Physiol. Genomics Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 18: 325-330, 2004. First published June 1, 2004; doi:10.1152/physiolgenomics.00047.2004
1094-8341/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
18/3/325    most recent
00047.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Klöting, N.
Right arrow Articles by Klöting, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klöting, N.
Right arrow Articles by Klöting, I.
Received 24 February 2004; accepted in final form 25 May 2004.
Physiological Genomics 18:325-330 (2004)
1094-8341/04 $5.00 © 2004 American Physiological Society

Phenotypic and genetic analyses of subcongenic BB.SHR rat lines shorten the region on chromosome 4 bearing gene(s) for underlying facets of metabolic syndrome

Nora Klöting, Barbara Wilke and Ingrid Klöting

Department of Laboratory Animal Science, Medical Faculty, University of Greifswald, D-17495 Karlsburg, Germany


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Congenic BB.SHR (D4Got41-Npy-Tacr1; BB.4S) rats develop an incomplete metabolic syndrome with obesity, hyperleptinemia, and dyslipidemia compared with their progenitor strain, the diabetes-prone BB/OK rat. To narrow down the underlying gene(s), two subcongenic BB.SHR rat lines, briefly termed BB.4Sa and BB.4Sb, were generated. Male BB.4S (n = 20), BB.4Sa (n = 24), and BB.4Sb (n = 26) were longitudinally characterized for facets of the metabolic syndrome and analyzed for expression of genes located in the region of interest in liver and blood. Body weight gain was comparable, serum triglycerides and leptin were significantly increased, and total cholesterol and HDL-cholesterol ratio were decreased in BB.4S compared with both subcongenics. Serum insulin was significantly higher in BB.4S and BB.4Sa than in BB.4Sb. The adiposity index showed a graduated decrease from BB.6S to BB.4Sb. Obvious differences in relative expression were found in 6 of 10 genes in liver and in 2 of 9 genes in blood. Only one gene, the eukaryotic translation initiation factor 2{alpha} kinase 3 (Eif2ak3 also called Perk or Pek), was significantly less expressed in liver and in blood of both subcongenic BB.4Sa and BB.4Sb compared with their "parental" BB.4S rats. Based on the phenotype and genotype in BB.4S and its subcongenic derivatives, the most important region on chromosome 4 can be said to lie between D4Got72 and Tacr1. Eif2ak3 is mapped in this region. Considering the function of Eif2ak3, it may be a candidate gene for the development of glucose intolerance found in both subcongenics but not in BB.4S. Allelic variants between BB/OK and SHR could influence Eif2ak3 function, possibly leading not only to glucose intolerance but also to the disturbances in hepatic and renal function found in human Wolcott-Rallison syndrome.

rat model; obesity; dyslipidemia; congenic mapping


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
LINKAGE STUDIES IN RATS have revealed a number of quantitative trait loci (QTLs) for facets of the metabolic syndrome (6, 7, 10, 12, 1518, 20, 21). However, these localizations are only preliminary steps for the identification of the underlying gene(s), and further investigations are required to confirm the existence of QTLs; to this end, the construction of congenic strains is essential. Strains that are genetically identical except for a single chromosome segment are said to be congenic. Congenic strains are usually derived by backcross breeding and genomic selection techniques, by which a specific chromosome segment is transferred from the strain A onto the genetic background of a recipient strain B and designated B.A. If such a congenic B.A strain differs from the progenitor strain B, one can conclude that there is a locus within the transferred segment affecting the respective trait. To date, several congenic rat strains have been generated to dissect complex diseases; one of them is the congenic BB.SHR (D4Got41-Npy-Tacr1) rat, also known as BB.LL, in which a genetically defined region on chromosome 4 of diabetes-prone BB/OK rats was replaced by that of spontaneously hypertensive rats (SHR). These rats, briefly termed BB.4S, are normotensive, but develop an incomplete metabolic syndrome including obesity, hyperleptinemia, and dyslipidemia compared with their progenitor strain, the BB/OK rat (13, 14, 19). However, to identify the gene(s), the introgressed chromosomal segment must be systematically narrowed down to generate recombinants and new subcongenic lines carrying smaller segments, to increase the chance of identifying the relevant gene(s). Therefore, we generated two subcongenic BB.SHR rat lines, termed BB.4Sa and BB.4Sb, differing from the congenic strain by smaller and overlapping segments. The phenotypic characterization of these newly established lines showed obvious differences from BB.4S. To get an indication of whether genes located in the genetically defined region on chromosome 4 are differently expressed between BB.4S and its subcongenics, we analyzed the relative mRNA expression of selected genes that may contribute to some of the phenotypic differences between the rat lines studied. Both subcongenic lines differ from BB.4S in a region flanked by markers D4Got72 at position 91.0 Mb and Tacr1 at position 116.9 Mb on chromosome 4. Most genes located in this region are unknown or novel. Therefore, we selected 10 known genes for gene expression studies in liver and blood: 1) the prostaglandin F2{alpha} receptor (Ptgs2) at position 94.8 Mb; 2) the interleukin-12 receptor (Il12r) at position 97.2 Mb; 3) the eukaryotic translation initiation factor 2{alpha} kinase 3 (Eif2ak3), also known as pancreatic eukaryotic translation initiation factor 2{alpha} kinase 3 (Pek or Perk) at position 104.4 Mb; 4) zinc finger protein 103 (Zfp103) at position 105.0 Mb; 5) the sialyltransferase 9 (Siat9) at position 105.6 Mb; 6) and 7) the vesicle-associated membrane proteins 5 and 8 (Vamp5; Vamp8) at position 105.9 Mb; 8) the methionine adenosyltransferase II{alpha} (Mat2a) at position 106.0 Mb; 9) the gelsolin-like capping protein (Capg) at position 106.1 Mb; and 10) trans-Golgi network protein 1 (Ttgn1) at position 106.3 Mb on chromosome 4 (8).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals.
Congenic BB.4S rats (N5, F8) were crossed with BB/OK rats (F65), resulting in F1 hybrids which were intercrossed to select animals with appropriate recombinant events. By this procedure, two subcongenic lines were established. The detailed region of chromosome 4 characteristic of BB.4S and their subcongenic derivatives BB.4Sa and BB.4Sb is given in Table 1. For the longitudinal observations, 20 BB.4S, 24 BB.4Sa, and 26 BB.4Sb males were kept in pairs in Macrolon type III cages (Ehret, Emmendingen, Germany) under strict hygienic conditions and maintained on a 12:12-h light/dark cycle (5 AM/5 PM). All rats were free of major pathogens as described (11) and had free access to food (Ssniff, Soest, Germany) and acidulated water. In addition, five males of BB.4S, BB.4Sa, and BB.4Sb were used for gene expression studies.


View this table:
[in this window]
[in a new window]
 
Table 1. Chromosome 4 characteristics of congenic BB.4S and its subcongenic derivatives BB.4Sa and BB.4Sb

 
Phenotypic characterization.
Rats were examined seven times from the 12th to 32nd weeks of life (at 12, 14, 18, 22, 26, 30, and 32 wk) for serum triglycerides and total and HDL cholesterol. Serum insulin and leptin were determined at an age of 32 wk. Nonfasting blood samples were obtained from the rats by orbital puncture under light anesthesia (Sevofluran; Abbott, Wiesbaden, Germany). Body weight was recorded at an age of 3 and 6 wk, and thereafter at 2-wk intervals. The intraperitoneal glucose tolerance test was performed seven times (at 12, 16, 20, 24, 28, and 32 wk) by injecting the nonfasting rats with a glucose solution, dosage 2 g/kg body wt. Blood glucose levels were measured after tail vein incision at 0 (baseline), 10, 30, and 60 min after injection. To compare the glucose tolerance in dependence on age and strain (BB.4S, BB.4Sa, BB.4Sb), the area under the glucose curve (AUC) was analyzed and calculated from the blood glucose measurements (mmol x min). All experiments were carried out between 7 and 9 AM. All rats were killed at an age of 32 wk by an overdose of anesthetic (Sevofluran, Abbott), and liver, heart, and left and right inguinal adipose pads were removed and weighed. The weight of organs and the sum of adipose pads to body weight, multiplied by 100, yielded the relative weight of organs and adiposity index (AI), respectively.

Blood glucose was determined using a glucose analyzer (ESAT 6660–2; Medingen, Dresden, Germany). Serum triglycerides and total and HDL cholesterol were analyzed using an automatic analyzer (Cobas Mira Plus; Roche, Basel, Switzerland). Serum leptin and insulin were determined using a radioimmunoassay kit (rat leptin RIA Kit; Linco Research, St. Charles, MO) or ELISA (rat insulin ELISA; Mercodia, Uppsala, Sweden).

All experiments were performed in accordance with the rules for animal care of the Ministry of Nutrition, Agriculture and Forestry of the German government.

RNA isolation and cDNA synthesis.
Total RNA was isolated from liver and blood using the RNeasy Mini kit, which was eluted in 50 µl of RNase-free water (Qiagen, Hilden, Germany). Residual DNA was removed by treatment with 1 U of DNase per 1 µg RNA (RQ1 RNase-free DNase; Promega, Mannheim, Germany) at 37°C for 30 min. RNA concentration was measured by spectrophotometry. Only RNA samples with an OD260/OD280 ratio > 1.6 were used for experiments. Purified RNA (1.5 µg) from organ samples was supplemented with RNase-free water and 1 µl of random primer to a final volume of 13.5 µl. All samples were denatured for 5 min at 65°C and cooled immediately on ice. Reverse transcription mixture (6.5 µl) was added, containing 4 µl of M-MLV 5x reaction buffer, 0.5 µl (20 U) of RNasin, 1 µl of 10 mM dNTP mix (dATP, dCTP, dGTP, dTTP), and 1 µl (250 U) of Moloney murine leukemia virus reverse transcriptase. All reverse transcription products were manufactured by Promega. cDNA synthesis was performed for 50 min at 42°C, followed by an enzyme-inactivating step for 10 min at 72°C. cDNA was stored at –20°C until use.

Real-time quantitative PCR.
Real-time PCR was performed using the ABI PRISM sequence detection system 7000 (Perkin-Elmer Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. Reactions were performed with 12.5 µl of SYBR-Green Master Mix (ABI), 0.4–2.0 µl of each primer (50 ng/µl), 6 µl of template (cDNA), or no template. RNase-free water was added to a final volume of 25 µl. The cycling conditions were as follows: 50°C for 2 min, initial denaturation at 95°C for 10 min, followed by 45 cycles of 95°C for 15 s, 60°C for 1 min. Each quantitative PCR was performed in triplicate. Target cDNA were amplified by primer sets for Ptgs2 [forward (F), 3' TGGGATCTCCATGGTGTTCTCT 5'; reverse (R), 3' CCCGATGCACCTCTCAATG 5'], Il12r (F, 3' CAAGCATTTGCATCGCTATCA 5'; R, 3' GAGTAAATGCCTTTTGCCTGAAG 5'), Eif2ak3 (F, 3' AACGGAAGGAGTCTGAAACTCAGT 5'; R, 3' TTGGCTCAAAATCTGTTAGGTATCG 5'), Zfp103 (F, 3' CTGGGTACGTTCCACTCTCATCA 5'; R, 3' CCCACTGTACTCTTTAAGCATGACTT 5'), Siat9 (F, 3' TGCCTGAGCACGACTTTCCT 5'; R, 3' GCCCAGCTCTAGTCCGTGAAG 5'), Vamp5 (F, 3' GACGGAAATCATGCTCAACAATT 5'; R, 3' GCGCTGCTGCAACTCTGA 5'), Vamp8 (F, 3' GAACCTGGACCATCTCCGAAA 5'; R, 3' AACTTCCGGGCCACCTTCT 5'), Mat2a (F, 3' TGTCCTTGATGCACACCTTCAG 5'; R, 3' CTAGATGTAATTTCCCCAGCAAGAA 5'), Capg (F, 3' TCGGCGTTCCACAAGACAA 5'; R, 3' TCTCGGTCGCACGGATGT 5'), and Ttgn1 (F, 3' TTAGGCAGGCCACACTATGGA 5'; R, 3' CCCATCAGCATCCCACAGA 5'). All primer sequences were obtained from the GenBank (8). The rat 18S RNA gene served as the endogenous reference gene.

Expression analysis.
For each experimental sample, the amounts of targets and endogenous reference (18S RNA) were determined from the calibration curve. The target amount was then divided by the endogenous reference amount to obtain a normalized target value. The relative gene target expression was also normalized to the tissue sample of BB.4S rats (calibrator). Each normalized target value was divided by the calibrator-normalized target value to generate the final relative expression. Final results are expressed as n-fold differences in selected gene expression relative to the 18S RNA gene and the calibrator.

Statistical analysis.
Data are given as means and SD. For real-time PCR analysis, statistical analyses were conducted according to the instructions from Applied Biosystems. Differences were assessed by one-way analysis of variance corrected with Bonferroni-Holm using the statistical analysis system SPSS (SPSS Inc., Chicago, IL).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In comparison with congenic BB.4S rats, subcongenic BB.4Sa differs genetically in the region flanked by microsatellite markers D4Got72 and Tacr1, while BB.4Sb differs in the region flanked by markers D4Rat168 and Tacr1. Therefore, the BB.4Sb line has the shortest region of SHR (Table 1).

Body weight gain in BB.4S, BB.4Sa, and BB.4Sb males was comparable up to an age of 32 wk as shown in Fig. 1. In serum triglycerides BB.4S rats were characterized by significantly elevated values compared with both subcongenics from 18 to 32 wk of age. In contrast, serum total cholesterol was significantly higher in male BB.4Sa and BB.4Sb compared with BB.4S, except at 12, 14, and 26 wk (Fig. 1). The HDL-cholesterol ratio was comparable up to an age of 18 wk. Thereafter, the ratio significantly dropped in BB.4S males, but that of the subcongenics remained at the level observed at 18 wk. The most surprising results were observed in glucose tolerance, demonstrated as glucose area under the curve (AUC). The AUC of both subcongenics, BB.4Sa and BB.4Sb, was significantly elevated after 28 wk, which suggests an impaired glucose tolerance with increasing age.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. Body weight gain, serum triglycerides, serum total cholesterol, HDL-cholesterol ratio, and glucose tolerance (AUC) in BB.4S (solid lines), BB.4Sa (dotted lines), and BB.4Sb (dashed lines) rats. Symbols indicate significant difference between BB.4S and both congenics at 0.5 (*), 1 (**), or 0.1% (***); between BB.4S and BB.4Sa at 0.5 ({dagger}), 1 ({dagger}{dagger}), or 0.1% ({dagger}{dagger}{dagger}); or between BB.4Sa and BB.4Sb at 0.5 (x), 1 (xx), or 0.1% (xxx) level. AUC, area under the curve.

 
Table 2 summarizes those traits that were determined once at an age of 32 wk. Serum leptin and AI were significantly lower in subcongenic BB.4Sa and BB.4Sb than in BB.4S. Significant differences in AI were also found between BB.4Sa and BB.4Sb. The values were lower in BB.4Sb than in BB.4Sa. Comparable values of serum insulin were observed in BB.4S and BB.4Sa; the lowest values in BB.4Sb significantly differed from those of BB.4S and BB.4Sa. No significant differences were observed for relative weight of liver and heart.


View this table:
[in this window]
[in a new window]
 
Table 2. Serum leptin, insulin, adiposity index, and relative weight of liver and heart in congenic BB.4S rats and their subcongenic derivatives at an age of 32 wk

 
Obvious findings in the relative gene expression in liver (Fig. 2) were found in six genes, Eif2ak3, Zfp103, Vamp5, Vamp8, Capg, and Ttgn1. The expression of Eif2ak3, Zfp103, Vamp8, and Ttgn1 was significantly reduced in both subcongenics, whereas the expression of Vamp5 and Capg was significantly elevated in BB.4Sa compared with BB.4S and BB.4Sb. In contrast, there were only two of nine genes showing significant differences in relative gene expression in blood. The expression of Eif2ak3 and Siat9 was significantly reduced in both subcongenics compared with BB.4S. One gene, Ptgs2, was not expressed in blood.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2. Relative gene expression in liver and blood of 32-wk-old BB.4S rats and their subcongenic derivatives. Symbols indicate significant difference between BB.4S and both congenics at the 0.5% (*) or 1% (**) level. #Position on chromosome 4 in megabases.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Congenic BB.4S rats are characterized by significantly increased serum triglycerides and total cholesterol compared with rats of the parental strain, BB/OK. In addition, BB.4S rats develop obesity and hyperleptinemia (13, 14, 19). Comparing the traits between congenic BB.4S and their subcongenic derivatives, BB.4Sa and BB.4Sb, it is possible to group the traits into those which were significantly higher (serum triglycerides and leptin) and those which were significantly lower (serum total cholesterol, HDL-cholesterol ratio, and AUC) in BB.4S than in their subcongenic derivatives. This means that the genes responsible for an increase or decrease of these values must be located in the region that is different from BB.4S but comparable between both subcongenic lines. This common region is flanked by microsatellite markers D4Got72 and Tacr1 (cf. Table 1). A third group comprises exceptions. They were found in body weight gain, which was comparable between all three rat lines, in serum insulin, which was significantly reduced in BB.4Sb compared with BB.4Sa and BB.4S, and in AI, which decreased from BB.4S to BB.4Sa to BB.4Sb. Because of the comparable body weight gain, the responsible gene(s) must be of SHR origin and therefore should be located between D4Got41 and Ian4. In contrast, if there is a gene(s) in this region influencing serum insulin, the values of which in BB.4Sb rats were significantly lower than in BB.4S and BB.4Sa, it should be located between D4Rat168 and D4Rat171, for this region in BB.4Sb differs genetically from both BB.4Sa and BB.4S. The region is of BB origin in BB.4Sb and of SHR origin in BB.4Sa and BB.4S. No clear-cut relationship was found in AI. The graduated decrease from BB.4S to BB.4Sa to BB.4Sb seems to suggest an interaction of genes.

The incontestably most important region on chromosome 4 lies between D4Got72 and Tacr1, significantly decreasing values of serum lipids and leptin as well as leading to an impaired glucose tolerance in both subcongenic BB.4Sa and BB.4Sb compared with their "parental" BB.4S rats. The common region between D4Got72 and Tacr1 in BB.4Sa and BB.4Sb is of BB/OK origin. The relative expression of genes located in this region revealed significant differences in 6 of 10 genes of liver and in 2 of 9 genes of blood, because Ptgs2 was not expressed in blood. In liver, the expression of Vamp5 and Capg is significantly increased in BB.4Sa compared with BB.4S and BB.4Sb. However, there was no trait in which BB.4Sa differed significantly from both BB.4S and BB.4Sb. That may suggest that Vamp5 and Capg are not involved in the regulation of the traits studied. In contrast, four genes, Eif2ak3, Zfp103, Vamp8, and Ttgn1, were found to be significantly less expressed in both subcongenics compared with BB.4S. However, considering the relative expression not only in liver but also in blood, there was only one gene of common interest. Eif2ak3 was significantly reduced in liver and blood of both subcongenics compared with their "parental" BB.4S rats, which may reflect a general genetic difference between the subcongenics BB.4Sa and BB.4Sb and their "parental" BB.4S strain.

Eif2ak3 regulates protein synthesis and is expressed in most tissues, with the highest expression in pancreatic islets and placenta. The role of Eif2ak3 in maintaining the function of pancreatic ß-cells has been corroborated by studies on knockout mice lacking functional Eif2ak3. These knockout mice are born with an apparently normal phenotype, suggesting that Eif2ak3 is not required for development. Between 2 and 4 wk of age, however, these mice gradually develop hyperglycemia which coincides with decreased levels of insulin mRNA and protein. The diabetic phenotype of Eif2ak3 knockout mice is primarily caused by progressive loss of islet ß-cells, as evidenced by the high number of ß-cells that scored positive for an apoptosis marker. The targeted disruption of the mouse Eif2ak3 gene also resulted in abnormally elevated protein synthesis and higher levels of endoplasmic reticulum (ER) stress, indicating that it plays a major role in the ability of cells to adapt to ER stress (9, 26). The important role of Eif2ak3 in maintaining normal islet function is further illustrated by mice deficient in Eif2ak3 in islet ß-cells only. These ß-cell-specific knockout mice develop diabetes without other defects, such as growth retardation or skeletal abnormalities (25). In addition, Eif2ak3 is involved in permanent neonatal or early infancy insulin-dependent diabetes, known as Wolcott-Rallison syndrome (WRS) in humans. WRS is a rare autosomal recessive disorder (1 in 500,000 neonates) characterized by diabetes mellitus, multiple epiphyseal dysplasia, osteoporosis, and growth retardation. The disease causes islet ß-cell dystrophy without major detectable defects in the glucagon-secreting {alpha}-cells. Other frequent manifestations are hepatic and renal dysfunction, mental retardation, and cardiovascular abnormalities (25, 2224). Considering the function of Eif2ak3, it may be a candidate gene for the development of glucose intolerance found in both subcongenics but not in BB.4S. Because subcongenic BB.4Sa and BB.4Sb are homozygous for BB and BB.4S for SHR alleles, the increase of AUC in subcongenics could be attributed to different Eif2ak3 alleles in BB and SHR rats.

This idea is supported by human studies where allelic variants were found in Eif2ak3 connected with WRS (2, 3, 5). If allelic variants are detectable between BB and SHR, then the question arises whether the significantly different values of serum lipids and leptin in both subcongenics compared with congenic BB.4S could also be explained by allelic variants of the Eif2ak3 gene. Considering the current knowledge on the biological function of Eif2ak3, no connection seems to exist; it cannot, however, be excluded, especially given the findings of Brickwood et al. (3) in unrelated patients with WRS. They identified two novel mutations in the Eif2ak3 gene and found additional phenotypic features, including a predilection to severe hypoglycemic episodes, indicating hepatic impairment and renal failure. This observation suggests that depending on the mutation in the gene, different phenotypes can manifest that were not observed in knockout mouse models. If so, the significantly different values of serum lipids and leptin in both subcongenics compared with congenic BB.4S may also be explained by a specific allelic variant of the Eif2ak3 gene in the BB rat on the one hand and in SHR on the other, not only leading to glucose intolerance but also to a disturbed hepatic and renal metabolism. The only way to answer the question is to sequence the Eif2ak3 gene in BB and SHR rats. If there are no allelic variants between BB and SHR, then other genes should be located in the chromosome 4 region flanked by markers D4Rat72 and Tacr1 which influence the regulation of serum lipids and leptin. This task could be solved in the future with further expression analysis of genes located in the region of interest and by generating sub-subcongenic BB.4S rat lines to more specifically identify the concerned chromosomal region on chromosome 4.


    GRANTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This research is partially supported by Grant No. KL 771/8-1 of the Deutsche Forschungsgemeinschaft.


    ACKNOWLEDGMENTS
 
We thank Susanne Schuldt, Edeltraut Lübke, Silvia Sadewasser, and Kathrin Stabenow for expert technical assistance.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: I. Klöting, Dept. of Laboratory Animal Science, Medical Faculty, Univ. of Greifswald, D-17495 Karlsburg, Germany (E-mail: kloeting{at}uni-greifswald.de).

10.1152/physiolgenomics.00047.2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Al-Gazali LI, Makai S, Azzam A, and Hall CM. Wolcott-Rallison syndrome. Clin Dysmorphol 4: 227–233, 1995.[Medline]
  2. Biason-Lauber A, Lang-Muritano M, Vaccaro T, and Schoenle EJ. Loss of kinase activity in a patient with Wolcott-Rallison syndrome caused by a novel mutation in the EIF2AK3 gene. Diabetes 51: 2301–2305, 2002.[Abstract/Free Full Text]
  3. Brickwood S, Bonthron D, Al-Gazali LI, Piper K, Hearn T, Wilson DI, and Hanley NA. Wolcott-Rallison syndrome: pathogenetic insights into neonatal diabetes from new mutation and expression studies of Eif2ak3. J Med Genet 40: 685–689, 2003.[Free Full Text]
  4. Castelnau P, Le Merrer M, Diatloff-Zito C, Marquis E, Tete MJ, and Robert JJ. Wolcott-Rallison syndrome: a case with endocrine and exocrine pancreatic deficiency and pancreatic hypertrophy. Eur J Pediatr 159: 631–633, 2000.[CrossRef][Medline]
  5. Delepine M, Nicolino M, Barrett T, Golamaully M, Lathrop GM, and Julier C. EIF2AK3, encoding translation initiation factor 2-{alpha} kinase 3, is mutated in patients with Wolcott-Rallison syndrome. Nat Genet 25: 406–409, 2000.[CrossRef][ISI][Medline]
  6. Dominiczak AF, Clark JS, Jeffs B, Anderson NH, Negrin CD, Lee WK, and Brosnan MJ. Genetics of experimental hypertension. J Hypertens 16: 1859–1869, 1998.[CrossRef][Medline]
  7. Galli J, Fakhrai-Rad H, Kamel A, Marcus X, Norgren S, and Luthman H. Pathophysiology and genetic characterization of the major diabetes locus in GK rats. Diabetes 48: 2463–2470, 1999.[Abstract]
  8. GenBank.Rattus norvegicus chromosome 4 WGS supercontig. Accession number NW_047693 [Online]. http://www.ncbi.nlm.nih.gov/Genbank/GenbankSearch.html
  9. Harding HP, Zeng HQ, Zhang YH, Jungries R, Chung P, Plesken H, Sabatini DD, and Ron D. Diabetes mellitus and exocrine pancreatic dysfunction in Perk–/– mice reveals a role for translational control in secretory cell survival. Mol Cell 7: 1153–1163, 2001.[CrossRef][ISI][Medline]
  10. Klimes I, Weston K, Kovacs P, Gasperikova D, Jezova D, Kvetnansky R, Thompson JR, Sebokova E, and Samani NJ. Mapping of genetic loci predisposing to hypertriglyceridemia in the hereditary hypertriglyceridemic rat: analysis of genetic association with related traits of the insulin resistance syndrome. Diabetologia 46: 352–358, 2003.[ISI][Medline]
  11. Klöting I and Vogt L. BB/O(ttawa)K(arlsburg) rats: features of a subline of diabetes-prone BB rats. Diabetes Res 18: 79–87, 1991.[Medline]
  12. Klöting I, Berg S, Kovacs P, Voigt B, Vogt L, and Schmidt S. Diabetes and hypertension in rodent models. Ann NY Acad Sci 827: 64–85, 1997.[Abstract/Free Full Text]
  13. Klöting I, Kovacs P, and Kuttler B. Phenotypic consequences after restoration of lymphopenia in the diabetes-prone BB/OK rat. Biochem Biophys Res Commun 239: 106–110, 1997.[Medline]
  14. Klöting I, Kovacs P, and van den Brandt J. Congenic BB.SHR (D4Mit6-Npy-Spr) rats: a new aid to dissect the genetics of obesity. Obes Res 10: 1074–1077, 2002.[ISI][Medline]
  15. Klöting I, Kovacs P, and van den Brandt J. Quantitative trait loci for body weight, blood pressure, blood glucose and serum lipids: linkage analysis with wild rats (Rattus norvegicus). Biochem Biophys Res Commun 284: 1126–1133, 2001.[CrossRef][ISI][Medline]
  16. Klöting I, Kovacs P, and van den Brandt J. Sex-specific and sex-independent quantitative trait loci for facets of the metabolic syndrome in WOKW rats. Biochem Biophys Res Commun 284: 150–156, 2001.[CrossRef][Medline]
  17. Kovacs P and Klöting I. Quantitative trait loci on chromosomes 1 and 4 affect lipid phenotypes in the rat. Arch Biochem Biophys 354: 139–143, 1998.[CrossRef][Medline]
  18. Kovacs P, van den Brandt J, and Klöting I. Genetic dissection of the syndrome X in the rat. Biochem Biophys Res Commun 269: 600–605, 2000.
  19. Kovacs P, van den Brandt J, Bonné ACM, van Zutphen LFM, van Lith HA, and Klöting I. Congenic BB.SHR rat provided evidence for effects of a chromosome 4-segment (D4Mit6-Npy ~1 cM) on total serum and lipoprotein lipid concentration and composition after feeding a high-fat, high-cholesterol diet. Metabolism 50: 458–462, 2001.[Medline]
  20. Pravenec M and Kurtz TW. Genetics of Cd36 and the hypertension metabolic syndrome. Semin Nephrol 22: 148–153, 2002.[CrossRef][ISI][Medline]
  21. Pravenece M, Zidek V, Landa V, Kostka V, Musilova A, Kasdova A, Krenova D, Bila V, and Kren V. Genetic analysis of cardiovascular risk factor clustering in spontaneous hypertension. Folia Biol (Praha) 46: 233–240, 2000.
  22. Stöss H, Pesch HJ, Pontz B, Otten A, and Spranger J. Wolcott-Rallison syndrome: diabetes mellitus and spondyloepiphyseal dysplasia. Eur J Pediatr 138: 120–129, 1982.[CrossRef][Medline]
  23. von Muhlendahl KE and Herkenhoff H. Long-term course of neonatal diabetes. N Engl J Med 333: 704–708, 1995.[Abstract/Free Full Text]
  24. Wolcott CD and Rallison ML. Infancy-onset diabetes mellitus and multiple epiphyseal dysplasia. J Pediatr 80: 292–297, 1972.[CrossRef][ISI][Medline]
  25. Zhang P, McNaughton K, Li S, McGrath B, Reinert J, Liang SH, Yuan X, Ma K, and Caverner D. Perk eIF2 {alpha} kinase is required for multiple pancreatic functions and viability of secretory cells. Abstracts 4th West Coast Meeting on mRNA Stability and Translation, Seattle, WA 2001, p25.
  26. Zhang PC, McGrath B, Li SA, Frank A, Zambito F, Reinert J, Gannon M, Ma K, McBaughton K, and Cavener DR. The PERK eukaryotic initiation factor 2 {alpha} kinase is required for the development of the skeletal system, postnatal growth, and the function and viability of the pancreas. Mol Cell Biol 22: 3864–3874, 2002.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
M. Liang and B. Ventura
Physiological genomics in PG and beyond: October to December 2005
Physiol Genomics, December 14, 2005; 24(1): 1 - 3.
[Full Text] [PDF]


Home page
Physiol. GenomicsHome page
N. Kloting, N. Follak, and I. Kloting
Is there an autoimmune process in bone? Gene expression studies in diabetic and nondiabetic BB rats as well as BB rat-related and -unrelated rat strains
Physiol Genomics, December 14, 2005; 24(1): 59 - 64.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
M. Liang and B. Ventura
Physiological genomics in PG and beyond: July to September 2005
Physiol Genomics, October 17, 2005; 23(2): 119 - 124.
[Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J. H. Kim, T. P. Stewart, W. Zhang, H. Y. Kim, P. M. Nishina, and J. K. Naggert
Type 2 diabetes mouse model TallyHo carries an obesity gene on chromosome 6 that exaggerates dietary obesity
Physiol Genomics, July 14, 2005; 22(2): 171 - 181.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
18/3/325    most recent
00047.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Klöting, N.
Right arrow Articles by Klöting, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klöting, N.
Right arrow Articles by Klöting, I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.