|
|
||||||||
GT-AT1A receptor transgene protects renal cortical structure in AT1 receptor-deficient mice
1 Departments of Medicine and Pathology, Duke University and Durham Veterans Affairs Medical Centers, Durham 27705
2 Department of Pathology, University of North Carolina, Chapel Hill, North Carolina 27599
3 Pennsylvania State University College of Medicine, Hershey, Pennsylvania 17033
| ABSTRACT |
|---|
|
|
|---|
-glutamyl transpeptidase (
GT) promoter. In transgenic mice, this promoter has been shown to confer cell-specific expression in epithelial cells of the renal proximal tubule. To avoid random integration of multiple copies of the transgene, we used gene targeting to produce mice with a single-copy transgene insertion at the hypoxanthine phosphoribosyl transferase (Hprt) locus on the X chromosome. The physiological effects of the
GT-AT1A transgene were examined on a wild-type background and in mice with targeted disruption of one or both of the murine AT1 receptor genes (Agtr1a and Agtr1b). On all three backgrounds,
GT-AT1A transgenic mice were healthy and viable. On the wild-type background, the presence of the transgene did not affect development, blood pressure, or kidney structure. Despite relatively low levels of expression in the proximal tubule, the transgene blunted the increase in renin expression typically seen in AT1-deficient mice and partially rescued the kidney phenotype associated with Agtr1a/Agtr1b/ mice, significantly reducing cortical cyst formation by more than threefold. However, these low levels of cell-specific expression of AT1 receptors in the renal proximal tubule did not increase the low blood pressures or abolish sodium sensitivity, which are characteristic of AT1 receptor-deficient mice. Although our studies do not clearly identify a role for AT1 receptors in the proximal tubules of the kidney in blood pressure homeostasis, they support a major role for these receptors in modulating renin expression and in maintaining structural integrity of the renal cortex. proximal tubule; blood pressure; glomerular cysts
| INTRODUCTION |
|---|
|
|
|---|
Along with its effects on blood flow and epithelial functions in the kidney, angiotensin II plays a unique role in development and maintenance of renal structure. For example, administration of angiotensin converting enzyme (ACE) inhibitors or angiotensin receptor blockers during pregnancy produces abnormalities in kidney organogenesis (11). Targeted null mutations of the angiotensinogen, renin, or ACE genes that are associated with impaired generation of angiotensin II cause similar abnormalities of renal structure (14, 29, 37, 40). Combined knockout of both murine AT1 receptor genes (Agtr1a and Agtr1b) produces an identical phenotype (41, 56), indicating that the actions of angiotensin II to preserve renal structure are mediated by AT1 receptors.
AT1 receptors are expressed throughout the kidney. In situ hybridization and immunohistochemical analysis are consistent in their demonstration of AT1 receptors in renal vasculature including afferent and efferent arterioles, in mesangial cells, in the juxtaglomerular apparatus, and in epithelial cells in various nephron segments, including proximal tubule, thick ascending limb, distal tubule, and cortical collecting ducts (23, 24, 28, 46). This expression pattern likely reflects the distinct actions of AT1 receptors to regulate discrete physiological functions. However, the relative contributions of AT1 receptors in different nephron segments to in vivo functions such as the regulation of blood pressure and kidney structure are not known.
A series of studies have suggested that the AT1 receptors expressed on epithelial cells in proximal tubule have the capacity to stimulate sodium and fluid reabsorption (54, 59). Moreover, since more than 90% of the filtered load of sodium is reabsorbed by the proximal tubule, this segment represents a potential control point for modulating overall sodium excretion. To develop a model for defining the physiological actions of AT1 receptors in the proximal tubule in vivo, we generated a line of mice in which expression of the AT1A receptor is driven by the P1 portion of
-glutamyl transpeptidase (
GT) promoter, conferring cell-specific expression in proximal tubular epithelium (48, 51). In these mice, we find that the presence of the AT1 receptor transgene does not substantially alter resting blood pressure, but it attenuates the increase in renin expression and protects against renal structural abnormalities that are associated with generalized AT1 receptor deficiency.
| MATERIALS AND METHODS |
|---|
|
|
|---|
4 kb of DNA derived from the 5' upstream region flanking the Hprt locus. The 3' homology region contains proximal portions of the Hprt gene including sequences capable of restoring Hprt gene function in the BK4s ES cell line (49). This ES cell line has an inactivating deletion of the proximal portion of the Hprt gene. Working from pMP8SKB, we constructed a heterologous fusion gene with a 2.0-kb fragment containing the P1 portion of the promoter from the rat
GT gene (kindly provided by Dr. Martin Lieberman) inserted 5' to the coding sequence from the mouse Agtr1a gene. The polyadenylation signal from the mouse PGK gene was inserted 3' relative to the Agtr1a coding sequence. The
GT(P1)/AT1A/PGK-poly-A cassette was then ligated into the polylinker of the targeting vector between the two Hprt homology domains. Fidelity of the construct was determined by restriction mapping and sequencing.
|
Backcrossing of the
GT-AT1A transgene onto AT1 receptor-deficient backgrounds.
To examine the effects of the transgene in isolation, the
GT-AT1A transgenic mice were crossed with mice bearing a targeted disruption of the AT1A receptor gene (Agtr1a) alone or in combination with targeted disruption of the AT1B receptor gene (Agtr1b). The Agtr1a and Agtr1b mutations were then bred to homozygosity in order to obtain mice bearing the
GT-AT1A transgene on Agtr1a/ or Agtr1a/Agtr1b/ backgrounds, respectively. Because of poor survival of animals with combined 1A/1B-deficiencies, animals for experiments were generated by selective breeding on mixed backgrounds. To control for potential confounding effects of genetic background differences, littermate controls are used for our experiments. Since the Hprt locus is located on the X chromosome, all experiments were performed using male littermates to avoid the potential variability of transgene expression related to random inactivation of the X chromosome in females. All mice were bred and maintained in the AAALAC-accredited animal facility of the Durham Veterans Affairs Medical Center under National Institutes of Health guidelines.
RNA isolation.
Mice were killed, and their livers, hearts, kidneys, brains, and spleens were removed and immediately frozen in liquid nitrogen and stored at 80°C. Total RNA was prepared from 50100 mg of tissue using a tissue homogenizer and TRIzol reagent (Sigma Chemical). Total RNA samples were analyzed for purity by spectrophotometry, and samples with OD260/OD280 ratio of 1.8 or above were used for subsequent analysis.
Verification of transgene mRNA expression by RT-PCR.
Transgene mRNA expression was assayed by RT-PCR using primer pairs that are specific for AT1A receptor mRNA (forward primer GGGGCTGCAGATGGCCCTTAACTCTTCTACTG and reverse primer GGGGCTGCAGTCACTCCACCTCAGAACAAGAC). RT-PCR amplification was performed as follows: 1 h at 42°C, then 5 min at 99°C, followed by a total of 35 temperature cycles (30 s at 94°C and 1 min at 60°C). The PCR products were size fractionated on a 1.0% agarose gel and visualized with ethidium bromide staining and UV transillumination. In some cases, to verify the identity of the PCR products, gels were blotted onto nylon membranes and probed with a 32P-labeled AT1A receptor-specific oligonucleotide (GCATCATCTTTGTGGTGGG) that is internal to the primers used for amplification (Fig. 2).
|
7080%.
Quantitation of mRNA expression by real-time RT-PCR.
Relative levels of mRNA for AT1A and renin were determined by real-time RT-PCR with the ABI Prism 7700 sequence detection system as described, and the nucleotide sequences of the PCR primers and the fluorogenic probe have been published previously (30). Standard plasmids containing a DNA fragment for each of the genes of interest were used as external controls, and amplification of the ß-actin gene was used as an endogenous control. For each experimental sample, the amounts of the target and of the endogenous control were determined from the appropriate standard curves.
Systolic blood pressure measurement in conscious mice.
Systolic blood pressures were measured in conscious mice using a computerized tail-cuff system (Visitech Systems, Cary, NC) that determines systolic blood pressure using a photoelectric sensor. This system allows pressures to be measured in four mice simultaneously and minimizes the potential for observer bias. Before the study was initiated, mice were adapted to the apparatus for at least 5 days. The validity of this system has been established previously (32).
Effect of altered dietary sodium on systolic blood pressures.
To determine the effects of the transgene expression on the adaptation to changes in dietary salt intake, we measured systolic blood pressures in mice that were sequentially fed diets of differing sodium chloride content. The animals were first fed a standard diet containing 0.4% sodium chloride for 2 wk. This was followed by a 14-day period in which the animals were given a high-salt diet containing 6% sodium chloride. Following the high-salt feeding, the animals were fed a low-salt diet containing <0.02% sodium chloride for the next 14 days. All diets were purchased from Harlan-Teklad, Madison, WI. Mice were allowed free access to water. Systolic blood pressures were measured at least five times per week throughout the period of study.
Measurement of urine osmolality.
The effect of the
GT-AT1A transgene on urinary concentrating capacity was examined in mice housed in standard cages and allowed free access to 0.4% NaCl chow. After 24-h water deprivation, urine was collected from Agtr1a/ mice with and without the transgene by bladder massage. Urine osmolality was measured immediately using a vapor-pressure osmometer (Wescor Instruments).
Histological and image analyses.
To determine the effects of the transgene on renal structural abnormalities associated with generalized AT1 receptor deficiency, kidney sections from Agtr1a/Agtr1b/ mice with and without the transgene were evaluated by two pathologists (R. C. Dash and D. N. Howell) who were masked to the experimental groups. Hematoxylin and eosin-stained sections of 5-µm thick formalin-fixed paraffin-embedded tissue were examined. Digital images were captured using an Olympus (Melville, NY) BX40 microscope and an Optronics (Goleta, CA) model DEI 750, 3-CCD digital camera. A 2x low-power objective and a 0.45x camera adapter were used to generate an 0.9x optically demagnified image, which was captured at a digital resolution of 1,024 x 768 pixels. The digital images were analyzed using Optimas ver. 6.1 (Media Cybernetics, Del Mar, CA) image analysis software by keying on morphometric and color-specific features with spatial calibration instituted appropriate for the 2x objective used for measurement. All procedures and measurements were performed twice for each histological cross section and then averaged. The outline of the kidney cortex was manually traced using the analysis tools. A smaller concentric outline of the medulla was also identified, which included nonparenchymal pelvic calyceal open areas. The true cortical area was measured as the intersection of these two areas, with areas ranging from 7.7 to 11.1 mm2. Visual confirmation of appropriate labeling confirmed accurate measurement. A separate color sample was simultaneously tracked in a similar fashion to identify cystic areas, which were colored yellow. The Optimas software reported the data associated with the areas of interest, expressed in square millimeters, as well as a percent of the main cortical region of interest.
Data analysis.
The values for each parameter within a group are expressed as means ± SE. For comparisons between two groups, statistical significance was assessed using an unpaired t-test. A paired t-test was used for comparisons within groups. For comparisons among three groups, ANOVA with Tukey multiple comparisons tests were used to test for statistical significance.
| RESULTS |
|---|
|
|
|---|
GT-AT1A transgene on survival.
GT-AT1A transgene (TG) on survival of wild-type mice and mice with targeted deletion of AT1 receptor genes. On wild-type and Agtr1a/ backgrounds, presence of the transgene had no significant effect on survival, growth, or vigor. We and others previously reported that Agtr1a/Agtr1b/ mice have poor survival and reduced growth (41, 56). To determine whether the transgene could rescue this phenotype, we analyzed 130 consecutive progeny resulting from matings that could generate Agtr1a/Agtr1b/ mice with and without the transgene. Of these progeny, 21 mice were TG(+) Agtr1a/Agtr1b/ and 32 mice were TG() Agtr1a/Agtr1b/. The proportions of surviving TG(+) and TG() Agtr1a/Agtr1b/ were not different than expected, P = 0.813.
Kidney-specific expression of the
GT-AT1A transgene.
To document expression of the transgene, we tested for the presence of transgene mRNA using an RT-PCR assay. An example of such an assay is shown in Fig. 2. In this case, we used PCR primers that would detect AT1A mRNA sequences and assayed total RNA isolated from various tissues of male Agtr1a/ mice bearing the
GT-AT1A transgene compared with the same tissues from Agtr1a+/+ and Agtr1a/ mice without the transgene. Shown in Fig. 2, AT1A receptor mRNA can be easily detected in the kidney of the Agtr1a+/+ animal, representing expression from the wild-type Agtr1a gene. By contrast, AT1A receptor mRNA could not be detected in kidneys from Agtr1a/ TG() animals. However, in kidneys from Agtr1a/ TG(+) animals, AT1A receptor mRNA could be detected, albeit with a reduced intensity compared with wild type. Although AT1A receptor mRNA expression was easily detected in kidneys of TG(+) Agtr1a/ animals, expression of the transgene could not be detected in other tissues such as heart, lung, and spleen (data not shown).
Proximal tubular expression of AT1A mRNA.
To precisely quantify expression of AT1A receptor mRNA in proximal tubules of transgenic animals, we generated enriched preparations of proximal tubules from kidneys of Agtr1a/Agtr1b/ mice with and without the
GT-AT1A transgene. AT1A mRNA expression in Agtr1a/Agtr1b/ double knockout mice was negligible (0.075 ± 0.075 pg/µg total mRNA). By contrast and consistent with the qualitative experiments, AT1A mRNA levels were easily detected in Agtr1a/Agtr1b/ mice with the
GT-AT1A transgene at levels that were significantly higher than Agtr1a/Agtr1b/ mice without the transgene (2.3 ± 1.3 pg/µg total mRNA; P < 0.02). However, the absolute levels of expression in Agtr1a/Agtr1b/ mice with the transgene were slightly less than 10% of wild-type levels.
The
GT-AT1A receptor transgene does not alter resting blood pressure.
To determine whether transgene-dependent expression of the AT1 receptor in the proximal tubule would affect blood pressure, we compared resting blood pressures of Agtr1a+/+ mice with and without the transgene. The transgene did not affect blood pressure in Agtr1a+/+ mice fed a conventional (0.4% NaCl) diet compared with wild-type, nontransgenic littermates (119 ± 4 vs. 122 ± 6 mmHg). During high-salt (6% NaCl) feeding, blood pressures are also similar (121 ± 4 vs. 123 ± 6 mmHg).
To examine its actions in isolation, the transgene was backcrossed onto AT1 receptor-deficient backgrounds as described above. Blood pressures were then measured as dietary sodium was altered. Similar to our previous findings (41) and as shown in Fig. 3A, Agtr1a/Agtr1b/ mice fed a conventional sodium diet (0.4% NaCl) have low systolic blood pressures (91 ± 8 mmHg). Under the same conditions, Agtr1a/Agtr1b/ with the
GT-AT1A transgene have similarly reduced blood pressures [84 ± 2 mmHg, P = 0.43 vs. TG()]. With high-salt feeding, blood pressures increased significantly and to a similar extent in transgene-negative (132 ± 7 mmHg; P = 0.004 vs. baseline) and transgene-positive Agtr1a/Agtr1b/ mice [122 ± 6 mmHg; P = 0.007 vs. baseline, and P = 0.29 vs. TG()]. Similarly, on the low-salt diet, systolic blood pressures fell to levels that were below baseline in both transgene-negative (70 ± 3 mmHg; P = 0.04 vs. baseline) and transgene-positive Agtr1a/Agtr1b/ mice (67 ± 4 mmHg, P = 0.02 vs. baseline), but the levels of blood pressure during low-salt feeding were similar between the two groups (P = 0.65). These data indicate that partial restoration of AT1 receptors in proximal tubule does not reverse the phenotype of hypotension and sodium-dependent blood pressure changes that are characteristic of generalized deficiency of AT1 receptors.
|
GT-AT1A transgene have blood pressures of 83.5 ± 4.0 (normal salt) [P = 0.14 vs. TG()], 90.6 ± 4.0 (high salt) [P = 0.20 vs. TG(), P = 0.03 vs. normal salt], and 59.4 ± 2.6 (low salt) [P = 0.06 vs. TG(), P < 0.0005 vs. normal salt], respectively (Fig. 3B).
Renin mRNA expression.
To determine whether the transgene might affect genomic responses that are relevant to blood pressure control, we compared renin mRNA levels in wild-type, TG() Agtr1a/Agtr1b/, and TG(+) Agtr1a/Agtr1b/ mice. As demonstrated previously (42) and as shown in Fig. 4, renin mRNA expression was markedly elevated by
10-fold in TG() Agtr1a/Agtr1b/ mice (274 ± 21 pg/µg total RNA) compared with wild-type controls (25 ± 2 pg/µg total RNA) and TG(+) Agtr1a/Agtr1b/ mice (75 ± 16 pg/µg total RNA; P = 0.002; ANOVA, 95% simultaneous confidence intervals). Presence of the transgene reduced renin expression in Agtr1a/Agtr1b/ mice by 70%, and the levels were not statistically different from that in wild-type controls (Tukey pairwise comparison intervals of 120.8 to 20.2). Across the three groups, there was a significant inverse correlation between renin mRNA and AT1A receptor expression (R2 = 0.50, P = 0.01). These data suggest an unexpected role for AT1 receptors in the proximal tubule to regulate renin expression.
|
GT-AT1A transgene on urinary concentrating capacity, we measured urine osmolalities in TG() Agtr1a/ and TG(+) Agtr1a/ mice after 24 h of thirsting. Presence of the transgene did not correct the defect in urinary concentration of Agtr1a/ mice. After 24 h of water deprivation, urine osmolality was reduced in TG(+) Agtr1a/ compared with wild-type controls (2,085 ± 271 vs. 3,637 ± 148, P < 0.002) and was not significantly different from TG() Agtr1a/ animals (2,876 ± 287, P = 0.156).
The
GT-AT1A transgene maintains renal cortical structure in Agtr1a/Agtr1b/ mice.
As discussed above, the complete absence of AT1 receptors in Agtr1a/Agtr1b/ mice is associated with the development of a characteristic pattern of structural pathology in the kidney including arteriolopathy, glomerular degeneration and cyst formation, and atrophy of the inner medulla (41, 56). To determine whether the absence of AT1 receptors in the proximal tubule contributes to these abnormalities, we systematically examined kidney histomorphology in groups of Agtr1a/Agtr1b/ mice with and without the transgene. Because the severity of the pathological changes becomes more advanced with age, we studied animals that were 46 mo old. Consistent with previous findings (41, 56), 100% of the TG() Agtr1a/Agtr1b/ mice developed a range of severe kidney pathology including renal vascular thickening, focal inflammatory infiltrates, atrophy of the inner medulla, and prominent glomerular and cortical cysts (Fig. 5A). In general, the severities of vascular thickening, papillary atrophy, and inflammatory cell infiltrates were not affected by the transgene. However, as depicted in Fig. 5B, in the TG(+) Agtr1a/Agtr1b/ mice, the general architecture of the renal cortex was preserved, and there was a dramatic reduction in the number and size of the cysts. To quantify the differences in cyst formation between the Agtr1a/Agtr1b/ mice with and without the
GT-AT1A transgene, we used an image analysis microscope and software to measure the extent of cortical area that is occupied by cysts from a digitized kidney image. As shown in Fig. 6, the cyst area expressed as a proportion of the total cortical area was reduced nearly threefold in TG(+) (2.5 ± 0.3%) compared with TG() Agtr1a/Agtr1b/ animals (6.0 ± 1.4%; P = 0.037).
|
|
| DISCUSSION |
|---|
|
|
|---|
The purpose of the current study was to assess the physiological functions of AT1 receptors in the proximal tubule of the kidney in vivo, using a genetic approach. To this end, we constructed a heterologous transgene in which the AT1A receptor would be expressed under control of the P1 portion of the
GT promoter that has been previously demonstrated to confer cell-specific expression in proximal tubular epithelium in several different lines of transgenic mice (51). The conventional method for generating transgenic mice is pronuclear injection of single-cell embryos with transgene DNA (17). Typically, with pronuclear injection, multiple copies of the transgene DNA are randomly incorporated into the genome, and the integration site and copy number significantly influence levels and patterns of expression. To avoid complications associated with random insertion of multiple copies of the transgene, we produced
GT-AT1A receptor transgenic mice using a gene targeting strategy that results in single-copy transgene insertion at a defined site in the mouse genome (6). In particular, we wished to avoid substantial overexpression of AT1A receptors in the target tissue, which in other systems has had dramatic and detrimental effects on cell growth and function (25, 45). On the Agtr1a+/+ background, the
GT-AT1A transgene had no harmful effects on survival or renal histomorphology. To determine whether isolated expression of AT1 receptors in the proximal tubule could rescue any of features of the AT1 receptor deficiency phenotype, the transgene was backcrossed onto Agtr1a/ and Agtr1a/Agtr1b/ backgrounds. Although the transgene did not alter the abnormal survival and blood pressure phenotype associated with AT1 receptor deficiency, it offered substantial protection against cortical cyst formation.
A role for the RAS in development and maintenance of kidney structure has been long recognized. There is a highly regulated program of AT1 receptor expression in the embryonic kidney (28), and administration of ACE inhibitors or AT1 receptor blockers during pregnancy causes kidney defects in various species including humans and rats (3, 11, 16). Similarly, in mice, null mutations that markedly abrogate AT1 receptor signaling, either through impaired generation of angiotensin II or the complete absence of AT1 receptors, cause characteristic kidney pathology (14, 29, 40, 41, 56). These changes include thickening of renal arteries and arterioles, atrophy of the renal papilla, and cortical cyst formation. Glomerular dysgenesis and cysts are also prominent in human infants following fetal exposure to ACE inhibitors (3, 11, 34). The studies of Ichikawa and associates (38) suggest that impaired ureteral peristalsis due to the absence of AT1 receptors on ureteral smooth muscle contributes to the degeneration of the renal papilla. However, the cellular pathogenesis of the other renal anatomical defects associated with interruption of the RAS is not clear.
In our studies, we find that reconstitution of AT1 receptors in the proximal tubule on the Agtr1a/Agtr1b/ background has no effect on several of the features of the abnormal kidney phenotype, including atrophy of the inner medulla and vascular thickening. However, the relatively low levels of AT1A receptor expression in the proximal tubule provided by the transgene were sufficient to attenuate cortical cyst formation, reducing by threefold the extent of the cysts and normalizing the overall appearance of the renal cortex. All of the nontransgenic Agtr1a/Agtr1b/ mice developed prominent cortical cysts. As shown in Fig. 5, A and B, most of these cysts contain glomerular structures and therefore are contiguous to and likely include portions of the proximal tubule. Thus the anatomical location of the cysts and their amelioration by the transgene are consistent with an important role for AT1 receptors in the proximal tubule in their development. Although we cannot determine the specific actions of AT1 receptors in the proximal tubule that prevent the development of these lesions, we speculate that regulatory effects on fluid and solute flux may contribute.
In AT1-deficient mice, renin expression is markedly upregulated. There are likely to be several factors that contribute to stimulate renin release in these mice. The first is disruption of the short-loop feedback in inhibition of renin by AT1 receptors. Second is the marked hypotension seen in these animals. Third is expanding cysts could cause stretching of the renal arterioles and renal ischemia, resulting in activation of the renin-angiotensin-aldosterone system (7, 22). Finally, altered sodium delivery to the macula densa due to abnormal sodium delivery may contribute to dysregulated renin expression (5). As the lack of AT1 receptor signaling in juxtaglomerular cells should not be affected by the transgene and blood pressures were not altered in transgenic animals, it seems most likely that an effect on the macula densa signal, perhaps due to altered delivery of sodium to distal nephron segments, may play a role in reduction of renin expression in TG(+) Agtr1a/Agtr1b/ mice. Alternatively, amelioration of the cysts by the transgene could relieve the mechanical stretch on renal arterioles, thereby downregulating renin expression.
The actions of AT1 receptors to regulate renal sodium handling were highlighted in our previous studies of AT1A receptor-deficient mice (42). These animals have reduced blood pressures that fluctuate markedly when dietary sodium intake is varied. When AT1-deficient mice were fed a diet with a very low sodium content, blood pressures fell below their already reduced levels, and this was associated with inappropriate urinary sodium losses, resulting in cumulative negative sodium balance. Thus the absence of AT1 receptors is associated with a marked impairment of the ability of the kidney to conserve sodium when dietary sodium intake is limited. Renal salt wasting in this circumstance despite a normal aldosterone response suggested a critical role for intrarenal actions of AT1 receptors to regulate sodium excretion and blood pressure (42). As AT1 receptors are present all along the nephron, where they function to modulate fluid and solute reabsorption, this phenotype may directly reflect the absence of epithelial actions of AT1 receptors.
Previous studies in intact animals (9) and in isolated perfused tubules (54) have documented the potent actions of angiotensin II to stimulate sodium reabsorption in the proximal tubule. These actions are mediated by AT1 receptors (10). Because more than 90% of filtered fluid and solute are reabsorbed in this segment (44), modulation of sodium flux by AT1 receptors in the proximal tubule could theoretically have a significant impact on sodium and volume homeostasis. Nonetheless, despite the significant reduction in renin expression to near normal levels and the dramatic protection of cortical structure afforded by the presence of the transgene, our studies show that expression of AT1A receptor at levels achieved with the
GT-AT1A transgene was not sufficient to reverse low blood pressure and sodium sensitivity in AT1 receptor-deficient mice, suggesting that AT1 receptors in the proximal tubule do not play a significant role in volume homeostasis. However, we cannot rule out the possibility that the failure of the transgene to affect blood pressure responses might be due to insufficient levels of expression. Alternatively, the failure of the transgene to affect blood pressure regulation may reflect more important contributions of AT1 receptor actions in distal nephron segments, where incremental changes in sodium reabsorption may have a greater impact on overall sodium excretion (36, 52, 58).
In summary, we have used a genetic strategy to examine the functions of AT1 receptors in the proximal tubule of the kidney in vivo. Using gene targeting to generate animals with a single copy of the
GT-AT1A transgene at the Hprt locus, kidney-specific expression of AT1 receptors was achieved. Our studies do not identify a major role for AT1 receptors in the proximal tubule a major role in regulation of blood pressure. However, they have unique actions to maintain normal structure of the renal cortex and to prevent the development of glomerular degeneration and cortical cysts. With the identification of a number of other promoters that confer cell-specific expression in the kidney, this approach should be useful for defining the physiological functions of AT1 receptors in other segments of the nephron.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Address for reprint requests and other correspondence: T. M. Coffman, Chief, Division of Nephrology, Dept. of Medicine, Duke Univ. and Durham VA Medical Centers, 508 Fulton St., Bldg. 6, Rm. 1100, Durham, NC 27705 (E-mail: tcoffman{at}duke.edu).
10.1152/physiolgenomics.00120.2003.
| References |
|---|
|
|
|---|
-glutamyltransferase gene in mouse. Proc Natl Acad Sci USA 90: 61796183, 1993.This article has been cited by other articles:
![]() |
S. Park and L. M. Harrison-Bernard Augmented Renal Vascular nNOS and Renin Protein Expression in Angiotensin Type 1 Receptor Null Mice J. Histochem. Cytochem., April 1, 2008; 56(4): 401 - 414. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||