mM HEPES (pH 7.9), 25% glycerol, 0.42 M NaCl, 0.2 M EDTA, 1 mM DTT, 0.5 mM PMSF, and 1.2 mM Na3VO4. The solution was incubated for 30 min at 4°C and centrifuged for 20 min at 15,000 rpm, and the nuclear extract was stored until analysis. Mitochondrial fractions were obtained by centrifuging the cytosolic fraction (1). Protein concentration of the myocardial specimens was quantified using Bradford reagent (Bio-Rad Laboratories, Richmond, CA).

Western blot analysis.
Total protein (50 µg/lane) was fractionated by electrophoresis on 9 or 12% polyacrylamide gels under denaturing conditions (27), transferred onto nitrocellulose membranes, blocked for 2 h in phosphate-buffered saline (PBS) containing 5% dried skimmed milk powder, and then probed overnight at 4°C with primary antibody, diluted 1:1,000. After repeated washings, the membranes were incubated at room temperature for 1 h with horseradish peroxidase-conjugated rabbit anti-mouse IgG (Jackson) diluted 1:1,000. The antibodies used were mouse monoclonal anti-HIF-1{alpha} (57), monoclonal anti-HIF-1ß (Neomarker, Fremont, CA) and anti-EpoR (Santa Cruz Biotechnology, Santa Cruz, CA). Specific antibody binding was detected using enhanced chemiluminescence (Amersham) and visualized by exposing X-ray film to the membrane. For further details, see Refs. 20, 30, and 32. The density of the scanned protein bands was calculated using TINA software (Raytest, Straubenhardt, Germany).

Coimmunoprecipitation.
For coimmunoprecipitation, 500 µg of nuclear extracts, prepared as described above, together with 1 µl of monoclonal anti-HIF-1ß antibody (µg/ml; Novus, Littleton, CO) in immunoprecipitation (IP) buffer [20 mM Tris·HCl, pH 7.5, 1.5 mM MgCl2, 1 mM EDTA, 20% glycerol, 5 mM DTT, 0.25 M sucrose, 1 mM PMSF, 1 mM Na3VO4, and protease inhibitor cocktail (Roche)] were incubated for 2 h at 4°C with agitation. Protein A/G beads (Pierce) in IP buffer (10 µl) were added and incubated overnight. The beads were then precipitated by centrifugation for 1 min at 10,000 g at 4°. The immune complexes on the beads were washed three times with washing buffer (50 mM Tris, pH 7.5, 0.5 mM NaCl, 1% Triton X-100, and protease inhibitor cocktail). HIF-1 IP by anti-HIF-1ß antibody was detected by electrophoresis through an SDS-7% polyacrylamide gel. Immunoblot assay was performed as described above.

Electrophoretic mobility shift assay.
Nuclear extracts were prepared as above. The oligonucleotides for electrophoretic mobility shift assay (EMSA) were sense strand 5'-GCCCTACGTGCTGTCTCA-3' and antisense 5'-GCCCTAAAAGCTGTCTCA-3' (22). The sense strand was labeled using T4 polynucleotide kinase (Promega) and {gamma}-32P[ATP] (NEN, Boston, MA). After incubation for 30 min at 37°C, the reaction was terminated by 1 µl of 0.5 M EDTA, and the labeled strand was annealed to the complementary strand in an automated thermal cycler (Perkin Elomer-Cetus, Emeryville, CA) using the following protocol: 95°C for 5 min; 70, 65, 50, 37, and 30°C for 1 h each; and then 4°C for 10 min. Nuclear extract proteins (15 µg) were incubated with the labeled double-stranded sequence (5 x 104 cpm) in 12 µl of binding reaction mixture containing 50 mM Tris·HCl (pH 8), 100 mM KCl, 12.5 mM MgCl2, 1 mM EDTA, 20% glycerol, 1 mM DDT, 1 mM PMSF, 1.2 mM Na3VO4, and 0.5 µg of poly(dI-dC) (Sigma). After 20 min at 25°C, 3 µl of loading dye were added, and samples were loaded onto a 5% polyacrylamide gel and run at 4°C for ~2 h at 80 V. For supershift analysis, protein extracts were preincubated with 1 µg of anti-HIF-1{alpha} and HIF-1ß antibodies for 1 h on ice. For competition, the samples were incubated with a 50-fold molar excess of specific unlabeled double-stranded sequence 15 min before adding the labeled oligonucleotides.

mRNA detection.
Changes in mRNA transcripts were detected using semi-quantitative RT-PCR. Concomitantly, to obtain absolute basal levels of those transcripts that showed significant changes, at a particular assigned physiological condition, real-time PCR was also used. RT-PCR was performed as previously described (30). Briefly, total RNA was extracted from the left ventricle homogenate, using Tri-Reagent (Molecular Research Center, OH). Total RNA (10 µg) was reverse transcribed in a 50-µl reaction mixture containing 0.5 µg of oligo(dT)15 as primer, together with 400 U of Moloney murine leukemia virus RT, according to the manufacturer's instructions [United States Biochemical (USB), Cleveland, OH]. For the PCR, 5 µl of the cDNA mixture were added to 50 µl of a master mix containing 200 µM each dNTP, 100 pM each specific primer, and 1.5 units of Vent polymerase (USB). We synthesized DNA oligonucleotide primers for HIF-1{alpha}, VEGF, and HO1, Epo, and EpoR. The oligonucleotide sequence and RT-PCR protocols were taken from the published literature (Refs. 7 and 54 and Clontech Laboratory, Palo Alto, CA, respectively). To ensure equal amounts of initial mRNA, we performed parallel actin amplification (annealing temperature 62°C, 30 cycles; Ref. 27). The PCR products were resolved on 1.5% agarose gel, stained with ethidium bromide, and visualized under UV light. Band density was analyzed using TINA software.

Epo, EpoR, and Vegf mRNA were also measured using quantitative real-time RT-PCR (ABI Prism 7000 Sequence Detection System, Applied Biosystems). The reaction was carried out in a 20-µl reaction volume containing 10 µl of SYBR Green Master Mix (Applied Biosystems), 500 nM each the forward and reverse primer, and 5 µl of diluted cDNA. The appropriate cDNA dilution was determined from the calibration curves established for each primer pair. The thermal profile for SYBR Green real-time RT-PCR was 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. The primers for real time RT-PCR were designed using Prime Express software (Applied Biosystems). The sense for Epo, EpoR, and Vegf were TCACGAAGCCATGAAGACAGA, CCTACCTGGTATTGGATGAATGGTTGC, and AGCGTTCACTGTGAGCCTTGT, respectively, and the matched antisense were CTCCCATGAAAGCTGAGAGTCA, CTGTAATCTGTTGAGATGCCGGAATCG, and CCTTGCAACGCGAGTCTGT. ß-Actin was sense TGTGGCATCCATGAAACTAC and antisense ATTTGCGGTGCACGATGGAG. The results were analyzed by the {Delta}Ct method, which reflects the difference in threshold for the target gene relative to that of ß-actin in each sample.

Immunohistochemistry and immunofluorescence.
Hearts were fixed for 40 min in 4% paraformaldehyde and then placed for 48 h in a 20% sucrose solution and frozen using embedding solution (Tissue-Tek, Sakura Finetek). The 5-µm frozen tissue sections were dried in cold acetone and incubated with H2O2 to quench endogenous peroxidase activity. Nonspecific binding sites on the slides were blocked with normal rabbit serum (Zymed Laboratories, South San Francisco, CA). The slides were then incubated for 1 h with the primary antibody rabbit polyclonal anti-HIF-1{alpha} (Semenza Lab) at a concentration of 4 µg/ml and then for 20 min with the secondary antibody biotinylated anti-rabbit IgG (Zymed). For the negative control, the primary antibody was replaced with blocking solution. Finally, the sections were counterstained with Harris hemotoxylin.

For immunofluorescence, frozen sections were used (as above). Tissue was permeabilized for 10 min with 0.2% Triton X-100 and blocked using normal rabbit serum (Zymed). The sections were incubated with the primary antibody rabbit polyclonal anti-HIF-1{alpha} for 1 h followed by the secondary antibody, Alexa 488 anti-rabbit IgG conjugate, at 1:200 (Molecular Probes, Eugene, OR). The nuclei were stained with propidium iodide solution (Sigma). The slides were examined using a confocal laser scanning microscope (Zeiss LSM 510) equipped with a x40/1.0-numerical aperture oil-immersion objective.

Statistical analysis.
For statistical analysis, one- and two-way ANOVAs were used with commercially available computer software (Sigmastat, SPPS). Treatments were taken as the fixed effects, and the individual organs were assumed to be random samples from the animal heart population. Student's unpaired t-test was used for individual matched-group comparisons. The data are expressed as means ± SE; values of P < 0.05 were considered statistically significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Heat acclimation and heat stress-body temperature profile.
Body weight and Tc profiles in acclimated rats during 2 h of HS at 41°C are presented in Table 1. After acclimation for 1 mo, the hyperthermic Tc of heat-acclimated rats was higher than that of C rats. The results are consistent with previous findings (28).


View this table:
[in this window]
[in a new window]
 
Table 1. Body weight and colonic temperature in the experimental groups

 
Heat acclimation and heat stress affect HIF-1{alpha} protein levels.
We first determined whether HIF-1{alpha} protein is detectable under normoxic conditions. HIF-1{alpha} was detected in whole cell lysates of the normoxic myocardium, in both nonacclimated and acclimated rats. Heat acclimation led to an almost twofold increase in HIF-1{alpha} levels (Fig. 2). To characterize the cellular localization of the protein, we examined HIF-1{alpha} levels in subcellular fractions. High levels of HIF-1{alpha} induced by heat acclimation accumulated in the cytosolic fraction (data not shown). When equal protein concentrations per cytosolic or nuclear extract sample were used, however, HIF-1{alpha} level in the nuclear extract of AC rats was clearly elevated (Fig. 2B) and the nuclear-to-cytosolic fraction ratio increased by 203% (C: 0.95 ± 0.04; AC: 2.03 ± 0.11; P < 0.001).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2. Whole body hyperthermia affects the expression of HIF-1{alpha} in the heart. A: Western blot analysis of whole cell lysates from the left ventricle of hearts excised from C and AC rats before and after HS. Bar graph presents HIF-1{alpha} level in C and AC groups before (basal), after 2 h of HS at 41°C, and after 1 h of recovery (°C/1) at room temperature (24°C). Each lysate was tested 3 times in separate runs. Data in each bar represent mean ± SE; n = 5. C-HS vs. C-basal: *P < 0.05. AC vs. C (same treatment): #P < 0.05. B: representative set of bands from nuclear extracts of hearts from C and AC rats.

 
Immunoblot assays revealed significantly increased HIF-1{alpha} protein levels in nonacclimated rat hearts after the termination of HS. This elevation persisted for at least 1 h after recovery at room temperature. In heat-acclimated rat hearts, HS did not elevate the protein level beyond the concentration detected when acclimation was achieved (Fig. 2). RT-PCR did not reveal significant alteration in the HIF-1{alpha} mRNA levels, either after acclimation or after HS (data not shown), implying that changes in protein synthesis or degradation are responsible for the increased accumulation of HIF-1{alpha} protein.

HIF-1 dimerization and DNA-binding activity.
To demonstrate that HIF-1{alpha} and HIF-1ß associate, nuclear extracts from hearts of nonacclimated, nonacclimated HS, and AC rats were tested for coimmunoprecipitation of HIF-1{alpha} and HIF-1ß. HIF-1{alpha} precipitated by anti-HIF-1ß antibody was identified by immunoblot assay. Markedly increased HIF-1{alpha} levels were observed after both HS and acclimation (Fig. 3A). EMSA was performed to confirm HIF-1 binding to the hypoxia response element (HRE). When cardiac nuclear extracts were incubated with labeled double-stranded oligonucleotide containing the HRE, a DNA-binding complex was detected in the samples from heat-stressed nonacclimated hearts (Fig. 3B), achieving a maximal level at 60 min post-HS. Heat-acclimated hearts revealed increased HIF-1 DNA-binding activity compared with nonacclimated hearts (Fig. 3B; compare lanes 1 and 6). The addition of excess unlabeled oligonucleotide attenuated the relative amount of the HIF-1/HRE complex. The specificity of the bands was confirmed by supershift analysis using antibodies specific to HIF-1ß (Fig. 3C).



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 3. HS and heat acclimation induce HIF-1{alpha} and HIF-1ß dimerization and HIF-1 DNA-binding activity in the heart. A: coimmunoprecipitation. B: left ventricle nuclear protein (15 µg) from nonacclimated and heat-acclimated animals was incubated in the presence of a 32P-labeled oligonucleotide containing the HIF-1-binding site. Lanes 1–5, nonacclimated (C) rats; lane 6, heat-acclimated (AC) rats. Lanes 1 and 6, basal levels; lane 2, immediately after HS; lane 3, 30 min post-HS; lane 4, hypoxia response element (HRE) competition assay using a 50-fold excess of unlabeled HRE oligonucleotide; lane 5, 60 min post-HS. C: for supershift assay, before incubation with the 32P-labeled oligonucleotide heart nuclear extracts obtained from C rats after 30 min of recovery from HS were preincubated with specific anti-HIF-1ß antibody.

 
Transcriptional activation of HIF-1 target genes.
Figure 4A shows the expression of Vegf mRNA in rat hearts before and after HS at 41°C. Vegf mRNA encoding the 188- and 164-kDa isoforms, which are generated by alternative splicing (55), was detected. HS resulted in upregulation of mRNA encoding both isoforms. This effect was significantly greater in hearts from AC rats. HO1 showed a different response. HO1 mRNA levels were increased in response to HS in nonacclimated but not in acclimated hearts (Fig. 4B). Interestingly, fourfold increased Epo mRNA levels were detected in the kidneys of heat-acclimated vs. nonacclimated rats (Fig. 5A). Concomitantly, EpoR mRNA and protein levels were significantly elevated in the heat-acclimated hearts (Fig. 5B). These data suggest a global heat acclimation effect on HIF-1{alpha} activation. Hearts from nonacclimated rats demonstrated heat-induced EpoR mRNA upregulation, and hearts from acclimated rats maintained their higher postacclimatory EpoR mRNA levels.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 4. RT-PCR analyses of VEGF and HO1 mRNA after 2 h of HS. A: RT-PCR analysis of Vegf mRNA showing induction of mRNAs encoding the 188- and 164-kDa isoforms of VEGF. Top: representative set of bands. Bottom: bar graph demonstrating the total change in Vegf transcripts at each time point. Inset: the change in Vegf (188 kDa) vs. its basal level during 1 h of recovery after HS [measured by quantitative RT-PCR (qRT-PCR)]. B: RT-PCR analysis of the HO1 mRNA level in hearts of rats, as above. mRNA of each individual animal was measured independently 3 times (3 animals for each time point). Each bar represents the relative amount of transcript normalized by ß-actin (mean ± SE) at the indicated time point: untreated (untr) and 0, 30, and 60 min of recovery after 2 h at 41°C. Significant difference from C hearts: {phi}P < 0.05 or {phi}P < 0.01. Significant difference from nonstressed (untr) controls: *P < 0.05 or *P < 0.01, ***P < 0.005. Significant difference between C and AC hearts (ANOVA): #P < 0.03.

 


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. qRT-PCR analyses of Epo transcripts in kidneys (A) and EpoR transcripts (B, left) and proteins (B, right) in hearts excised from nonacclimated (C) and heat-acclimated (AC) rats. mRNA of each individual animal was measured independently 3 times. Each bar represents mean ± SE; n = 4–5. HS, 1 h of recovery (at 24°C) after 2 h at 41°C. Significant difference from nonstressed C hearts: *P < 0.000. Significant difference from nonstressed C hearts: #P < 0.05.

 
Ischemic insult has different effects on the HIF-1{alpha} profile.
Tissue oxygen pressure during the various ischemic conditions and the magnitude of cross-tolerance, using infarct area as a marker for tissue injury, are presented in Table 2 and Fig. 6. No difference in PO2 among the groups was found. The infarct area of the heat-acclimated heart was markedly smaller compared with nonacclimated hearts, thus confirming the cross-tolerance provided by heat acclimation. HIF-1{alpha} levels were measured under different ischemic conditions. Figure 7 demonstrates that in nonacclimated rats, HIF-1{alpha} levels are markedly elevated in response to a 75% reduction in coronary flow. Consistent with immunoblot data (Fig. 7), HIF-1 heterodimer and HIF-1 DNA-binding activity were increased in nonacclimated hearts subjected to 75% ischemia (Fig. 8A). Vegf-164 mRNA levels were significantly elevated in both C and AC groups (P < 0.005; Fig. 8B). EpoR mRNA levels were significantly elevated in C hearts, but the highest levels of EpoR mRNA were observed in ischemic hearts from heat-acclimated rats (Fig. 8C).


View this table:
[in this window]
[in a new window]
 
Table 2. Coronary flow and myocardial PO2 in nonacclimated and heat-acclimated rats

 


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 6. Myocardial infarction induced by 30 min of global ischemia followed by 30 min of reperfusion using the Langendorff perfusion apparatus. Top: representative sections of TTC-stained slices. Bottom: densitometric assessment of the infarct size, normalized to area at risk (AAR) (in %). Each bar presents the mean ± SE; n = 10. *P < 0.005.

 


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 7. Progressive graded ischemia affects the expression of HIF-1{alpha} in the heart. Western blot analysis of whole cell lysates from the left ventricle of hearts excised from C and AC rats. Top: representative set of bands. Bottom: bar graph representing HIF-1{alpha} level in C and AC groups before (normoperfusion; 100 cmH2O) and after a decrease in perfusion pressure by 75%, for 45 min. Each lysate was tested 3 times in separate runs. Data in each bar represent mean ± SE; n = 5. *Significant difference from normoperfused hearts of the matched group.

 


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 8. Ischemia (ISC) affects HIF-1 binding and transcriptional activation of target genes in the heart A: ischemia induces HIF-1{alpha} and HIF-1ß dimerization (top) and HIF-1 DNA-binding activity (bottom) in the heart. Lanes 1 and 2: C hearts; lanes 3 and 4, AC hearts. Lanes 1 and 3, normoperfused; lanes 2 and 4, 75% ischemia. For details and binding specificity, see Fig. 3. B: transcriptional activation of VEGF, isoform 164 kDa. Bottom: bar graph presenting Vegf mRNA level in C and AC groups before (normoperfusion) and after a decrease in perfusion pressure by 75%, for 45 min. C: transcriptional activation of EpoR at normoperfusion and after decrease in perfusion pressure by 75%, for 45 min. Normoperfusion equals 100 cmH2O. mRNA of each individual animal was measured independently 3 times. Data in each bar represent mean ± SE; n = 3–4. Significant difference from normoperfused hearts of the C group: *P < 0.05 and *P < 0.01. Significant difference from normoperfused heart of the AC group: 0.0003 < #P < 0.005.

 
Cellular HIF-1{alpha} localization: confocal microscopy and immunofluorescence.
To confirm our immunoblot assays showing that AC and HS induce increased HIF-1{alpha} protein levels in the heart, we analyzed heart sections by anti-HIF-1{alpha} immunohistochemistry. Both scanning confocal fluorescence microscopy and immunohistochemical light microscopy (Fig. 9) showed that, after each treatment used in this investigation, most of the HIF-1{alpha} accumulated in the cytosol of cardiomyocytes, adjacent to the cell membranes and encircling the nuclei. Nuclear staining was also visualized.



View larger version (75K):
[in this window]
[in a new window]
 
Fig. 9. Confocal microscopy (A) and immunohistochemistry (B) photoimages of HIF-1{alpha} protein expression in the heart. C, hearts of nonacclimated rats; AC, hearts of heat-acclimated rats; HS, hearts of heat-stressed rats at 41°C for 2 h; NC, negative control (cardiac muscle slices incubated without primary antibody). It is evident from both confocal microscopy scans and immunohistochemistry staining that after the heat treatments, HIF-1{alpha} accumulates in the cytosol, adjacent to the cell membranes and encircling the nuclei. Arrows point to HIF-1{alpha}-positive staining in the nucleus.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
By determining HIF-1{alpha} levels and the expression of HIF-1 target genes, we have demonstrated enhancement of the HIF-1-mediated hypoxia response following heat acclimation. This response likely contributes to heat acclimation-induced ischemic cross-tolerance in mammals. A greater abundance of HIF-1{alpha} protein and an enhanced transcriptional activation of target genes upon insult characterize this state. The results suggest that the response consists of chronic and acute adaptive components, as demonstrated by increased Epo and EpoR mRNA levels following acclimation compared with the induction of HO1 and Vegf mRNA expression, which only occurred in response to acute heat or ischemic insults. The occurrence of the chronic adaptive component agrees with our concept that greater cellular reserves of key cytoprotective proteins represent an important part of the acclimatory/cross-tolerance response.

HIF-1{alpha} is elevated after heat acclimation.
The results of these experiments indicate that 1 mo of heat acclimation significantly increases HIF-1{alpha} protein levels in the heart. The absence of major changes in the steady-state levels of HIF-1{alpha} mRNA suggests that heat acclimation-mediated HIF-1{alpha} accumulation results from a change in the rate of HIF-1{alpha} protein synthesis or degradation. In homeotherms, heat acclimation does not involve periods of hypoxia as might be the case in marine ectotherms (40). Hence, HIF-1{alpha} stabilization and accumulation in the cell is most likely attributable to oxygen-independent mechanisms. The phosphatidylinositol-3-kinase (PI3K)/AKT pathway, which has been shown to induce HIF-1 DNA-binding activity and transcriptional activation (5, 12, 28, 32, 42, 50, 56, 58), is a promising signaling candidate. Zelzer et al. (54) and Feldser et al. (11) established an oxygen-independent connection between HIF-1 and responses to insulin and IGF-1, including transcriptional activation of the genes encoding glucose transporter-1, Epo, VEGF, and several enzymes in the glycolytic pathway. Angiotensin induces similar responses (36). The observation that HIF-1 is essential for heat acclimation in C. elegans (49) and the increased expression of HIF-1 target genes in acclimated mammals (9, 13, 35) provide the rationale for our notion that heat acclimation exploits HIF-1-targeted pathways to induce adaptations in mammals, perhaps as a result of enhanced PI3K/AKT activity during heat acclimation.

Both cellular fractionation and microscopy provided evidence that HIF-1{alpha} protein accumulates in the cytosolic fraction of the cell, whereas the amount of HIF-1{alpha} is relatively low in nuclear extracts. Nevertheless, the acclimation process drives HIF-1{alpha} into the nucleus as shown by the 203% increase in the nuclear-to-cytosolic ratio of HIF-1{alpha}.

Previous studies by our group showed that an important predisposing acclimatory response is the establishment of "alerted" molecular cytoprotective systems and increased reserves of cytoprotective proteins, including HSP72 (30) and HSP90 (A. Maloyan and M. Horowitz, unpublished observations). Recently, Zhou et al. (58) provided evidence that HSP70 and HSP90 promote HIF-1{alpha} accumulation and stabilization, with their expression provoked by PI3K/AKT. We hypothesize that the elevation of HIF-1{alpha} in the cytosolic fraction of the heat-acclimated heart is part of this cytoprotective reserve. Although cytosolic HIF-1{alpha} localization has been reported before (46), it is not clear whether HIF-1{alpha} that is localized to the cytosol represents a reserve that can be translocated into the nucleus in response to additional physiological signals or whether it plays a specific homeostatic role unrelated to its activity as a transcription factor.

Heat stress and HIF-1{alpha}.
Because the primary adaptation induced by heat acclimation is augmented thermal tolerance and prolonged endurance to HS, we examined the functional activity of HIF-1 following HS to determine whether this transcription factor plays a role in acclimatory responses. We demonstrated that, in response to acclimation and/or HS, HIF-1{alpha} and HIF-1ß heterodimerize, and that this complex binds to DNA. We also showed that heat acclimation induces the upregulation of Epo mRNA in the kidney and EpoR in the heart, thus positively affecting this survival axis. Likewise, both Vegf and HO1 mRNA levels were increased in response to HS, with a greater increase of Vegf mRNA levels in the heat-acclimated state, suggesting that HS induces HIF-1 transcriptional activation and that heat acclimation enhances this response. Our results are not consistent with those of Katchinski et al. (24), who found that HS induces the accumulation of HIF-1{alpha} without subsequent transcriptional activation. HIF-1 target genes are activated in a selective manner (39, 46) depending on cell type (23). The results of the present investigation suggest that HIF-1-mediated induction of Epo and EpoR expression in response to HS may be of particular importance. Erythropoietin has been shown to function as a cardioprotective cytokine (2, 3), playing a role in energy metabolism (52) and antiapoptotic pathways (2, 3, 48). Thus enhancement of the EpoR cascade in the acclimated heart provides a potential molecular basis for cross-tolerance-mediated cardioprotection as discussed in the following section.

Heat acclimation-ischemic insult cross-tolerance and HIF-1.
HIF-1-mediated gene expression was induced at a PO2 of 14 Torr in nonacclimated hearts subjected to a 75% reduction in coronary flow. Heat-acclimated hearts maintained high HIF-1{alpha} levels and low DNA-binding activity. These different responses of the nonacclimated and heat-acclimated groups to ischemia resemble the response profiles of these groups to HS. In accordance with our concept of heat acclimation-mediated cardioprotection via larger cytoprotective protein reserves, the markedly enhanced levels of EpoR, which mediates the protective function of erythropoietin in this tissue, might be beneficial to the heat-acclimated ischemic heart.

Although we did not measure the transcriptional activation of genes encoding glycolytic enzymes by HIF-1 here, the enhanced glycolytic production of ATP occurring in the heat-acclimated ischemic heart (9) is an additional consequence of HIF-1 activation (20). Most likely, the combined enhancement of metabolic potential and greater reserves of cytoprotective proteins together with accelerated inducible responses (30, 29) ultimately lead to the marked cardioprotection that is demonstrated in Fig. 6.

An intriguing issue raised in this investigation is the utilization of HIF-1 for heat acclimation. The HIF-1-mediated hypoxic response appeared early in metazoan evolution to regulate metabolic responses and is highly conserved (44, 54). We hypothesize that HIF-1 could be exploited by a variety of physiological adaptive mechanisms requiring metabolic changes, as in the case of heat acclimation, which shows enhancement of the metabolic machinery to elevate energy potential upon insults (20). Our finding that HIF-1 is essential for C. elegans acclimation (49) confirmed that this function developed early in metazoan evolution.

In conclusion, the results of this investigation provide evidence that, in rats, HIF-1{alpha} 1) is expressed at increased levels following long-term heat acclimation, 2) is transiently upregulated following acute HS, and 3) activates target genes following HS, but with greater magnitude in the heat-acclimated phenotype. The elevated protein level and the greater transcriptional activation in the acclimated vs. nonacclimated animals suggest that the acclimated phenotype predisposes HIF-1 signaling by greater protein reserves and the ability to intensify the response. This concept of the heat acclimatory response, namely, acclimation augments effector output-to-signal ratio (16), as developed in previous studies for other signaling pathways, is achieved by a variety of mechanisms. The HIF-1 module likely interacts with other molecular pathways to mediate protective responses to heat stress and ischemia.


    GRANTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by the United States-Israel Binational Fund (grant no 9800167).


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: M. Horowitz, Dept. of Physiology, Hadassah Medical School, The Hebrew Univ., POB 12272, Jerusalem 91120, Israel (e-mail: horowitz{at}cc.huji.ac.il).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Baines CP, Zhang J, Wang GW, Zheng YT, Xiu JX, Cardwell EM, Bolli R, and Ping P. Mitochondrial PKC-{epsilon} and MAPK form signaling modules in the murine heart: enhanced mitochondrial PKC-{epsilon}-MAPK interactions and differential MAPK activation in PKC-{epsilon}-induced cardioprotection. Circ Res 90: 390–397, 2002.[Abstract/Free Full Text]
  2. Cai Z, Manalo DJ, Wei G, Rodriguez ER, Fox-Talbot K, Lu H, Zweier JL, and Semenza GL. Hearts from rodents exposed to intermittent hypoxia or erythropoietin are protected against ischemia-reperfusion injury. Circulation 108: 79–85, 2003.[Abstract/Free Full Text]
  3. Cai Z and Semenza GL. Phosphatidylinositol-3-kinase signaling is required for erythropoietin-mediated acute protection against myocardial ischemia/reperfusion injury. Circulation 109: 2050–2053, 2004.[Abstract/Free Full Text]
  4. Chandel NS, McClintock DS, Feliciano CE, Wood TM, Melendez JA, Rodriguez AM, and Schumacker PT. Reactive oxygen species generated at mitochondrial complex III stabilize hypoxia-inducible factor-1{alpha} during hypoxia: a mechanism of O2 sensing. J Biol Chem 275: 25130–25138, 2000.[Abstract/Free Full Text]
  5. Chun YS, Kim MS, and Park JW. Oxygen-dependent and -independent regulation of HIF-1{alpha}. J Korean Med Sci 17: 581–588, 2002.[Web of Science][Medline]
  6. Cohen O, Stern M, and Horowitz M. Heat acclimation improves cardiac contractility and ischemic tolerance. Is acclimation memorized? (Abstract.) J Mol Cell Cardiol 33: A22, 2001.
  7. Csonka C, Varga E, Kovacs P, Fernandy P, Blasing IE, Szilvassy Z, and Tosaki A. Heme oxygenase and cardiac function in ischemic/reperfused rat hearts. Free Radic Biol Med 27: 119–126, 1999.[CrossRef][Web of Science][Medline]
  8. Eynan M, Palmon A, Hasin Y, and Horowitz M. Does low thyroid hormone level switch on heat acclimation-induced changes in cardiac mechanical performance? Am J Physiol Regul Integr Comp Physiol 276: R550–R558, 1999.[Abstract/Free Full Text]
  9. Eynan M, Knubuvetz T, Meiri U, Navon G, Gerstenblith G, Bromberg Z, Hasin Y, and Horowitz M. Heat acclimation-induced elevated glycogen, glycolysis, and low thyroxine improve heart ischemic tolerance. J Appl Physiol 93: 2095–2104, 2002.[Abstract/Free Full Text]
  10. Fandrey J. Oxygen-dependent and tissue-specific regulation of erythropoietin gene expression. Am J Physiol Regul Integr Comp Physiol 286: R977–R988, 2004.[Abstract/Free Full Text]
  11. Feldser D, Agani F, Iyer NV, Pak B, Ferreira G, and Semenza GL. Reciprocal positive regulation of hypoxia-inducible factor 1{alpha} and insulin-like growth factor 2. Cancer Res 59: 3915–3918, 1999.[Abstract/Free Full Text]
  12. Fukuda R, Hirota K, Fan F, Jung YD, Ellis LM, and Semenza GL. Insulin-like growth factor 1 induces hypoxia-inducible factor 1-mediated vascular endothelial growth factor expression, which is dependent on MAP kinase and phosphatidylinositol 3-kinase signaling in colon cancer cells. J Biol Chem 277: 38205–38211, 2002.[Abstract/Free Full Text]
  13. Hadad W and Horowitz M. Heat acclimation alters endothelial nitric oxide activity in the splanchnic vascular bed. J Therm Biol 24: 403–408, 1999.
  14. Haddad JJ. Recombinant human interleukin (IL)-1ß-mediated regulation of hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) stabilization, nuclear translocation and activation requires an antioxidant/reactive oxygen species (ROS)-sensitive mechanism. Eur Cytokine Netw 13: 250–260, 2002.[Web of Science][Medline]
  15. Horowitz M. Acclimatization of rats to mild heat: body water distribution and adaptability of submaxillary salivary gland. Pflügers Arch 366: 173–176, 1976.[CrossRef][Web of Science][Medline]
  16. Horowitz M. From molecular and cellular to integrative heat defense during exposure to chronic heat. Comp Biochem Physiol A 131: 475–483, 2002.[CrossRef][Medline]
  17. Horowitz M. Matching the heart to heat-induced circulatory load: heat-acclimatory responses. News Physiol Sci 18: 215–221, 2003.[Abstract/Free Full Text]
  18. Horowitz M and Meiri U. Central and peripheral contributions to control of heart rate during heat acclimation. Pflügers Arch 422: 386–392, 1993.[CrossRef][Web of Science][Medline]
  19. Horowitz M, Argov D, and Mizrahi R. Interrelationships between heat acclimation and salivary cooling mechanism in conscious rats. Comp Biochem Physiol A 74: 945–949, 1983.
  20. Horowitz M, Eli-Berchoer L, Wapinski I, Friedman N, and Kodesh E. Stress related genomic responses during the course of heat acclimation and its association with ischemic/reperfusion cross-tolerance. J Appl Physiol 97: 1496–1507, 2004.[Abstract/Free Full Text]
  21. Iyer NV, Kotch LE, Agani F, Leung SW, Laughner E, Wenger RH, Gassmann M, Gearhart JD, Lawler AM, Yu AY, and Semenza GL. Cellular and developmental control of O2 homeostasis by hypoxia-inducible factor 1{alpha}. Genes Dev 12: 149–162, 1998.[Abstract/Free Full Text]
  22. Jiang BH, Rue E, Wang GL, Roe R, and Semenza GL. Dimerization, DNA binding, and transactivation properties of hypoxia-inducible factor 1. J Biol Chem 271: 17771–17778, 1996.[Abstract/Free Full Text]
  23. Kasuno K, Takabuchi S, Fukuda K, Kizaka-Kondoh S, Yodoi J, Adachi T, Semenza GL, and Hirota K. Nitric oxide induces hypoxia-inducible factor 1 activation that is dependent on MAPK and phosphatidylinositol 3-kinase signaling. J Biol Chem 279: 2550–2558, 2004.[Abstract/Free Full Text]
  24. Katschinski DM, Le L, Heinrich D, Wagner KF, Hofer T, Schindler SG, and Wenger RH. Heat induction of the unphosphorylated form of hypoxia-inducible factor-1{alpha} is dependent on heat shock protein-90 activity. J Biol Chem 277: 9262–9267, 2002.[Abstract/Free Full Text]
  25. Kimura H, Weisz A, Kurashima Y, Hashimoto K, Ogura T, D'Acquisto F, Addeo R, Makuuchi M, Esumi H. Hypoxia response element of the human vascular endothelial growth factor gene mediates transcriptional regulation by nitric oxide: control of hypoxia-inducible factor-1 activity by nitric oxide. Blood 95: 189–197, 2000.[Abstract/Free Full Text]
  26. Kelly BD, Hackett SF, Hirota K, Oshima Y, Cai Z, Berg-Dixon S, Rowan A, Yan Z, Campochiaro PA, and Semenza GL. Cell type-specific regulation of angiogenic growth factor gene expression and induction of angiogenesis in nonischemic tissue by a constitutively active form of hypoxia-inducible factor 1. Circ Res 93: 1074–1078, 2003.[Abstract/Free Full Text]
  27. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685, 1970.[CrossRef][Medline]
  28. Laughner E, Taghavi P, Chiles K, Mahon PC, and Semenza GL. HER2 (neu) signaling increases the rate of hypoxia-inducible factor 1{alpha} (HIF-1{alpha}) synthesis: novel mechanism for HIF-1-mediated vascular endothelial growth factor expression. Mol Cell Biol 21: 3995–4004, 2001.[Abstract/Free Full Text]
  29. Levi E, Vivi A, Hasin Y, Tassini M, Navon G, and Horowitz M. Heat acclimation improves cardiac mechanics and metabolic performance during ischemia and reperfusion. J Appl Physiol 75: 833–839, 1993.[Abstract/Free Full Text]
  30. Maloyan A, Palmon A, and Horowitz M. Heat acclimation increases basal HSP72 level and alters its production dynamics during heat stress. Am J Physiol Regul Integr Comp Physiol 276: R1506–R1515, 1999.[Abstract/Free Full Text]
  31. Maloyan A, Semenza G, Gerstenblith G, Stern M, and Horowitz M. Heat-acclimation-ischemia cross-tolerance: does HIF 1 play a role? (Abstract.) J Mol Cell Cardiol 33: A72, 2001.
  32. Maloyan A and Horowitz M. ß-Adrenergic signaling and thyroid hormones affect HSP72 expression during heat acclimation. J Appl Physiol 93: 107–115, 2002.[Abstract/Free Full Text]
  33. Metzen E, Zhou J, Jelkmann W, Fandrey J, Brune B. Nitric oxide impairs normoxic degradation of HIF-1{alpha} by inhibition of prolyl hydroxylases. Mol Biol Cell 14: 3470–3481, 2003.[Abstract/Free Full Text]
  34. Morse D and Choi AM. Heme oxygenase-1: the "emerging molecule" has arrived. Am J Respir Cell Mol Biol 27: 8–16, 2002.[Abstract/Free Full Text]
  35. Nagasawa J, Sato Y, Yamashita H, Ookawara T, Kizaki T, Habara Y, and Ohno H. Is heat acclimation able to increase whole-body sensitivity to insulin? Res Commun Chem Pathol Pharmacol 84: 375–378, 1994.[Web of Science][Medline]
  36. Page EL, Robitaille GA, Pouysse'gur J, and Richard DE. Induction of hypoxia-inducible factor-1 by transcriptional and translational mechanisms. J Biol Chem 277: 48403–48409, 2002.[Abstract/Free Full Text]
  37. Palmer LA, Gaston B, and Johns RA. Normoxic stabilization of hypoxia-inducible factor-1 expression and activity: redox-dependent effect of nitrogen oxides. Mol Pharmacol 58: 1197–1203, 2000.[Web of Science][Medline]
  38. Park SK, Dadak AM, Haase VH, Fontana L, Giaccia AJ, and Johnson RS. Hypoxia-induced gene expression occurs solely through the action of hypoxia-inducible factor 1{alpha} (HIF-1{alpha}): role of cytoplasmic trapping of HIF-2{alpha}. Mol Cell Biol 23: 4959–4971, 2003.[Abstract/Free Full Text]
  39. Podrabsky JE and Somero GN. Changes in gene expression associated with acclimation to constant temperatures and fluctuating daily temperatures in an annual killifish Austrofundulus limnaeus. J Exp Biol 207: 2237–2254, 2004.[Abstract/Free Full Text]
  40. Portner HO. Climate variations and the physiological basis of temperature-dependent biogeography: systemic to molecular hierarchy of thermal tolerance in animals. Comp Biochem Physiol A 132: 739–761, 2002.[CrossRef][Medline]
  41. Pugh CW, O'Rourke JF, Nagao M, Gleadle JM, and Ratcliffe PJ. Activation of hypoxia-inducible factor-1; definition of regulatory domains within the {alpha} subunit. J Biol Chem 272: 11205–11214, 1997.[Abstract/Free Full Text]
  42. Richard DE, Berra E, and Pouyssegur J. Nonhypoxic pathway mediates the induction of hypoxia-inducible factor 1{alpha} in vascular smooth muscle cells. J Biol Chem 275: 26765–26771, 2000.[Abstract/Free Full Text]
  43. Sawka MN, Wenger CB, and Pandolf KB. Thermoregulatory responses to acute exercise-heat stress and heat acclimation. In: Handbook of Physiology. Environmental Physiology. Bethesda, MD: Am Physiol Soc, 1996, sect. 4, vol. I, p. 157–187.
  44. Semenza GL. Hydroxylation of HIF-1: oxygen sensing at the molecular level. Physiology 19: 176–182, 2004.[Abstract/Free Full Text]
  45. Shams I, Avivi A, and Nevo E. Hypoxic stress tolerance of the blind subterranean mole rat: expression of erythropoietin and hypoxia-inducible factor 1{alpha}. Proc Natl Acad Sci USA 101: 9698–9703, 2004.[Abstract/Free Full Text]
  46. Stroka DM, Burkharedt T, Desbaillets I, Wenger RH, Neil DAH, Bauer C, Gassmann M, and Candinas D. HIF-1 is expressed in normoxic tissue and displays an organ-specific regulation under systemic hypoxia. FASEB J 15: 2445–2453, 2001.[Abstract/Free Full Text]
  47. van Patot Tissot MC, Bendrick-Peart J, Beckey VE, Serkova N, and Zwerdlinger L. Greater vascularity, lowered HIF-1/DNA binding, and elevated GSH as markers of adaptation to in vivo chronic hypoxia. Am J Physiol Lung Cell Mol Physiol 287: L525–L532, 2004.[Abstract/Free Full Text]
  48. Tramontano AF, Muniyappa R, Black AD, Blendea MC, Cohen I, Deng L, Sowers JR, Cutaia MV, and El-Sherif N. Erythropoietin protects cardiac myocytes from hypoxia-induced apoptosis through an Akt-dependent pathway. Biochem Biophys Res Commun 308: 990–994, 2003.[CrossRef][Web of Science][Medline]
  49. Treinin M, Shliar J, Jiang H, Powell-Coffman JA, Bromberg Z, and Horowitz M. HIF-1 is required for heat acclimation in the nematode C. elegans. Physiol Genomics 14: 17–24, 2003.[Abstract/Free Full Text]
  50. Treins C, Giorgetti-Peraldi S, Murdaca J, Semenza GL, and Van Obberghen E. Insulin stimulates hypoxia-inducible factor 1 through a phosphatidylinositol 3-kinase/target of rapamycin-dependent signaling pathway. J Biol Chem 277: 27975–27981, 2002.[Abstract/Free Full Text]
  51. Wenger RH. Cellular adaptation to hypoxia: O2-sensing protein hydroxylases, hypoxia-inducible transcription factors, and O2-regulated gene expression. FASEB J 16: 1152–1162, 2002.
  52. Wright GL, Hanlon P, Amin K, Steenbergen C, Murphy E, and Arcasoy MO. Erythropoietin receptor expression in adult rat cardiomyocytes is associated with an acute cardioprotective effect for recombinant erythropoietin during ischemia-reperfusion injury. FASEB J 18: 1031–1033, 2004.[Abstract/Free Full Text]
  53. Yu AY, Fri MG, Shimoda LA, Weiner CM, Stenmark K, and Semenza GL. Temporal, spatial, and oxygen-regulated expression of hypoxia-inducible factor-1 in the lung. Am J Physiol Lung Cell Mol Physiol 275: L818–L826, 1998.[Abstract/Free Full Text]
  54. Zelzer E, Levy Y, Kahana C, Shilo B, Rubinstein M, and Cohen B. Insulin induces transcription of target genes through the hypoxia-inducible factor HIF-1/ARNT. EMBO J 17: 5085–5094, 1998.[CrossRef][Web of Science][Medline]
  55. Zheng W, Seftor EA, Meining CJ, Hendrix MJC, and Tomanek RJ. Mechanisms of coronary angiogenesis in response to stretch: role of VEGF and TGF-ß. Am J Physiol Heart Circ Physiol 280: H909–H917, 2001.[Abstract/Free Full Text]
  56. Zhong H, Chiles K, Feldser D, Laughner E, Hanrahan C, Georgescu MM, Simons JW, and Semenza GL. Modulation of hypoxia-inducible factor 1{alpha} expression by the epidermal growth factor/phosphatidylinositol 3-kinase/PTEN/AKT/FRAP pathway in human prostate cancer cells: implications for tumor angiogenesis and therapeutics. Cancer Res 60: 1541–1545, 2000.[Abstract/Free Full Text]
  57. Zhong H, De Marzo AM, Laughner E, Lim M, Hilton DA, Zagzag D, Buechler P, Isaacs WB, Semenza GL, and Simons JW. Overexpression of hypoxia-inducible factor 1{alpha} in common human cancers and their metastases. Cancer Res 59: 5830–5835, 1999.[Abstract/Free Full Text]
  58. Zhou J, Schmid T, Frank R, and Brune B. PI3K/Akt is required for heat shock proteins to protect hypoxia-inducible factor 1{alpha} from pVHL-independent degradation. J Biol Chem 279: 13506–13513, 2004.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M.-G. Ryou, D. C. Flaherty, B. Hoxha, J. Sun, H. Gurji, S. Rodriguez, G. Bell, A. H. Olivencia-Yurvati, and R. T. Mallet
Pyruvate-fortified cardioplegia evokes myocardial erythropoietin signaling in swine undergoing cardiopulmonary bypass
Am J Physiol Heart Circ Physiol, November 1, 2009; 297(5): H1914 - H1922.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J.-S. Lin, Y.-S. Chen, H.-S. Chiang, and M.-C. Ma
Hypoxic preconditioning protects rat hearts against ischaemia-reperfusion injury: role of erythropoietin on progenitor cell mobilization
J. Physiol., December 1, 2008; 586(23): 5757 - 5769.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
M. Martini, L. Teofili, T. Cenci, F. Giona, L. Torti, M. Rea, R. Foa, G. Leone, and L. M. Larocca
A novel heterozygous HIF2AM535I mutation reinforces the role of oxygen sensing pathway disturbances in the pathogenesis of familial erythrocytosis
Haematologica, July 1, 2008; 93(7): 1068 - 1071.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
A. Tetievsky, O. Cohen, L. Eli-Berchoer, G. Gerstenblith, M. D. Stern, I. Wapinski, N. Friedman, and M. Horowitz
Physiological and molecular evidence of heat acclimation memory: a lesson from thermal responses and ischemic cross-tolerance in the heart
Physiol Genomics, June 1, 2008; 34(1): 78 - 87.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
G.-J. Gu, Y.-P. Li, Z.-Y. Peng, J.-J. Xu, Z.-M. Kang, W.-G. Xu, H.-Y. Tao, R. P. Ostrowski, J. H. Zhang, and X.-J. Sun
Mechanism of ischemic tolerance induced by hyperbaric oxygen preconditioning involves upregulation of hypoxia-inducible factor-1{alpha} and erythropoietin in rats
J Appl Physiol, April 1, 2008; 104(4): 1185 - 1191.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
X.-H. Ning, S.-H. Chen, N. E. Buroker, C.-S. Xu, F.-R. Li, S.-P. Li, D.-S. Song, M. Ge, O. M. Hyyti, M. Zhang, et al.
Short-cycle hypoxia in the intact heart: hypoxia-inducible factor 1{alpha} signaling and the relationship to injury threshold
Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H333 - H341.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. A. Baird, D. W. Turnbull, and E. A. Johnson
Induction of the Heat Shock Pathway during Hypoxia Requires Regulation of Heat Shock Factor by Hypoxia-inducible Factor-1
J. Biol. Chem., December 15, 2006; 281(50): 38675 - 38681.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
D. S. Moran, L. Eli-Berchoer, Y. Heled, L. Mendel, M. Schocina, and M. Horowitz
Heat intolerance: does gene transcription contribute?
J Appl Physiol, April 1, 2006; 100(4): 1370 - 1376.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
L. Tomanek
WARM HEARTS PREPARE RATS FOR BEING SHORT OF BREATH
J. Exp. Biol., January 1, 2006; 209(1): v - v.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
23/1/79    most recent
00279.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maloyan, A.
Right arrow Articles by Horowitz, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maloyan, A.
Right arrow Articles by Horowitz, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.