Physiol. Genomics Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 20: 12-14, 2004. First published October 26, 2004; doi:10.1152/physiolgenomics.00204.2004
1094-8341/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Methods and Figures
Right arrow All Versions of this Article:
20/1/12    most recent
00204.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Parks, K. P.
Right arrow Articles by Brenner, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Parks, K. P.
Right arrow Articles by Brenner, C.
Received 7 September 2004; accepted in final form 25 October 2004.
Physiological Genomics 20:12-14 (2004)
1094-8341/02 $5.00 © 2004 American Physiological Society

Call For Papers: Comparative Genomics

Altered specificity of Hint-W123Q supports a role for Hint inhibition by ASW in avian sex determination

Kristen P. Parks1, Heather Seidle1, Nathan Wright1, Jeffrey B. Sperry2, Pawel Bieganowski1, Konrad Howitz3, Dennis L. Wright2 and Charles Brenner1

1 Departments of Genetics and Biochemistry and Norris Cotton Cancer Center, Dartmouth Medical School, Lebanon, New Hampshire
2 Department of Chemistry, Dartmouth College, Hanover, New Hampshire
3 Biomol Inc., Plymouth Meeting, Pennsylvania


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTS AND RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Hint is a universally conserved, dimeric AMP-lysine hydrolase encoded on the avian Z chromosome. Tandemly repeated on the female-specific W chromosome, Asw encodes a potentially sex-determining, dominant-negative Hint dimerization partner whose substrate-interacting residues were specifically altered in evolution. To test the hypothesis that Gln127 of Asw is responsible for depression and/or alteration of Hint enzyme activity, a corresponding mutant was created in the chicken Hint homodimer, and a novel substrate was developed that links reversal of AMP-lysine modification to aminomethylcoumarin release. Strikingly, the Hint-W123Q substitution reduced kcat/Km for AMP-lysine hydrolysis 17-fold, while it increased specificity for AMP-para-nitroaniline hydrolysis by 160-fold. The resulting 2,700-fold switch in enzyme specificity suggests that Gln127 could be the dominant component of Asw dominant negativity in avian feminization.

AMP-lysine hydrolase; W chromosome; dominant negative; site-directed mutagenesis


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTS AND RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
HINT IS A HOMODIMER of ~14 kDa subunits that functions as an AMP-lysine hydrolase and positive regulator of Kin28 in yeast, whose most conserved amino acids form the dimer interface and the substrate binding site (2, 3, 8). The Hint active site consists of mostly nonpolar residues that contribute to adenosine binding (3), the histidine that forms a phosphoramide with the substrate {alpha}-phosphate (11), Ser107, which interacts with the leaving group amine (8), and Trp123, which interacts with the alkyl portion of the lysine leaving group across the dimer interface (8).

Although it is known that male birds are homogametic with a ZZ karyotype and females are heterogametic with a ZW karyotype, the molecular basis for sexual differentiation is unknown, although the existence of a ZZW female warbler strongly suggests that genetic information on the W chromosome is responsible for feminization (1). In birds other than ostriches and emus, the female-specific W chromosome carries ~40 tandem repeats of an unusual Hint-related gene, ASW, whereas the Z chromosome carries a typical HINT gene (7, 12). In a striking departure from all previously isolated Hint homologous sequences, which conserve the AMP-lysine binding site more than other residues, the female-specific Asw protein has strong similarity to Hint except that 15 of 16 substrate-interacting residues are sexually dimorphic, i.e., altered in the W-encoded Asw with respect to the Z-encoded Hint (13). Thus, because the predicted dimerization interface (helix {alpha}2 and beta strand ß4) is virtually unaltered in Asw (13), and a single His-to-Ala substitution can reduce the catalytic activity of Hint by over 100,000-fold (2), evolutionary pressures may have ablated the AMP-lysine binding site in Asw but allowed Asw to function as a Hint heterodimerization partner. In this regard, it is important to note that of the 16 substrate-interacting residues in the Hint dimer, only one interacts with the AMP-lysine substrate across the dimer interface (8). That residue, Trp123, in the COOH-terminal Trp-Pro-Pro-Gly motif of Hint, is conspicuously substituted by Gln in the repeated, female-specific Asw sequence (13).

As a candidate female sex-determining gene, we reasoned that dominance and negativity might be functionally separable components of Asw’s activities. Negativity would seem to be a function of loss of AMP-binding residues in the Asw sequence, but, because the Hint dimer is not cooperative with respect to substrate hydrolysis (2), an inert dimerization partner would fail to depress Hint enzymatic activity by more than 50%. In fact, because there is no HINT gene on the W chromosome, HINT gene dosage is already reduced 50% by HINT gene absence. We therefore considered an explanation necessary for why a potential Hint dimerization partner lacking an active site is repeated 40 times on the W chromosome. By constructing a model of the putative Hint-Asw heterodimer based on crystal structures of rabbit Hint bound to products (3) and substrate analogs (8), we noted that Hint Trp123 is expected to be located on the Asw side of the dimer interface (13). More importantly, the model predicted that the residue in Asw that corresponds to Hint Trp123, namely Gln127, is physically located in the Hint half of the putative heterodimer. Thus we proposed that Gln127 in place of Trp123 is responsible for dominant depression and/or dominant alteration of activity of the Hint active site (13). In this study, with site-directed mutagenesis of chicken Hint and synthesis of a novel fluorescent Hint substrate, we establish that the W123Q allele of Hint creates a 2,700-fold alteration of substrate specificity, supporting a mechanistic role for Asw’s COOH-terminal Gln in feminization of developing birds.


    EXPERIMENTS AND RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTS AND RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
To study the AMP-lysine hydrolase activity of wild-type chicken Hint and the Hint-W123Q mutant, we modified a fluorigenic trypsin substrate [tert-butoxycarbonyl-L-lysine methylcoumarinamide (tBoc-Lys-MCA)] by adenylylation of the {epsilon}-amino group of lysine (tBoc-LysAMP-MCA, Fig. 1). Because this modification renders the lysinamide moiety resistant to trypsin, Hint incubations to liberate tBoc-Lys-MCA are coupled to tryptic digestion to quantitate Hint activity with aminomethylcoumarin (AMC) release from tBoc-Lys (see Supplemental Materials, are available online at the Physiological Genomics web site).1 As shown in Fig. 2 and Table 1, wild-type chicken Hint hydrolyzed tBoc-LysAMP-MCA with a kcat of 24 s–1 and a Km of 6.1 µM (specificity constant = 3,950,000 M–1s–1). Consistent with a dominant-negative role for the COOH-terminal Gln of Asw, the Hint-W123Q substitution depressed kcat ninefold (to 2.6 s–1) and increased Km twofold (to 11 µM) for an overall 17-fold decline in kcat/Km (229,000 M–1s–1). Because an Asw-Hint heterodimer would have only a single Hint active site per dimer, the predicted depression in AMP-lysine hydrolytic activity is >30-fold.



View larger version (8K):
[in this window]
[in a new window]
 
Fig. 1. Structure and synthesis of tBoc-LysAMP-MCA. Because the {epsilon}-adenylyl modification of Lys blocks trypsin cleavage, Hint enzymatic activity is limiting for production of tert-butoxycarbonyl-L-lysine methylcoumarinamide (tBoc-Lys-MCA), a trypsin substrate (see Supplemental Material, at the Physiological Genomics web site). tBoc-LysAMP-MCA was made as a modification of the adenosine 5'-phosphoramidate synthesis method of Fu et al. (4). Under an argon atmosphere at room temperature, 0.25 mmol of tBoc-Lys-MCA (Bachem) and 0.12 mmol ADP (Sigma) were dissolved in 2 ml pyridine plus 0.6 ml trimethylsilyl chloride, added dropwise, and the resulting mixture was stirred for 2 days. The mixture was evaporated, and 1 ml of 2 M aqueous ammonia was added to hydrolyze the residue. Product was extracted with four 5-ml volumes of diethyl ether, evaporated to dryness, and dissolved in 1.5 ml isopropanol:2 M aqueous ammonia:methanol (7:1:2). tBoc-LysAMP-MCA (yield = 20.6%) was purified twice by silica gel column chromatography using a 10 x 1 cm column. Peak material was analyzed by matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS) and nuclear magnetic resonance (NMR). MALDI was performed on an Applied Biosystems Voyager system 6235 in negative ion mode using 3-hydroxypicolinic acid (observed mass = 733.79; calculated mass = 734.26). 31P, 13C, and 1H-NMR data were collected using a 15-mm probe with the compound in DMSO. 1H-NMR (500 mHz, DMSO-d6, 50°C) {delta} = 10.93 (s, 1H), 10.85 (s, 1H), 8.47 (s, 1H), 8.12 (s, 1H), 7.81 (d, J = 2.0 Hz, 1H), 7.71 (d, J = 8.5 Hz, 1H), 7.53 (d, J = 8.8 Hz, 1H), 7.35–7.44 (m, 2H), 7.27 (d, J = 7.6 Hz, 1H), 7.10–7.16 (m, 1H), 6.25 (d, J = 1.2 Hz, 1H), 5.89 (d, J = 5.4 Hz, 1H), 5.57–5.62 (m, 1H), 4.55–4.59 (m, 1H), 4.18–4.21 (m, 1H), 4.07–4.21 (m, 1H), 4.02–4.05 (m, 1H), 3.83–3.88 (m, 1H), 3.74–3.80 (m, 1H), 2.72–2.77 (m, 1H), 2.66–2.70 (m, 1H), 2.36 (d, J = 4.2 Hz, 3H), 1.64–1.70 (m, 1H), 1.57–1.61 (m, 1H), 1.33 (d, J = 13.9 Hz, 9H), 1.23–1.25 (m, 1H), 1.00 (d, J = 6.1 Hz, 3H); 13C-NMR (hmqc, DMSO-d6, 50°C, partial) {delta} = 153.3, 126.5, 116.0, 112.7, 106.2, 87.5, 84.4, 74.5, 71.3, 64.3, 41.5, 40.3, 31.6, 28.8, 28.6, 28.1, 26.0, 18.6; 31P-NMR (300 mHz, DMSO-d6) {delta} = 2.66.

 


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 2. The 2,700-fold alteration of substrate specificity by W123Q alteration. The chicken Hint cDNA was amplified from EST clone pat.pk0069.a10 from the University of Delaware using primers 7038 (5' GATCGTCCATATGGCTGACGAGATCCGCAAGG) and 7039 (5' CACTCTCGAGTTAGCCAGGAGGCCAGCCCAACTG) and cloned into pSGA02 as an NdeI-XhoI fragment. The W123Q substitution was introduced (9) with mutagenic primer 7046 (5' GGTCGTCAGTTGGGCCAGCCTCCTGGCTAA). Enzymes were purified as described (2, 8). tBoc-LysAMP-MCA assays, at 5–50 µM, described and validated in detail in Supplementary Materials, were performed with 1.8 fmol of wild-type or 19 fmol Hint-W123Q at pH 5.5 with 1 mM EDTA. Reactions (10–20 min) were stopped by adjusting the pH to 9.5, addition of trypsin to a final concentration of 60 µg/µl to liberate aminomethylcoumarin (AMC), then quantitated by fluorescence. AMP-para-nitroaniline (AMP-pNA) assays with 3.6 pmol wild-type or 0.36 pmol Hint-W123Q were as described (8). Solid symbols are on the left y-axis. Open symbols are on the right y-axis.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Kinetic constants for wild-type and W123Q chicken Hint

 
Conversion of Hint dimers to Asw-Hint heterodimers could either depress AMP-lysine hydrolytic activity, promote another activity, or both. To test whether substitution of Trp123, which makes a hydrophobic interaction with the Lys leaving group of AMP-lysine in the substrate across the dimer interface (8), would promote hydrolysis of a bulkier adenylylated phosphoramide substrate, we tested wild-type and W123Q forms of chicken Hint on AMP-para-nitroaniline (AMP-pNA) (8). This molecule, which is followed spectroscopically, is a poor substrate for wild-type rabbit Hint (8). In the chicken system, the wild-type kcat was depressed 470-fold (to 0.051 s–1) and Km was elevated 15-fold (to 93 µM), for an overall specificity constant of 550 M–1s–1 with AMP-pNA. Remarkably, Hint-W123Q is 160-fold superior AMP-pNA hydrolase compared with wild-type Hint (kcat = 1.1 s–1; Km = 13 µM; kcat/Km = 88,000 M–1s–1). The 17-fold depressed AMP-lysine hydrolase activity coupled with 160-fold superior AMP-pNA hydrolase activity represents a 2,700-fold alteration of specificity, which is remarkable for a single amino acid substitution.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTS AND RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Although sex-specific body plans are fundamentally similar in all vertebrate phyla, birds and mammals make use of unique chromosomal sex determination systems while crocodiles, many turtles and some lizards lack genetically encoded switches and make use of environmental sex determination (5). Thus it has been argued that genetic switches have evolved independently in birds and mammals that take the place of temperature-dependent switches in organisms without sex chromosomes. Because Asw is repeated 40 times on the female-specific W chromosome and is highly expressed at the urogenital ridge precisely at the time of feminization (7, 12), we have considered Asw to be a strong candidate gene for female sex determination (13). The ability of Asw residue 127 to repress and alter Hint enzymatic activity is a plausible mechanism for function of Asw in this process; either of these activities might be sufficient for Asw function. Because functions of Hint that depend on protein-protein interactions have been proposed (10), one could hypothesize that Asw functions by altering putative Hint complexes or promoting a female-specific complex. However, as a Hint active site mutant is a functional null (2), it was interesting to determine whether an Asw residue could repress Hint enzymatic activity in trans.

This study is also instructive in dissection of how nature constructs a dominant-negative allele. As described by Ira Herskowitz (6), a dominant-negative allele ought to have two characteristics: simple loss of function and dominant interference. In the case of Asw, loss of function can be attributed to mutation of the active-site residues (13), which is sufficient to produce an inactive allele in vitro and in vivo (2). Because overexpression of an inert molecule would be pointless, however, we searched for the source of dominant interference in Asw. Transplantation of the dimer-crossing Trp to Gln substitution of Asw into the Hint sequence both depressed and altered specificity, consistent with a dominant-negative mechanism for Asw function in avian feminization.


    GRANTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTS AND RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Cancer Institute Grant CA-75954 to C. Brenner.


    ACKNOWLEDGMENTS
 
We thank Dr. Joan Burnside of the University of Delaware for the kind gift of EST clone pat.pk0069.a10.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: C. Brenner, Dartmouth Medical School, Rubin 733-HB7937, Lebanon, NH 03756 (E-mail: charles.brenner{at}dartmouth.edu).

10.1152/physiolgenomics.00204.2004.

1 The Supplemental Material for this article (Supplemental Methods and Figs. S1–S3) is available online at http://physiolgenomics.physiology.org/cgi/content/full/00204.2004/DC1. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTS AND RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Arlt D, Bensch S, Hansson B, Hasselquist D, and Westerdahl H. Observation of a ZZW female in a natural population: implications for avian sex determination. Proc R Soc Lond B Biol Sci 271: S249–S251, 2004.
  2. Bieganowski P, Garrison PN, Hodawadekar SC, Faye G, Barnes LD, and Brenner C. Adenosine monophosphoramidase activity of Hint and Hnt1 supports function of Kin28, Ccl1 and Tfb3. J Biol Chem 277: 10852–10860, 2002.[Abstract/Free Full Text]
  3. Brenner C, Garrison P, Gilmour J, Peisach D, Ringe D, Petsko GA, and Lowenstein JM. Crystal structures of Hint demonstrate that histidine triad proteins are GalT-related nucleotide-binding proteins. Nat Struct Biol 4: 231–238, 1997.[CrossRef][Web of Science][Medline]
  4. Fu H, Han B, and Zhao YF. Reaction of ADP with amino acid methyl esters mediated by trimethylsilyl chloride. Chem Commun (Camb) 33: 134–135, 2003.
  5. Graves JAM and Shetty S. Sex from W to Z: evolution of vertebrate sex chromosomes and sex determining genes. J Exp Zool 290: 449–462, 2001.[CrossRef][Web of Science][Medline]
  6. Herskowitz I. Functional inactivation of genes by dominant negative mutations. Nature 329: 219–222, 1987.[CrossRef][Medline]
  7. Hori T, Asakawa S, Itoh Y, Shimizu N, and Mizuno S. Wpkci, encoding an altered form of PKCI, is conserved widely on the avian W chromosome and expressed in early female embryos: implication of its role in female sex determination. Mol Biol Cell 11: 3645–3660, 2000.[Abstract/Free Full Text]
  8. Krakowiak A, Pace HC, Blackburn GM, Adams M, Mekhalfia A, Kaczmarek R, Baraniak J, Stec WJ, and Brenner C. Biochemical, crystallographic, and mutagenic characterization of Hint, the AMP-lysine hydrolase, with novel substrates and inhibitors. J Biol Chem 279: 18711–18716, 2004.[Abstract/Free Full Text]
  9. Kunkel TA, Roberts JD, and Zakour RA. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol 154: 367–382, 1987.[Web of Science][Medline]
  10. Lee YN, Nechushtan H, Figov N, and Razin E. The function of lysyl-tRNA synthetase and Ap4A as signaling regulators of MITF activity in Fc{epsilon}RI-activated mast cells. Immunity 20: 145–151, 2004.[CrossRef][Web of Science][Medline]
  11. Lima CD, Klein MG, and Hendrickson WA. Structure-based analysis of catalysis and substrate definition in the HIT protein family. Science 278: 286–290, 1997.[Abstract/Free Full Text]
  12. O’Neill M, Binder M, Smith C, Andrews J, Reed K, Smith M, Miller C, Lambert D, and Sinclair A. ASW: a gene with conserved avian W-linkage and female-specific expression in chick embryonic gonad. Dev Genes Evol 210: 243–249, 2000.[CrossRef][Web of Science][Medline]
  13. Pace HC and Brenner C. Feminizing chicks: a model for avian sex determination based on titration of hint enzyme activity and the predicted structure of an Asw-Hint heterodimer. Genome Biol 4: R18, 2003.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
T.-F. Chou and C. R. Wagner
Lysyl-tRNA Synthetase-generated Lysyl-Adenylate Is a Substrate for Histidine Triad Nucleotide Binding Proteins
J. Biol. Chem., February 16, 2007; 282(7): 4719 - 4727.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Weiske and O. Huber
The Histidine Triad Protein Hint1 Triggers Apoptosis Independent of Its Enzymatic Activity
J. Biol. Chem., September 15, 2006; 281(37): 27356 - 27366.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
S. Moriyama, J. Ogihara, J. Kato, T. Hori, and S. Mizuno
PKCI-W Forms a Heterodimer with PKCI-Z and Inhibits the Biological Activities of PKCI-Z In Vitro, Supporting the Predicted Role of PKCI-W in Sex Determination in Birds
J. Biochem., January 1, 2006; 139(1): 91 - 97.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
N. Backstrom, H. Ceplitis, S. Berlin, and H. Ellegren
Gene Conversion Drives the Evolution of HINTW, an Ampliconic Gene on the Female-Specific Avian W Chromosome
Mol. Biol. Evol., October 1, 2005; 22(10): 1992 - 1999.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. F. Seidle, P. Bieganowski, and C. Brenner
Disease-associated Mutations Inactivate AMP-Lysine Hydrolase Activity of Aprataxin
J. Biol. Chem., June 3, 2005; 280(22): 20927 - 20931.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T.-F. Chou, P. Bieganowski, K. Shilinski, J. Cheng, C. Brenner, and C. R. Wagner
31P NMR and Genetic Analysis Establish hinT as the Only Escherchia coli Purine Nucleoside Phosphoramidase and as Essential for Growth under High Salt Conditions
J. Biol. Chem., April 15, 2005; 280(15): 15356 - 15361.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Methods and Figures
Right arrow All Versions of this Article:
20/1/12    most recent
00204.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Parks, K. P.
Right arrow Articles by Brenner, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Parks, K. P.
Right arrow Articles by Brenner, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.