Physiol. Genomics Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 21: 112-116, 2005. First published January 4, 2005; doi:10.1152/physiolgenomics.00275.2004
1094-8341/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
21/1/112    most recent
00275.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grondin, M.
Right arrow Articles by Deng, A. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grondin, M.
Right arrow Articles by Deng, A. Y.
Received 18 November 2004; accepted in final form 18 December 2004.
Physiological Genomics 21:112-116 (2005)
1094-8341/05 $8.00 © 2005 American Physiological Society

Complete and overlapping congenics proving the existence of a quantitative trait locus for blood pressure on Dahl rat chromosome 17

Myrian Grondin 1, Vasiliki Eliopoulos 1, Raphaelle Lambert 1, Yishu Deng 2, Anita Ariyarajah 1, Myriam Moujahidine 1, Julie Dutil 1, Sophie Charron 1 and Alan Y. Deng 1

1 Research Centre, Centre Hospitalier de l’Universite de Montréal (CHUM), Montréal, Québec, Canada
2 Number Three People’s Hospital of Yunnan, Kunming, Yunnan, China


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Linkage studies suggested that a quantitative trait locus (QTL) for blood pressure (BP) was present in a region on chromosome 17 (Chr 17) of Dahl salt-sensitive (DSS) rats. A subsequent congenic strain targeting this QTL, however, could not confirm it. These conflicting results called into question the validity of localization of a QTL by linkage followed by the use of a congenic strain made with an incomplete chromosome coverage. To resolve this issue, we constructed five new congenic strains, designated C17S.L1 to C17S.L5, that completely spanned the ±2 LOD confidence interval supposedly containing the QTL. Each congenic strain was made by replacing a segment of the DSS rat by that of the normotensive Lewis (LEW) rat. The only section to be LL homozygous is the region on Chr 17 specified in a congenic strain, as evidenced by a total genome scan. The results showed that BPs of C17S.L1 and C17S.L2 were lower (P < 0.04) than that of DSS rats. In contrast, BPs of C17S.L3, C17S.L4, and C17S.L5 were not different (P > 0.6) from that of DSS rats. Consequently, a BP QTL must be located in an interval of ~15 cM shared between C17S.L1 and C17S.L2 and unique to them both, as opposed to C17S.L3, C17S.L4, and C17S.L5. The present study illustrates the importance of thorough chromosome coverage, the necessity for a genome-wide screening, and the use of "negative" controls in physically mapping a QTL by congenic strains.

Dahl salt-sensitive rat; normotensive Lewis rat; congenic strain; congenic substrain


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
THE PRESENCE OF A BLOOD PRESSURE (BP) quantitative trait locus (QTL) on rat chromosome 17 (Chr 17) was originally hinted on by linkage analyses of an F2 population derived from a cross between the Dahl salt-sensitive (DSS) and Lewis (LEW) rats (6). The maximum LOD score supporting this localization was 2.9, which constitutes a suggestive linkage (6). Subsequently, another group of investigators using a different model of salt-sensitive hypertension, the Sabra strain, independently localized a QTL by linkage to a similar region, but with a higher LOD score of 3.43 (27). Employing recombinant inbred strains derived from crosses between the spontaneously hypertensive (SHR) and Brown Norway (BN) rats (22), a separate group of investigators did not find linkage to BP, but they found linkage to the left ventricular mass in a region on Chr 17 distant from the interval containing the BP QTL reported in DSS and Sabra rats (6, 27). Recently, researchers studying cardiac hypertrophy associated with pulmonary hypertension (28) showed that a QTL for right ventricular mass was localized to a Chr 17 region close to the BP QTL in DSS (6) and Sabra (27) strains. Finally, linkage analysis based on the Lyon rats also showed that a QTL on Chr 17 was involved in controlling metabolic homeostasis and BP (3).

Nevertheless, the BP QTL localization (6) was questioned because a congenic strain made by replacing a segment of the DSS chromosome with that of LEW did not show any BP effect (12). Due to a lack of markers at the time, the entire ±2 LOD support interval harboring the QTL was not replaced in that study (12). Consequently, the validity of the QTL could not be verified.

For the convenience of presentation and discussion, the congenic strain previously made (12) is designated as congenic 1. Because congenic 1 was constructed on selecting certain Chr 17 markers alone and did not span fully the region supposed to harbor the QTL (12), the observed result using congenic 1 was not entirely unexpected. The present investigation was designed, first, to create congenic strains to cover, at minimum, the ±2 LOD support interval harboring the QTL. Once a BP effect was demonstrated in the congenic strain by telemetry, congenic substrains were made to derive "negative" control congenic strains.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals.
The SS/Jr rat used for making the congenic strain and substrains will be designated as DSS in the present report and is the same as we used previously (2, 7, 9, 10, 1821, 24). LEW/CrlBR (LEW) rats were purchased from Charles Rivers Laboratories (La Salle, Quebec, Canada). Protocols for handling as well as maintaining animals were approved by our Institutional Animal Committee. All experimental procedures were in accordance with the guidelines of institutional, provincial, and federal regulations.

Breeding scheme for generating congenic strains.
The breeding procedure, markers used for the total genome scan, and screening protocol were similar to those reported previously (2, 7, 18, 20, 21, 24). From this process, two congenic strains were produced and are designated as DSS.LEW-(D17Rat65-Prl)/Lt (abbreviated as C17S.L1) and DSS.LEW-(D17Chm14/D17Rat181)/Lt (abbreviated as C17S.L2). C17 indicates that the strains are made for Chr 17.

Derivations of congenic substrains followed virtually the same procedure as those for Chr 10 (21). Briefly, rats of the DSS and C17S.L1 were cross-bred to produce F1 rats, which then were intercrossed to produce F2 progeny. The F2 rats were genotyped with D17Rat65 and prolactin (Prl) (Fig. 1) to search for crossovers. Once a crossover was identified, other markers located between D17Rat65 and D17Rat83 were genotyped to define more precisely the crossover breakpoints. Several rats with crossovers in the regions of interest were capable of breeding. Each of these rats was then backcrossed (BC) to a DSS rat to duplicate the fragment. Male and female heterozygous BC rats were intercrossed to derive progeny homozygous LL for the region of interest, and SS for the rest of the chromosome and the rest of the genome. This phenotype was reverified by genotyping >114 markers scattered throughout the rat genome, as was done for making C17S.L1. As a result, three congenic substrains were established. They were DSS.LEW-(D17Rat65/D17Chm2)/Lt (abbreviated as C17S.L3), DSS.LEW-(D17Chm9/D17Rat97)/Lt (abbreviated as C17S.L4), and DSS.LEW-(D17Chm14/D17Rat97)/Lt (abbreviated as C17S.L5) (Fig. 1).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1. Congenic quantitative trait locus (QTL) mapping on Dahl rat chromosome 17 (Chr 17). Maps refer to physical (base pairs), radiation hybrid (cR), and linkage (cM) maps from left to right. The linkage map is essentially the same as has been published previously (6, 8, 12). Oval bars to the left of the cR and cM maps represent base pairs on the physical map. They refer to the alignment of rat supercontigs in an ascending order from top to bottom on Chr 17, obtained by blasting a marker to the rat genome database (http://www.ncbi.nlm.nih.gov/genome/seq/RnBlast.html). The name of a supercontig starts with NW_0474, followed by 2-digit nos. Nos. below a supercontig indicate its approximate size in base pairs. Solid bars under congenic strains symbolize the Dahl salt-sensitive (DSS) chromosome fragments (open bar) that have been replaced by that of the Lewis (LEW) rat. Hatched bars on the ends of solid bars indicate the ambiguities of crossover breakpoints between markers. The rest of Chr 17 and the rest of the genome of each congenic strain are SS homozygous. Agtr1a, angiotensin receptor AT1A; Chrm3, acetylcholine receptor m3 muscarinic; Drd1a, dopamine 1A receptor; Edn1, endothelin-1; Prl, prolactin; Ryr2, cardiac isoform of the ryanodine receptor. The rest of the markers are anonymous [either from our current or previous work (6, 8, 12) or from the rat database http://www.genome.wi.mit.edu/rat/public/]. Markers included inside parentheses are those not genotyped for a lack of polymorphisms between DSS and LEW. Their placements were done based on their chromosome locations only (6, 8, 12, 28). Primers (5' to 3', forward and reverse) for new markers are as follows: D17Chm2, gagcaggaactggtctcattg and tgccatgacattggctaaaa; D17Chm9, cagatggtcaatgtgacagga and cctctgacttctggcctaca; D17Chm14, gcagatcaggcagggagtta and caggaggcagaagcatttgt; D17Chm19, tagtgcccagcaattgtgtc and gccatctgttgtgtgttgct; D17Chm26, ggtcaacgatgcaaaagaca and aaggtggtggattaccttgg; and D17Chm55, cagcagcccatcactgtaaa and aaagtttggtccccagtgtg. Congenic strains are DSS.LEW-(D17Rat65-Prl)/Lt (abbreviated as C17S.L1), DSS.LEW-(D17Chm14/D17Rat83)/Lt (abbreviated as C17S.L2), DSS.LEW-(D17Rat65/D17Chm2)/Lt (abbreviated as C17S.L3), DSS.LEW-(D17Chm9/D17Rat97)/Lt (abbreviated as C17S.L4), and DSS.LEW-(D17Chm14/D17Rat97)/Lt (abbreviated as C17S.L5). Placement of the QTL is indicated by a bracket to the right of the congenic strains. The chromosome coverage from our previous work (12) is indicated to the extreme right under Ref. 12. Mean arterial pressures (MAPs) at bottom refer to those averaged throughout the period of measurements, in mmHg, for the strains above; n indicates the no. of animals used.

 
Production of new chromosome markers.
Supercontigs located in Chr 17 regions of interest were first identified by blasting with a known marker at the website http://www.ncbi.nlm.nih.gov/genome/seq/RnBlast.html. From such a supercontig, regions possessing microsatellites were searched and, when found, were used to design PCR-based markers for genotyping rats. According to the guideline on rat nomenclature (http://rgnc.gen.gu.se/Brief.html), these new markers (Fig. 1) were designated with D17Chm prefixes, which represent CHUM.

BP measurements.
The determination of BPs of the rats was, in principle, the same as described previously (2, 7, 9, 10, 1821, 24). In brief, the mating pairs of the DSS and congenic strains to be studied were bred simultaneously. Male rats were selected and weaned at 21 days of age, maintained on a low-salt diet (0.2% NaCl; Harlan Teklad 7034), and then fed a high-salt diet (2% NaCl; Harlan Teklad 94217) starting at 35 days of age until the end of the experiment. Telemetry probes were implanted when rats were 56 days old (i.e., after 3 wk of the high-salt diet), with their body weights between 250 and 320 g. After the surgery, the rats were allowed 10 days to recuperate before their BPs were read. The implantation of telemetry probes, age, and postoperative care of animals are the same as described before (9, 10). The telemetry system from Data Sciences (St. Paul, MN) was used to measure BP. Each telemetry probe was calibrated before and cleaned after each usage, according to manufacturer’s instructions.

BP studies.
The basic design of raising animals is similar to our previous congenic work regarding age and sex and in terms of the time table of dietary treatments (2, 7, 9, 10, 1821, 24). One BP reading was taken every 2 min for the period of measurement. Then, these readings were averaged for 24 h to obtain one data point, which appears as a point on the graph. Please see Dutil and Deng (9) for detailed comparisons of BPs of DSS and a congenic strain showing even finer reading variations during our typical BP measurements.

BPs for all the strains shown in the Fig. 1 were measured, at least, at two different times, i.e., they were separate litters raised at different time periods, for the purpose of excluding seasonal variations in the measurements (data not shown). BPs for all the strains were measured simultaneously each time. The results from these separate measurements were not different for each strain (P > 0.05) for pooling.

Statistical analysis.
Repeated-measures ANOVA followed by the Dunnett test in the SYSTAT 9 program (SPSS Sci, Chicago, IL) was used to compare the significance level for a difference or a lack of it in a BP component between a congenic strain and the S strain. The Dunnett test takes into account multiple group comparisons as well as sample sizes among the comparing groups. In the analysis, a BP component was compared at each day for the period of measurement among the strains (2, 7, 9, 10, 1821, 24).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Congenic constructions.
By following the strategy of selecting a BC rat at each generation, the construction of the first two congenic strains, C17S.L1 and C17S.L2, was accomplished in five, instead of eight or more, BC generations as used conventionally (1, 11, 12, 23, 26). Current results are consistent with those of other investigators (17) and with the previous work of our laboratory (2, 7, 1821, 24).

C17S.L1 was designed to cover, at minimum, the ±2 LOD support interval for the QTL between D17Mit5 and D17Mit2 (6, 12), although this coverage included a section of ambiguity between D17Chm55 and C17Mit2. C17S.L2 shared a segment of chromosome with C17S.L1. From C17S.L1, three substrains were derived (Fig. 1).

In this process of screening crossovers to derive substrains from C17S.L1, nine rats with different crossovers between D17Rat66 and Prl were obtained. Three of them died or did not breed, and consequently no substrains could be derived from them. Three other rats gave rise to three congenic substrains, C17S.L3, C17S.L4, and C17S.L5. The remaining three rats had crossovers within the chromosome region contained in C17S.L4 (Fig. 1). Because of a lack of an effect on BP in C17S.L4 (see below for detail), these last three rats were discarded.

Measurements of BP.
Mean arterial (MAP), diastolic (DAP), and systolic (SAP) pressures of DSS rats and those of rats of congenic strains were measured. BPs for all the strains were not different at the separate periods of measurements (data not shown). Therefore, the BP data were pooled from reproducible measurements for each strain. Patterns of diurnal variations among the strains were not different (data not shown). For the simplicity of comparisons among the strains, MAPs were shown at the bottom of Fig. 1. These numbers were given as averaged values throughout the days of measurements.

Mapping of a BP QTL.
MAPs of C17S.L1 and C17S.L2 were lower (P < 0.04) than those of DSS (Fig. 1). In contrast, MAPs of C17S.L3, C17S.L4, and C17S.L5 were not different (P > 0.68) from those of DSS (Fig. 1). Therefore, all the congenic strains can be classified into two groups, i.e., group 1, which had a BP effect (i.e., C17S.L1 and C17S.L2), and group 2, which did not have a BP effect (i.e., C17S.L3, C17S.L4, and C17S.L5).

Because C17S.L1 (Fig. 1) showed a BP effect, a QTL has to be located in the region between D17Rat65 and D17Rat181 markers. The region containing the QTL can be further narrowed to the segment that was shared between C17S.L1 and C17S.L2 but not shared between group 1 and group 2 congenic strains (Fig. 1). This means that the location of the QTL is between D17Rat97 and D17Rat181 markers. This interval is ~15 cM. The possibility cannot be excluded that another C17QTL could exist in the interval of 8.8 cM between D17Rat181 and D17Rat84, because C17S.L2 had a BP effect.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The major conclusion from the current work is that the BP QTL, which previously did not show to be present (12), has now been proven to exist in a segment of ~15 cM on Dahl rat Chr 17, not including the Endothelin-1 gene (Edn1). The positive proofs came from two congenic strains, C17S.L1 and C17S.L2.

Proof of the presence of a BP QTL on Dahl rat Chr 17.
If such a BP QTL exists in the fragment between D17Rat97 and D17Rat181, it has to fulfill the following criteria. Multiple congenic strains sharing the same chromosome section had to show BP effects, whereas any other congenic strains not sharing it should not have BP effects. Indeed, this is the case. C17S.L1 and C17S.L2 clearly demonstrated BP effects, and they have one segment between D17Chm2 and D17Rat181 in common (Fig. 1). In contrast, C17S.L3, C17S.L4, and C17S.L5 possess the same genome constitutions as C17S.L1 and C17S.L2 except for the LL congenic regions in question (Fig. 1), and they did not manifest BP effects. By comparing the chromosome interval shared between C17S.L1 and C17S.L2, which is not in common with C17S.L3, C17S.L4, and C17S.L5, one can further narrow the region harboring the QTL to the segment between D17Rat97 and D17Rat181 (i.e., excluding the section between D17Chm2 and D17Rat97). Moreover, a lack of BP effects in C17S.L3, C17S.L4, and C17S.L5 proves also that the BP effects observed in C17S.L1 and C17S.L2 can be directly attributed to the QTL present in the region between D17Rat97 and D17Rat181 and were not due to the influence from the rest of the genome. Therefore, during the process of congenic constructions, the residual genetic background from LEW, if any, could not have lowered BPs observed in C17S.L1 and C17S.L2.

Because the region harboring the QTL is ~15 cM (Fig. 1), it is still too large for positional cloning to identify the QTL. One way to narrow the region is by fine mapping with congenic substrains involving smaller chromosome intervals within acetylcholine receptor m3 muscarinic (Chrm3) and Prl. During the process of screening crossovers to derive congenic substrains from C17S.L1, of the nine rats found, only one showed a crossover between Chrm3 and Prl. This rat subsequently died before breeding could take place. Thus no substrain was derived from it. One reason of a scarcity of crossovers detected in the region between Chrm3 and Prl could be due to the presence of a crossover "cold" region, among other factors.

Comparisons with our previous results.
How would one explain that our original congenic strain (12), congenic 1, failed to exhibit a BP effect? This could be due to one or a combination of the following reasons.

First, the region of crossover ambiguity in congenic 1 (12) overlaps with the region of C17S.L4 and C17S.L5 in our current work. These regions are shown as hatched bars in the top section of Ref. 12 and the bottom sections for C17S.L4 and C17S.L5 in Fig. 1. More precisely, the crossover regions of ambiguity in the two different studies still had in common the segment between D17Rat97 and Chrm3, which is 184.2 – 168.7 = 15.5 cR, or 1.8 megabases in size. The QTL could fall in this gap. It would be interesting to define more precisely the crossover break point in congenic 1 (12). This could be done by genotyping all the markers located between D17Mit5 and Chrm3, as shown in Fig. 1, in congenic 1. Unfortunately, our research group at CHUM did not have available the genomic DNA samples from congenic 1 to resolve this issue, because it was produced in collaboration with the laboratory of Dr. J. P. Rapp at the Medical College of Ohio.

Second, congenic 1 (12) was constructed by the conventional method (23), i.e., only selecting for several Chr 17 markers, whereas our present congenic strains were selected based on a total genomic scan. Consequently, there could be some undefined residual heterozygosity or even homozygosity from the LEW genome remaining in congenic 1 (12). Without the benefit of a total genome scan and a negative control congenic strain, it remains unknown whether a QTL(s) from another chromosome region(s) could have any additive or suppressive influence on the expression of the QTL on Chr 17, assuming that it was trapped in congenic 1. In contrast, the QTL-residing segment defined in our current work was proven in two "positive" congenic strains, C17S.L1 and C17S.L2. The remaining genetic background was ruled out to have any influence on BP shown from the QTL by three negative congenic strains, C17S.L3, C17S.L4, and C17S.L5.

Third, it cannot be excluded that there exists a potential strain difference between the LEW rats used in the two independent studies. Both LEW strains are inbred and were purchased from Charles River Laboratories [at Wilmington, MA, previously (12) and at La Salle, Quebec, Canada, in our current work]. Despite this nomenclature similarity, there is no information on a possible genetic divergence in Chr 17 QTL alleles in the strain between the two different sources.

Finally, a technical difference in BP measurements could have resulted in different results. The BP measurements conducted previously were by tail cuff (12), whereas those in our current work were by telemetry. Although differences in these two methods were evident (5), the results in mapping BP QTLs using these two differing methods seem to be consistent. For example, in mapping multiple QTL on Dahl Chr 10, the tail cuff (13) and telemetry (7, 24) methods produced similar results. The possibility, however, cannot be completely excluded that these two methods could lead to differing results in QTL mapping.

In perspective, although the Edn1 is located on the outside of the QTL interval (Fig. 1), there are two genes that can be considered, potentially, as the candidate. They are the genes for the angiotensin II receptor AT1A (Agtr1a) (25) and a cardiac isoform of the ryanodine receptor (Ryr2) (28) (Fig. 1). Because no polymorphic markers were found for Ryr2 and Agtr1a (indicated by parentheses in Fig. 1), they were not genotyped in the congenic strains. Their placements on the map were based solely on their locations with reference to other markers (6, 8, 12, 28).

At this point of writing, there are no other substrains available to cover more narrowly the segment harboring the QTL between Chrm3 and Prl. However, because the QTL-containing interval is ~15 cM (Fig. 1), fine mapping by congenic substrains will be necessary for further reductions in the future. Barring the presence of a possible crossover cold spot, as our recent work (21) as well as that of other investigators (14) has demonstrated, it is possible to narrow a QTL interval to 1–2 cM or smaller. Then, one can test the candidacy of either Agtr1a or Ryr2 more precisely. On the basis of our previous work, it appears more definitive to rule out a candidate gene when a congenic strain harboring it lacks a BP effect than to prove it as a QTL. The genes coding for angiotensin-converting enzyme (Ace) and the inducible form of nitric oxide synthase (Nos2) are cases in point (21). Moreover, fine mapping will also address the issue of whether there would be more than one QTL present in the region (Fig. 1). If no candidate genes are present in the QTL interval of 1–2 cM, positional cloning would be used (4, 5, 16).

In conclusion, a systematic congenic strategy was utilized to produce two congenic strains exhibiting BP effects and, as controls, three congenic strains lacking BP effects. This congenic mapping approach provided physical evidence that a BP QTL is present in a segment of ~15 cM on Dahl Chr 17. With the rat genome-wide sequence now available (15), further fine congenic mapping and a mutation screening will be greatly facilitated on genes found in the QTL interval (4). The QTL region is homologous to a section of mouse Chr 13 and sections of human CHR1 and CHR6 (http://www.ncbi.nlm.nih.gov/). The QTL, once identified, could be used to study human essential hypertension (4, 5).


    GRANTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by grants from the Canadian Institutes for Health Research (CIHR), the Kidney Foundation of Canada, and the American Heart Association, National Center (an Established Investigator Grant), to A. Y. Deng. J. Dutil holds a graduate studentship from CIHR. R. Lambert is partially supported by a Bourse des Programmes de Biologie Moléculaire de l’Université de Montréal.


    ACKNOWLEDGMENTS
 
We thank the director of our research center for helpful comments on the manuscript.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: A. Y. Deng, Research Centre, Centre Hospitalier de l’Université de Montréal (CHUM), 7-132 Pavillon Jeanne Mance, 3840 rue St. Urbain, Montreal, Quebec H2W 1T8, Canada (E-mail: alan.deng{at}umontreal.ca).

10.1152/physiolgenomics.00275.2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Alemayehu A, Breen L, Krenova D, and Printz MP. Reciprocal rat chromosome 2 congenic strains reveal contrasting blood pressure and heart rate QTL. Physiol Genomics 10: 199–210, 2002.[Abstract/Free Full Text]
  2. Ariyarajah A, Palijan A, Dutil J, Prithiviraj K, Deng Y, and Deng AY. Dissecting quantitative trait loci into opposite blood pressure effects on Dahl rat Chromosome 8 by congenic strains. J Hypertens 22: 1495–1502, 2004.[CrossRef][Web of Science][Medline]
  3. Bilusic M, Bataillard A, Tschannen MR, Gao L, Barreto NE, Vincent M, Wang T, Jacob HJ, Sassard J, and Kwitek AE. Mapping the genetic determinants of hypertension, metabolic diseases, and related phenotypes in the lyon hypertensive rat. Hypertension 44: 695–701, 2004.[Abstract/Free Full Text]
  4. Deng AY. Functional genomics of blood pressure determination: dissecting and assembling a polygenic strait by experimental genetics. Curr Hypertension Rev 1: 35–50, 2005.
  5. Deng AY. In search of hypertension genes in Dahl salt-sensitive rats. J Hypertens 16: 1707–1717, 1998.[CrossRef][Web of Science][Medline]
  6. Deng AY, Dene H, Pravenec M, and Rapp JP. Genetic mapping of two new blood pressure quantitative trait loci in the rat by genotyping endothelin system genes. J Clin Invest 93: 2701–2709, 1994.[Web of Science][Medline]
  7. Deng AY, Dutil J, and Sivo Z. Utilization of marker-assisted congenics to map two blood pressure quantitative trait loci in Dahl rats. Mamm Genome 12: 612–616, 2001.[CrossRef][Web of Science][Medline]
  8. Deng AY, Smith-Mensah WH, Hoebee B, Garrett M, and Rapp JP. Linkage mapping of rat chromosome markers generated from chromosome-sorted DNA. Mamm Genome 9: 38–43, 1998.[CrossRef][Web of Science][Medline]
  9. Dutil J and Deng AY. Further chromosomal mapping of a blood pressure QTL in Dahl rats on chromosome 2 using congenic strains. Physiol Genomics 6: 3–9, 2001.[Abstract/Free Full Text]
  10. Dutil J and Deng AY. Mapping a blood pressure quantitative trait locus to a 5.7-cM region in Dahl salt-sensitive rats. Mamm Genome 12: 362–365, 2001.[CrossRef][Web of Science][Medline]
  11. Frantz S, Clemitson JR, Bihoreau MT, Gauguier D, and Samani NJ. Genetic dissection of region around the Sa gene on rat chromosome 1: evidence for multiple loci affecting blood pressure. Hypertension 38: 216–221, 2001.[Abstract/Free Full Text]
  12. Garret MR, Dene H, Walder R, Zhang Q, Cicila GT, Assadnia S, Deng AY, and Rapp JP. Genomic scan and congenic strains for blood pressure quantitative trait loci using Dahl salt-sensitive rats. Genome Res 8: 711–723, 1998.[Abstract/Free Full Text]
  13. Garret MR, Zhang X, Dukhanina OI, Deng AY, and Rapp JP. Two linked blood pressure QTL on chromosome 10 defined by Dahl-rat congenic strains. Hypertension 38: 779–785, 2001.[Abstract/Free Full Text]
  14. Garrett MR and Rapp JP. Defining the blood pressure QTL on chromosome 7 in Dahl rats by a 177-kb congenic segment containing Cyp11b1. Mamm Genome 14: 268–273, 2003.[CrossRef][Web of Science][Medline]
  15. Gibbs et al. (Rat Genome Sequencing Project Consortium). Genome sequence of the Brown Norway rat yields insights into mammalian evolution. Nature 428: 493–521, 2004.[CrossRef][Medline]
  16. Glazier AM, Nadeau JH, and Aitman TJ. Finding genes that underlie complex traits. Science 298: 2345–2349, 2002.[Abstract/Free Full Text]
  17. Jeffs B, Negrin CD, Graham D, Clark JS, Anderson NH, Gauguier D, and Dominiczak AF. Applicability of a "speed" congenic strategy to dissect blood pressure quantitative trait loci on rat chromosome 2. Hypertension 35: 179–187, 2000.[Abstract/Free Full Text]
  18. Moujahidine M, Dutil J, Hamet P, and Deng AY. Congenic mapping of a blood pressure QTL on Chromosome 16 of Dahl rats. Mamm Genome 13: 153–156, 2002.[CrossRef][Web of Science][Medline]
  19. Moujahidine M, Lambert R, Dutil J, Palijan A, Sivo Z, Ariyarajah A, and Deng AY. Combining congenic coverage with gene profiling in search of candidates for blood pressure QTLs in Dahl rats. Hypertens Res 27: 203–212, 2004.[CrossRef][Web of Science][Medline]
  20. Palijan A, Dutil J, and Deng AY. Quantitative trait loci with opposing blood pressure effects demonstrating epistasis on Dahl rat chromosome 3. Physiol Genomics 15: 1–8, 2003.[Abstract/Free Full Text]
  21. Palijan A, Lambert R, Sivo Z, Dutil J, and Deng AY. Comprehensive congenic coverage revealing multiple BP QTLs on Dahl rat Chromosome 10. Hypertension 42: 515–522, 2003.[Abstract/Free Full Text]
  22. Pravenec M, Gauguier D, Schott JJ, Buard J, Kren V, Bila V, Szpirer C, Szpirer J, Wang JM, and Huang H. Mapping of quantitative trait loci for blood pressure and cardiac mass in the rat by genome scanning of recombinant inbred strains. J Clin Invest 96: 1973–1978, 1995.[Web of Science][Medline]
  23. Rapp JP and Deng AY. Detection and positional cloning of blood pressure quantitative trait loci: is it possible? Hypertension 25: 1121–1128, 1995.[Abstract/Free Full Text]
  24. Sivo Z, Malo B, Dutil J, and Deng AY. Accelerated congenics for mapping two blood pressure quantitative trait loci on Chromosome 10 of Dahl rats. J Hypertens 20: 1–9, 2002.
  25. Wong C, Mahapatra NR, Chitbangonsyn S, Mahboubi P, Mahata M, Mahata SK, and O’Connor DT. The angiotensin II receptor (Agtr1a): functional regulatory polymorphisms in a locus genetically linked to blood pressure variation in the mouse. Physiol Genomics 14: 83–93, 2003.[Abstract/Free Full Text]
  26. Yagil C, Hubner N, Kreutz R, Ganten D, and Yagil Y. Congenic strains confirm the presence of salt-sensitivity QTLs on chromosome 1 in the Sabra rat model of hypertension. Physiol Genomics 12: 85–95, 2003.[Abstract/Free Full Text]
  27. Yagil C, Sapojnikov M, Kreutz R, Katni G, Lindpaintner K, Ganten D, and Yagil Y. Salt susceptibility maps to chromosomes 1 and 17 with sex specificity in the Sabra rat model of hypertension. Hypertension 31: 119–124, 1998.[Abstract/Free Full Text]
  28. Zhao L, Sebkhi A, Nunez DJ, Long L, Haley CS, Szpirer J, Szpirer C, Williams AJ, and Wilkins MR. Right ventricular hypertrophy secondary to pulmonary hypertension is linked to rat chromosome 17: evaluation of cardiac ryanodine Ryr2 receptor as a candidate. Circulation 103: 442–447, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Hum Mol GenetHome page
A. Y. Deng
Genetic basis of polygenic hypertension
Hum. Mol. Genet., October 15, 2007; 16(R2): R195 - R202.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
B. S. Huang, M. Ahmad, A. Y. Deng, and F. H.H. Leenen
Neuronal Responsiveness to Central Na+ in 2 Congenic Strains of Dahl Salt-Sensitive Rats
Hypertension, June 1, 2007; 49(6): 1315 - 1320.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. M. Saavedra
The Challenge of Genetic Studies in Hypertension
Circ. Res., May 25, 2007; 100(10): 1389 - 1393.
[Full Text] [PDF]


Home page
EndocrinologyHome page
N. Luo, S. M. Liu, H. Liu, Q. Li, Q. Xu, X. Sun, B. Davis, J. Li, and S. Chua Jr.
Allelic Variation on Chromosome 5 Controls {beta}-Cell Mass Expansion during Hyperglycemia in Leptin Receptor-Deficient Diabetes Mice
Endocrinology, May 1, 2006; 147(5): 2287 - 2295.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Charron, R. Lambert, V. Eliopoulos, C. Duong, A. Menard, J. Roy, and A. Y. Deng
A loss of genome buffering capacity of Dahl salt-sensitive model to modulate blood pressure as a cause of hypertension
Hum. Mol. Genet., December 15, 2005; 14(24): 3877 - 3884.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
S. Charron, C. Duong, A. Menard, J. Roy, V. Eliopoulos, R. Lambert, and A. Y. Deng
Epistasis, Not Numbers, Regulates Functions of Clustered Dahl Rat Quantitative Trait Loci Applicable to Human Hypertension
Hypertension, December 1, 2005; 46(6): 1300 - 1308.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
21/1/112    most recent
00275.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grondin, M.
Right arrow Articles by Deng, A. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grondin, M.
Right arrow Articles by Deng, A. Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.