Physiol. Genomics Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 17: 230-244, 2004. First published February 3, 2004; doi:10.1152/physiolgenomics.00203.2003 Free Article
1094-8341/04 $5.00
This Article
Free upon publication Free Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
17/2/230    most recent
00203.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (49)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bauer, M.
Right arrow Articles by Katzenberger, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bauer, M.
Right arrow Articles by Katzenberger, J. D.
Received 8 December 2003; accepted in final form 29 January 2004.
Physiological Genomics 17:230-244 (2004)
1094-8341/04 $5.00 © 2004 American Physiological Society

Starvation response in mouse liver shows strong correlation with life-span-prolonging processes

Matthias Bauer 1,*, Anne C. Hamm 1,*, Melanie Bonaus 1, Andrea Jacob 2, Jens Jaekel 3, Hubert Schorle 2, Michael J. Pankratz 1 and Joerg D. Katzenberger 1

1 Institut fuer Genetik, Forschungszentrum Karlsruhe, 76021 Karlsruhe
2 Institut fuer Pathologie, Universitaet Bonn, 53127 Bonn, Germany
3 Institut fuer Angewandte Informatik, Forschungszentrum Karlsruhe, 76021 Karlsruhe, Germany


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We have monitored global changes in gene expression in mouse liver in response to fasting and sugar-fed conditions using high-density microarrays. From ~20,000 different genes, the significantly regulated ones were grouped into specific signaling and metabolic pathways. Striking changes in lipid signaling cascade, insulin and dehydroepiandrosterone (DHEA) hormonal pathways, urea cycle and S-adenosylmethionine-based methyl transfer systems, and cell apoptosis regulators were observed. Since these pathways have been implicated to play a role in the aging process, and since we observe significant overlap of genes regulated upon starvation with those regulated upon caloric restriction, our analysis suggests that starvation may elicit a stress response that is also elicited during caloric restriction. Therefore, many of the signaling and metabolic components regulated during fasting may be the same as those which mediate caloric restriction-dependent life-span extension.

microarray analysis; nutrient response; caloric restriction; metabolic signaling; aging/longevity


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
THE HEALTH CONSEQUENCES of abnormal metabolic regulation are enormous. These include inborn errors of metabolism that affect specific enzymes of a biochemical reaction and defects in hormone systems, such as diabetes, that coordinate nutrient utilization (59). In addition, changes in modern diet and lifestyle have drastically increased unwanted consequences in body metabolism even in nondiseased condition, as seen in the dramatic increase in obesity and cardiovascular disorders (25, 84). Although some of the metabolic defects can be controlled by appropriate dietary modification, e.g., avoiding food containing high levels of phenylalanine can prevent fatal consequence of phenylketonurea, molecular mechanisms underlying the physiological response to different nutrient conditions are largely unknown. The controversies surrounding the relative efficacy of different diets and diet supplements to battle a wide spectrum of health conditions attest to this lack of knowledge (69). On the other end of the health spectrum, evidence is accumulating that restricting caloric intake can slow down the effects of aging and increase life span in all model organisms tested to date (41, 63). This has been attributed to several factors, including oxidative stress, genome integrity, and endocrine signaling. To understand how diet affects progression of diseases and aging, one of the goals would be to identify the metabolic pathways affected by altered nutrient conditions and the underlying genetic and signaling control mechanisms that regulate them.

The major reactions of the biochemical pathways leading to the metabolism of essential nutrients have been worked out (46). These have come mostly through studying the substrates and products of the reactions and the enzymes catalyzing them. Regulations of the reactions have furthermore focused on the activity and specificity of the enzymes in terms of allosteric control and posttranslational modifications. Thus one way to study changes in flux through a particular metabolic pathway in response to altered diet would be to measure substrate and product concentrations of a particular reaction. This, however, is not yet feasible for multicellular organisms on a large scale. A complementary approach is through analysis of genes that encode these enzymes using recently developed genomic technologies. Although altering enzyme levels may not necessarily result in altering flux through that pathway, significant alterations in the expression of the enzyme-encoding genes may reflect responsive flux changes. In addition, this approach may identify molecules that regulate specific metabolic pathways, such as transcription factors or components of signal transduction cascades. We have already utilized such a strategy to study nutrient-regulated gene regulation in Drosophila (85). Based on these considerations, we have analyzed nutrient-dependent gene expression changes using microarrays in mouse liver.

In mammals the liver plays a key role in coordinating body metabolism in response to dietary conditions. Much of the regulatory effects occur initially in the liver, which then modulates the activities of other organs regarding nutrient utilization and metabolism. We have carried out a comprehensive microarray gene profiling analysis in mouse liver under fasting and under sugar conditions. Numerous studies have utilized microarrays to study nutrient regulation of gene expression, but these differ with respect to the number of genes, type of microarrays, organs tested, and the specific nutrient conditions. Our study provides the most comprehensive gene profiling to date on the patterns of gene expression under fasting and sugar conditions in the same experimental setup, representing some 20,000 different mouse genes. Our results pinpoint several metabolic and signaling pathways that may be part of a global regulatory response to food restriction. These pathways may be important for providing insights into understanding nutrient-dependent disorders. Furthermore, our analysis reveals a connection between starvation response and those which may slow aging. Our results suggest that many of the physiological pathways operating upon starvation underlie those operating during life-span extension brought on by caloric restriction.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Microarray Production
A total of 20,160 PCR products were amplified from a collection of cDNAs (Array Tag, set A and B) that was made by LION Bioscience, Heidelberg, Germany. These cDNAs (150 to 700 bp) were derived from 3' end of expressed sequence tags (ESTs) and cloned and sequenced by the company. We amplified the inserts using primers designed from the vector sequence flanking the insert (primer sequence provided by LION Bioscience). The PCR products were cleaned using Millipore 96-well filtration plates (HPPV, 0.45 µm, clear), then transferred into 384-well plates, dried, and resuspended in 1.5 M betaine/1x phosphate printing buffer (150 mM sodium phosphate, pH 8.5). The amplified cDNA products (200–500 ng/µl) were spotted in duplicates in two separate subarrays using a GeneMachines OmniGrid 100 (San Carlos, CA) and TeleChem SMP3 pins (Sunnyvale, CA) on Corning CMT-GAPS II slides (Corning, NY).

Nutrient Conditions
Mice used in this study were 129/SV males, 8–15 wk of age, which were housed individually and received water ad libitum. Twelve animals were taken for the 24 h experiment, in two batches of six animals each (3 fasted, 3 normal fed controls). Total RNA and poly-A RNA were prepared for each sample probe separately, and equal amounts of poly-A RNA from each batch and each condition were pooled, i.e., three animals per pool. A fifth pool was made in which all starved animals were included, as well as a sixth pool that contained all normal controls. Pool 1/2 (normal fed) was hybridized the same manner against pool 3/4 (24 h starved), and pool 5 (starved) was hybridized against pool 6 (normal fed). For experiments on 48 h nutrient condition, 10 normal fed and 10 starved animals were used (distributed in groups of three, three, and four per condition). Pooling was done as described above for each group, and eight arrays were hybridized per group (with dye swap). In the third set up, 10 animals received a sugar solution (40% sucrose and 10% glucose) and water ad libitum, and these were compared with 10 normal fed animals. Pooling and hybridizations were done as described for 48-h starved experiment.

RNA Preparation, Labeling and Hybridization
Mice were killed by CO2 asphyxiation. The livers were snap frozen in liquid nitrogen and stored at –80°C. Total RNA was prepared using the NucleoSpin RNA L kit (Macherey-Nagel, Dueren, Germany), with an additional step in which the final eluate was used for a subsequent elution step. Poly-A RNA was extracted with the Ambion Purist kit (Austin, TX) according to the manufacturer’s protocols. Equal amounts of poly-A RNA were pooled to generate normal or starved or sugar pools of all animals. These were hybridized against each other on 24 arrays for the 24-h and 48-h starvation experiments each and on 12 arrays for the 48-h sugar experiment. Half of the arrays were hybridized as dye swaps. Labeled cDNA was synthesized from 1.5 µg poly-A RNA using the Amersham direct cDNA labeling kit (Amersham Europe, Freiburg, Germany). Removal of the unincorporated dyes and concentration of the target were done with Microcon 30 spin columns (Millipore, Bedford, MA) according to the manufacturer’s instructions. The concentrated probes were hybridized to the microarray in 1x DIG Easy Hyb buffer (Hoffman-La Roche, Basel, CH) overnight at 42°C.

Microarray Scanning
Arrays were scanned using the Axon model 4000B dual-laser scanner and the corresponding GenePix 4 software (Axon, Union City, CA). Both channels (532 nm for Cy3 and 635 nm Cy5) were scanned in parallel and stored as 16-bit TIFF files. The absolute intensity values span the range from 0 to 65,535. The scans were performed with a resolution of 10 µm. From each spot with a mean diameter of 100 µm, 100 data pixels were recorded. Individual local background area around the spots were defined, which included ~400 pixels and excludes neighboring spots. For each channel, the raw data was calculated as the median intensity of all foreground pixels with respect to all background pixels.

Each array was scanned three times (low, medium, and high scan) with different signal amplification factors (voltage settings of the photomultiplier tubes), but with the same laser power. The channels for Cy3 and Cy5 were balanced in each scan for approximately the same intensity profile. In the low scan no spot was saturated; in the high scan the signal amplification for Cy5 was set to ~80% of maximum and the Cy3 amplification was adjusted to this. The settings used in the medium scan lie between the low and the high scan. This method for scanning has several advantages. In the low scan where no spot is in saturation, it is possible to calculate the real ratio for genes with high expression levels; however, those with a low expression level are most likely not recognized. In order not to lose these, a high scan is made; in this case, the information on the saturated spots is lost, so the two scans complement each other. The medium scan produces additional values for subsequent calculations. By scanning the arrays three times, errors which occur while recording and which might increase the error factor in the normalization are averaged.

Data Processing and Normalization
The data processing was automated in a Visual Basic/Excel (Microsoft) program, which integrates the following steps. Raw data are derived from the result files generated by GenePix scanning and picture analysis software. The spot diameter is to lie in the range from 80 to 120 µm, otherwise these spots are not included in analysis. From the pixel-to-pixel ratios between the foreground values of both colors, the standard deviation (SD) is calculated. Those spots that show a ratio SD of higher than 3 are excluded from analysis due to inconsistency. The foreground signal of each spot is corrected by subtracting the corresponding local background. Resulting values that are lower than the background are replaced by the background value. This defines the minimum measurement threshold as the background and avoids calculations of completely wrong ratios, e.g., if the background corrected value for one channel is close to zero. Spots are marked as saturated in one channel if more than 10% of the foreground pixels are at the highest absolute value. From the unsaturated data points of all three scans, linear regression between the low and medium scans and between low and high scans are calculated for both colors. Taking these regressions, the values of saturated spots are replaced by estimated values that reflect the real intensity.

The generated data set of each scan is normalized afterward based on the intensity-dependent methods as described by Yang et al. (80). The ratios are calculated as log2 transformed values: M = log2(Cy5/Cy3). Number describing the spot intensity, A = log2 , is calculated according to Yang et al. (80). A within-pin-tip group Loess fit to the MA plot was made. The Loess scatter plot smoother performs robust local fits using a tricube function to weight the values relative to the median point in the intensity interval. An interval size of 20% was chosen, which corresponds to 180 data points in a pin-tip group containing 30 by 30 spots. After combining the normalized data from all blocks, the data sets of all scans are additionally normalized using a global approach. The normalization was performed so that the sum of all log transformed ratios (M) is 0.

All statistical normalizations are based on the assumption that 1) the majority of genes are not changed in their expression and 2) that the overall up- and downregulations statistically compensate each other in sum. Taking this into account, the standard deviation in the ratios of the stable genes (80% of the most unchanged genes) could be seen as the measurement noise of the array experiments. To be able to compare the different scans and different normalized microarrays, the SD of the stable genes ratios was adjusted to a medium estimated value of 0.2, which is dependent on the used array system. This value does not influence the subsequent statistical analysis because the normal distribution of the data is not changed. For each microarray the normalized and adjusted log ratios of the three scans are averaged. On the used arrays, two identical subarrays are present; thus the data were divided block-wise into two sets. Each set is taken afterward as a distinct element in the statistical test. The data are stored in a relational database using the FileMaker Pro software (FileMaker, Santa Clara, CA).

Statistical Analysis
RNA was hybridized to minimum 12 (for 48 h sugar) replicate microarrays, giving rise to 24 data points for each gene. The criteria for a gene to be considered for statistical analysis in a t-test was that at least 16 of 24 are present (i.e., the data was derived from at least 8 different arrays). In subsequent examinations, only those genes whose ratios placed it in the 99.5% confidence interval were included. RT-PCR analysis was performed for nine genes, and all were consistent with the microarray data. The primer sequences used are listed below; ß-actin was used as control. Cog2 was used as additional control, as this showed no regulation from the microarray analysis. These represented both upregulated (Cyp4a14, Ela2, Fkbp5, Gadd45b, Got1, Igfbp1, and Lepr) and downregulated (Car3 and Temt) genes upon starvation, and all but one of the signaling or metabolic pathways are represented by at least one gene. The gene symbols and sequence forward (F) and reverse (R) primers are as follows: ß-actin, F-AAGGCCAACCGTGAAAAGATGA/R-TGTCAGCAATGCCTGGGTACAT; Car3, F- TCTGGCCAGTTAGAAAGCCTGTG/R-GTCCGCATACTCCTCCATACCC; Cog2: TTCAGAGTGGACATGGGGACAA/R-CACCAGCCACACTTGTCGATTT; Cyp4a14, F-GCCTGTTCACCCCTCATAACCA/R-CGCCAACCTGCATTTCTACACA; Ela2, F-GTCTCCCTGCAGGTCCTTTCCT/R-GTTGGAGACCCTGGTGAAGACG; Fkbp5, F-GTGTCCATGCATCAAGCCAAAG/R-ATACCAGTCTCCTTGGCCCACA; Gadd45b, F-GAAGGCCTCCGACACTTCTGGT/R-GAGTGGGTCTCAGCGTTCCTCT; Got1, F-CTGACCGTGGTCGGAAAAGAGT/R-TCCAACAGGCTCTAACCCCAGA; Igfbp1, F-ACATCCCTGGATGGAGAAGCTG/R-AGCTTTCCACGTTCAGCTTTGG; Lepr, F-GCCAGTCTTTCCGGAGAATAACC/R-CTGCTGCTCAGGGGATAAGCAC; Temt, F-CTGACTACACCCCGCAGAACCT/R-GCTGTGGAGCAAGGCTTTACAA.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Experimental and Microarray Setup
We performed experiments to identify genes regulated under 24 and 48 h fasting, as well as 48 h only on sugar (Table 1). The sugar treatment was used as a first step to see whether the starvation effect was due to a simple lack of energy source or whether some other nutrient signals, for example, amino acids, could be responsible. For 24 h fast, a total of 12 mice were used (6 normal, 6 starved) and hybridized to 24 arrays. For 48 h fast, a total of 20 mice were used (10 for normal and 10 for starved) and hybridized to 24 arrays. For 48 h sugar fed, a total of 20 animals were used (10 normal and 10 sugar) and hybridized to 12 arrays. Each microarray contains ~20,000 PCR products representing different genes printed in duplicates (see MATERIALS AND METHODS). For each experimental condition, dye swaps were performed (Table 1). Scanning of each array was done three times at three different intensities. Normalization was carried out using Loess (80). For every experiment, each sample class was hybridized to a minimum of 12 replicate microarrays; since there are two subarrays, there are a minimum of 24 data points for each experimental setup. Only those genes with 99.5% confidence level by t-test were used (see MATERIALS AND METHODS for details). These data provide a large-scale, statistically reliable view of the changes in gene expression in the mouse liver during fasting and sugar-fed conditions.


View this table:
[in this window]
[in a new window]
 
Table 1. Experimental overview

 
The data on which this paper is based have also been deposited with the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo/). The sample series GSE853 contains data of the 24 h starvation, GSE852 contains data of the 48 h starvation, and GSE851 contains data of the 48 h sugar experiment.

Overview
As a first step, we compared the number of genes regulated in the three conditions (24 h starvation, 48 h starvation, and 48 h sugar). As expected, the number of genes increased in going from 24 to 48 h of starvation. Furthermore, the number of genes regulated under sugar at 48 h is much lower than starved (Fig. 1). This is not surprising, since sugar feeding is a much less radical alteration in diet than total fasting. Furthermore, most of the regulated genes in starvation no longer become regulated to as high a degree when sugar is present. To discern which of the gene expression changes might have biologically meaningful consequences, we reasoned that significant alterations in flux through a given metabolic pathway may come about through large changes in single key components and/or a series of smaller changes in different components comprising the pathway. To structure the data, we did not use the common approach of clustering based on expression changes. Instead, we grouped the genes in specific metabolic or signaling pathways to obtain a more functional sense of the data.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1. Number and overlap of more than twofold regulated genes between the three nutrient conditions.

 
Fat Metabolism
During fasting, the body breaks down fats to generate energy. As expected, many genes encoding enzymes used in ß-oxidation of fatty acids are highly upregulated upon starvation (Table 2). One of the highest upregulated genes in our list encodes a peroxisomal acyl-CoA thioester hydrolase (Pte-2a). This result is consistent with previous results from Northern analysis showing increased expression of Pte-2a upon fasting (28). The gene encoding carnitine acetyltransferase (Crat), which is required for transport of fatty acids into the mitochondria for ß-oxidation (30, 34), is also upregulated. There is also upregulation of long-chain acyl-CoA dehydrogenase gene (Acadl) and peroxisomal enoyl-CoA hydratase gene (Ech1) (18, 38), which are involved in ß-oxidation.


View this table:
[in this window]
[in a new window]
 
Table 2. Selected enzymes and regulatory proteins of fatty acid and lipid metabolism

 
Concomitant with upregulation of genes involved in fat breakdown, genes encoding enzymes involved in fat synthesis are downregulated. These include stearoyl-CoA desaturase (Scd1), a key lipogenic enzyme for synthesis of monosaturated oleic acid (52). Knockout of Scd1 gene protected mice against adiposity, demonstrating its importance in fat synthesis (51). A special regulatory effect is observed for the Scd1 gene, namely, that it is decreased upon starvation and increased in sugar. There are very few genes that show opposite regulation to this extent in the two nutrient conditions, strengthening the view that Scd1 expression is especially sensitive to sugar and fat metabolism. Other downregulated genes include fatty synthase (Fasn), peroxisomal nudix hydrolase (Nudt7), and butyryl-CoA synthetase 1 (Bucs1) (16, 22).

Recently, the gene for Hyplip1 locus, which causes familial combined hyperlipidemia, was identified as thioredoxin interacting protein (Txnip) (4, 76), and this gene is upregulated upon starvation. Interestingly, the Txnip gene is also dramatically upregulated in glucose-treated pancreas (60). We also see upregulation of leptin receptor and Fsp27, suggesting their function in fat breakdown in the liver (12, 48). Genes involved in lipid transport are also affected (57). Apolipoprotein A-IV (Apoa4) is upregulated, whereas apolipoprotein 2 gene is downregulated, suggesting that the former has a role in fat breakdown, while the latter has a role in fat synthesis. There is also downregulation of the different serum amyloid A genes (Saa), whose products bind and transport HDLs, as well as numerous esterases (Es).

Pxr and Car Nuclear Receptors
The breakdown products of dietary lipids, as well as drugs and other xenobiotics, must be detoxified and eliminated. One signaling cascade that performs these functions comprises nuclear receptors that are activated by lipid ligands and regulate target genes that function in lipid metabolism (9). By a similar token, catabolism of endogenous fats upon starvation appears to operate through the same signaling cascade. For example, the high upregulation of Pte-2a mentioned above is dependent on Ppar{alpha}, a major fatty acid sensor (28). Although the Ppars are not transcriptionally regulated themselves, the Pxr and Car genes, which act as xenobiotic sensors, show increased expression upon starvation (Table 3). These are among the highest regulated transcription factors. Targets of lipid-activated nuclear receptor include Cyp enzymes, cytosolic binding proteins, and ABC transporters (9), and we also observe strong regulation of these genes (Tables 3 and 4).


View this table:
[in this window]
[in a new window]
 
Table 3. Nuclear receptors, fatty acid binding proteins, and ABC transporters

 

View this table:
[in this window]
[in a new window]
 
Table 4. Cytochrome P-450s and aminolevulinic acid synthases

 
Cytochrome P-450s, Cytosolic Binding Proteins, and ABC transporters
A critical family of proteins that regulate lipid metabolism and detoxification is cytochrome P-450s. The expression profiles of the different members of this family represent one of the most striking in our analysis (Table 4). The highest upregulated gene among the 20,000 genes represented, in both 24 and 48 h starvation, is cytochrome P-450 4A14 (Cyp4a14). Disruption of this gene in mice has been shown to cause hypertension (26). Another highly upregulated gene is Cyp17a1, which is involved in dehydroepiandrosterone (DHEA) synthesis from cholesterol (see also Table 7). Among the downregulated genes, cytochrome P-450 2C70 (Cyp2c70) is the second-most downregulated gene in our microarray; little is known about the function of this gene, but its strong downregulation upon starvation suggests a role in lipid synthesis. There are two other cytochrome P-450s that are highly downregulated. Cyp4f14 may play a role in the inactivation of eicosanoids (37), whereas Cyp7b1 is involved in bile acid synthesis (54).


View this table:
[in this window]
[in a new window]
 
Table 7. Regulated enzymes of cholesterol and DHEA metabolism

 
We have also noted a potentially interesting regulation of cytochrome P-450s by aminolevulinic acid. Aminolevulinic acid synthetase (Alas) is the first enzyme in the synthesis of heme, a component of cytochrome P-450 (33). Of the aminolevulinic acid produced in the rat liver, as much as 65% is used for formation of cytochrome P-450s. Thus an increase in Alas would result in increased heme levels required for increased antioxidant and detoxification function of cytochrome P-450s. It is interesting that while the liver-expressed Alas1 is upregulated, Alas2, which in literature is known to be red blood cell specific, is downregulated (Table 4). This could mean that as red blood cells become degraded upon nutrient shortage, the freed amino acids and heme become refunneled for cytochrome P-450 production.

Among the genes encoding the family of 14–15 kb intracellular fatty acid binding proteins, the epidermal-specific lipid binding protein (E-Fabp/Fabp5) (24, 77) is the most strongly downregulated (Table 3). It is expressed in adipocytes and skin, but its role in the liver has not been characterized. There is also small but significant regulation of other fatty acid binding proteins and ABC transporters, including the downregulation of Abcb11, a target of farnesoid receptor Fxr (15). Some of the others may be targets of lipid-activated nuclear receptors Pxr and Car.

Urea Cycle and Amino Acid Metabolism
In addition to fat breakdown, prolonged fasting results in the breakdown of endogenous proteins and amino acids to generate energy and to reallocate available metabolic resources. In keeping with this, we observe gene expression changes that may reflect an increase in flux through amino acid metabolism and urea cycle (Table 5). For example, the lysosomal cysteine protease cathepsin L (Ctsl) gene expression is unchanged at 24 h starvation but becomes upregulated after 48 h starvation. It has already been reported that the activity and protein level of Ctsl is increased in starved rats (29) and that a knockout of this gene results in heart defects (66). This upregulation of Ctsl is completely suppressed by sugar, suggesting that with sufficient energy source, Ctsl targeted proteins need not to be catabolized. We also observe an upregulation of saccharopine dehydrogenase (Aass), which is involved in lysine catabolism: this upregulation is also suppressed in sugar condition. Consistent with this finding, treatment with glucagon has demonstrated increased flux through lysine catabolism pathway (58). There is also downregulation of the gene encoding glutamine synthetase (Glu1), a key enzyme in amino acid metabolism. In Escherichia coli, the enzyme glutamine synthetase is rapidly degraded upon nitrogen starvation (64).


View this table:
[in this window]
[in a new window]
 
Table 5. Regulated enzymes of urea cycle and selected enzymes of amino acid metabolism

 
More specifically, we observe a high upregulation of aspartate aminotransferase encoding gene Got1 (also known as glutamic-oxaloacetate deaminase), together with three other genes of the urea cycle, namely, arginase (Arg1), argininosuccinate lyase (Asl), and carbamoyl phosphate synthetase (Fig. 2, Table 5). This most likely reflects the need to utilize amino acids as energy source. Remarkably, the four genes upregulated in starvation are all downregulated in sugar condition. This suggests that in the presence of sugar, the body tries to spare protein degradation, resulting in decreased flux through the urea cycle. This pattern is reminiscent of Scd1 regulation during fat metabolism (see above) and further strengthens the view that flux through the urea cycle is particularly sensitive to nutrient conditions.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 2. The urea cycle and its connection to aspartate cycle. The plus (+) and minus (–) signs on gray arrows designate upregulation or downregulation, respectively, in the expression of genes encoding the enzymes shown. The numbers refer to the numbers in Table 5. Dashed arrows indicate summarized reactions. Metabolites are displayed in ellipses, enzymes in rectangles.

 
We also observe a large downregulation of carbonic anhydrase III gene (Car3). It is in fact the highest downregulated gene in our microarray. The carbonic anhydrases are involved in bicarbonate buffering function. This is necessary to maintain acid-base homeostasis since increased amino acid catabolism would create a pH imbalance. On the other hand, it has been reported that Car3 is found at a much higher level in male than in female mice, in which case the downregulation may reflect a need to suppress synthesis of certain sex hormones.

S-Adenosylmethionine Cycle and Methyl Transferases
Several key enzymes of the S-adenosylmethionine (SAM) cycle are upregulated upon starvation (Fig. 3, Table 6). SAM plays a critical role in methyl transfer reactions, including one carbon metabolism. The gene for methionine-adenosyl transferase (Mat1) is the highest upregulated; this enzyme catalyzes the only known biosynthetic pathway for SAM from methionine and is required for proper liver function (42, 43). The regulation of the gene encoding betaine-homocysteine methyltransferase (Bhmt) seems to be especially sensitive to different nutrient conditions, since there is a large opposite regulation between starvation (upregulated) and sugar condition (downregulated). This is very similar to the behavior of Scd1 during fat metabolism. This regulatory pattern of Bhmt may be important for setting homocysteine levels under various nutrient and health conditions (20). For example, high homocysteine levels have been associated with heart defects (19, 57). In this context, decreased Bhmt (as observed in sugar condition) would lead to higher homocysteine levels, whereas increased Bhmt (as observed during fasting) would lower homocysteine levels.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 3. The S-adenosylmethionine (SAM) cycle. The numbers refer to the numbers in Table 6. The other markings are as in Fig. 2. Numbers on black arrows designate enzymes that are not regulated.

 

View this table:
[in this window]
[in a new window]
 
Table 6. Regulated enzymes of the SAM cycle, subsequent reactions and methyl transferases

 
Several methyltransferases that utilize SAM are also regulated upon starvation (Table 6). Especially interesting is the gene encoding catechol-O-methyltransferease (Comt), which catabolizes several catecholamines in the liver, including epinephrine and norepinephrine. Comt has been implicated in Alzheimer disease and aging, as well as in responding to a pain stressor (86). In addition, Comt inhibitors have been used as treatment for Parkinson and other age-related diseases (78, 83) There is also a strong downregulation of Temt (thioether S-methyltransferase), an important enzyme involved in detoxification of selenium- and sulfur-containing compounds (47). An evolutionarily related gene for the enzyme nicotinamide N-methyltransferase (Nnmt), which methylates nicotinamide, is also regulated during starvation and sugar.

Cholesterol and DHEA Regulation
DHEA is a cholesterol-derived hormone, which together with its sulfated ester, DHEA-S, is present at the highest level of any circulating hormone in humans (1, 81). Our analysis reveals a striking regulatory pattern concerning DHEA metabolism (Fig. 4, Table 7). First, genes involved in synthesis of cholesterol from acetyl-CoA are downregulated (including the cytoplasmic form of HMG-CoA synthase, which produces HMG-CoA). Second, the key gene in DHEA biosynthesis from cholesterol, Cyp17a1 (steroid-17{alpha}-monooxygenase), is highly upregulated. Third, genes involved in converting DHEA to other compounds, such as bile acid and other steroids, are downregulated (Table 7). Fourth, there is a downregulation of Cyp7b1, which is involved in the breakdown of cholesterol to bile acid, and the corticosteroid binding globulin protein (CBG). In sum, the goal of these regulatory changes during fasting appears to be to maintain as high a level of DHEA as possible, both by increasing DHEA production from the available cholesterol pool and by decreasing DHEA conversion to other compounds.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 4. Cholesterol and dehydroepiandrosterone (DHEA) metabolism. The numbers refer to the numbers in Table 7. The other markings are as in Fig. 2.

 
As an aside, we note that in contrast to the cytoplasmic form, the mitochondrial form of HMG-CoA synthase is increased in starvation. The latter form is used in ketogenesis to make ketone bodies from acetyl-CoA derived from fatty acid catabolism. This makes physiological sense, since ketone bodies provide fuel for the brain during starvation. It has further been reported that the mitochondrial HMG-CoA synthase is directly regulated by forkhead transcription factor (FKHRL1) via the insulin signaling pathway (50).

IGFBP and IGF Regulation
One of the most striking regulations is observed for insulin-like growth factor binding protein 1 (Igfbp1) (Fig. 5, Table 8). It is unchanged at 24 h starvation but becomes highly upregulated after 48 h. This upregulation is almost completely suppressed by sugar feeding. Igfbps function by binding insulin-like growth factors (Igfs), thereby interfering with Igf activity on target organs (35). Igfbp1 is the major form that controls body growth. Thus it makes physiological sense that starvation effects upregulation of Igfbp1, thereby signaling stoppage of cellular growth upon nutrient limitation. There is also a downregulation of Igf1, the cognate binding factor of Igfbp1. The results of other Igf/Igfbp members are shown in Table 8. The Igfbp1 signaling pathway is used not only during nutrient deprivation but in other processes that require stoppage of growth, including liver regeneration (67). This is probably because global body growth must be halted during the biosynthetic process of regenerating an organ. We have also seen a marked decrease in growth hormone (GH) gene expression in the brain upon starvation (unpublished data). This further reflects a coordinated alteration in growth factor signaling program (Fig. 5).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 5. Insulin and insulin-like growth factor binding protein (IGFBP) actions. Genes are displayed in ellipses with white background. The numbers refer to the numbers in Table 8; arrows extending from the genes denote their transcription pattern. Proteins are shown as rectangular shapes and written in capitalized letters. Arrows indicate positive influence; blunt-ended lines indicate negative influence. The red arrows denote predicted increase (arrow upward) or decrease (arrow downward) of the given components. GH, growth hormone; IGF, insulin-like growth factor.

 

View this table:
[in this window]
[in a new window]
 
Table 8. Insulin-like growth factors and their regulatory proteins

 
DNA Repair and Apoptosis
In addition to changes in metabolic and hormonal systems in the face of nutrient shortage, animals must also stop growth, since attempted proliferation in the absence of necessary biosynthetic resources would be detrimental to survival. Various genes that may function to maintain genome integrity or coordinate cell proliferation and apoptosis are listed in Table 9. A highly upregulated gene is Gadd45b, which functions in growth arrest and is also inducible by DNA damage, genotoxic stress, and TGFß signals (73, 82). As with Igfbp1, Gadd45s are also upregulated during liver regeneration (67). The LIM-only transcriptional regulator Lmo4 is implicated in proliferation control and is also upregulated (highest upregulated transcription factor in our microarray), as is the radiation-induced cysteine-rich LIM protein gene Rad51L1 (61, 75). Other upregulated genes implicated in apoptosis include a Bcl-2 family member, Bnip3 (5, 6, 53, 74), and Creg (cellular repressor of E1A suppressed genes), which encodes a glycoprotein involved in growth inhibition and binds to insulin-like growth factor receptor Igf2r (Table 8) (14). There is also strong downregulation SMP-30/regucalcin (Rgn), which has been implicated in calcium homeostasis and growth control (21, 49).


View this table:
[in this window]
[in a new window]
 
Table 9. DNA repair and apoptosis genes

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Connection Between Physiological Pathways Underlying Starvation Response and Those Regulating Life Span
In a large-scale gene expression profile screen in mouse liver, we have identified several metabolic and signaling pathways whose components are altered transcriptionally in starved and sugar-fed conditions. Although the microarray approach we used cannot provide a direct link between changed RNA levels and influence on protein activity or metabolic flux, we observe a strong correlation between these pathways and those which have been shown to be important for longevity. We outline below the similarities between starvation response and life-span-prolonging processes.

Lipid catabolism and activation of the oxidative stress response.
The need for the body to break down lipids can come externally through dietary intake or internally through breakdown of endogenous lipids during fasting. We have observed a large number of genes regulated upon starvation which are part of this lipid signaling cascade (9). The relevance for this cascade for aging is clear: it regulates a battery of antioxidant factors, including nuclear receptors and cytochrome P-450s, for detoxification and protection from oxidative and xenobiotic stress. Since oxidative stress is one of the major sources thought to affect the aging process, factors that increase protection from oxidative stress should slow down aging. In C. elegans for example, the daf9 and daf12 genes, which affect life span, encode a cytochrome P-450 and a nuclear receptor with similarity to Pxr, respectively (3, 23). In Drosophila, it has recently been shown that the steroid hormone ecdysone, acting through its nuclear receptor, controls aging (62). Thus the lipid-activated nuclear receptor pathways would bring about increased resistance to oxidative stress, thereby increasing survival and longevity.

Regulation of central metabolic pathways: SAM and urea cycles.
SAM, the central factor in methylation reactions in the cell, has long been implicated in cellular aging through regulation of various methyltransferases that participate in protein repair (10, 11, 64). It is interesting that the overall regulatory alterations in SAM cycle upon starvation would have the effect of lowering homocysteine levels, since high homocysteine levels have been associated with increased chance for coronary diseases (19, 57). It has also been recently shown that in long-lived Ames dwarf mice the activities of Mat1 and Gnmt are elevated (72); since both of these genes are upregulated upon starvation, it is consistent with the notion that increased flux through the SAM cycle is associated with life-span extension and starvation response. Furthermore, the methyltransferase Comt, which is downregulated in starvation, has been implicated in Alzheimer disease and its inhibitor is used to treat Parkinson disease (78).

In contrast to the association of methyltransferase reactions with protein damage repair and aging, little has been documented on the potential role of urea cycle and aging. There is, however, one intriguing observation. It has recently been shown in Drosophila that feeding sodium 4-phenylbutyrate (PBA) can extend life span (32), and PBA is a FDA-approved drug for treatment of urea cycle disorder (7). Another potential connection comes from a recent study showing that a gene involved in autophagy can extend life span in C. elegans (45). Since autophagy entails degradation of internal proteins in the face of nutrient deprivation, it will likely increase flux through the urea cycle.

Regulation of hormonal pathways: DHEA and insulin/Igf signaling.
The level of DHEA and its sulfated derivative steadily decreases with age, a fact which underpins many discussions on its role as an anti-aging substance. The role of DHEA is controversial, but it has been implicated in a variety of processes associated with youth and virility (1, 44, 81). Our analysis indicates that upon starvation, the body tries to maintain as high a level of DHEA as possible: the gene for DHEA synthesis from cholesterol is highly upregulated, whereas those which are involved in making other steroid hormones are downregulated. This further suggests a connection between starvation response and an anti-aging process.

There is substantial evidence for insulin/IGF signaling playing a fundamental role in aging. This comes from mammalian studies, as well as worms and flies (17, 36, 41). In these cases, a decrease in insulin signaling is correlated with increased life span. Recent studies further suggest that insulin may increase the chance of Alzheimer disease (70). Consistent with our view that starvation response shares signaling pathways with those underlying anti-aging processes, there is a large decrease in insulin signaling upon starvation as illustrated by the large increase in Igfbp1 expression. The decreased insulin signaling could also affect cytochrome P-450 activity through Alas, since it has been reported that insulin inhibits Alas in a liver-derived cell line (56). Therefore, upon starvation decreased insulin level would de-repress expression of Alas, which is what is observed, leading to increased cytochrome P-450 synthesis, thereby connecting the cytochrome P-450 pathway with the insulin pathway.

Genome instability and apoptosis.
Genes involved in maintaining genome integrity, such as DNA repair, play an important role in aging (31). The NAD-dependent histone deacetylase Sir2 in yeast and the histone deacetylase Rpd3 in Drosophila have been shown to regulate aging (39, 55). Furthermore, yeast life span can be increased by changing the level of NAD through increased Nnmt (nicotinamide N-methyltransferase) activity (2), and we also see an increase in Nnmt upon starvation. It has also been suggested that certain compounds that extend life span in yeast through Sir2 operate by suppressing p53 and delaying apoptosis (27). In this respect, we note that Rad51L1, which is upregulated in starvation, is a vital, radiation-induced gene which may function through interaction with p53 (61). In addition, Starai et al. (65) have pointed out a link between Sir2 function and lipid metabolism through the activation of acetyl-CoA synthetase. Thus many of the metabolic response to starvation may be mediated by factors that influence aging through their function in genome stability and cell survival.

Regulatory Overlap Between Starvation Response and Caloric Restriction
The one documented regimen for prolonging life span in various organisms has been caloric restriction (41, 63). Since starvation can be viewed as the most extreme form of caloric restriction, it is not surprising that many of the connections made here between starvation and longevity have been previously observed for caloric restriction and longevity. It is therefore also not surprising that life-span extension is associated with increased survival under starvation stress in different organisms (40). Thus one can ask whether the regulatory mechanisms that operate during starvation also operate during caloric restriction at the gene expression level. We indeed find informative overlaps between genes regulated for liver in caloric-restricted mice and our current analysis. For example, carbamoyl phosphate synthetase of the urea cycle is upregulated upon starvation and caloric restriction, whereas glutamine synthetase is downregulated in both cases (13, 71, 79). Furthermore, in a microarray analysis of calorically restricted mouse liver (8), 33 genes were identified as having caloric-restriction-specific changes. Of the 28 genes that are represented in our microarray, 19 of these are regulated in the same direction, 5 in the opposite direction, and 4 are unchanged. Of the 24 regulated genes, 9 can be found in the list of genes representing the signaling or metabolic pathways highlighted in our starvation condition, and 8 of the 9 genes are regulated in the same direction as in caloric restriction (Got1, Fasn, Gamt, Cypa13, Cyp4a14, Ese1, Cbg, and Rgn; the one exception is Apoa4). Furthermore, the eight genes are distributed over the different pathways and are not restricted to any specific pathway. This comparison reveals a significant overlap of the expression profile between starvation and caloric-restricted conditions, although it should be emphasized that the comparison is based on a single study, and further independent data will be required. On the other hand, although caloric restriction can extend life span, prolonged starvation is life threatening. What could then be the common theme linking starvation response to caloric restriction? We favor the view that it is the degree of response to stress brought upon by the two conditions. Caloric restriction might invoke a low-level stress response, which in the long run will have a protective function and increase survival; starvation would invoke a similar response, but at a much higher level and which cannot be sustained for long periods. The genetic regulatory patterns that we have found in starvation could therefore lead to a better understanding of anti-aging mechanisms as well as global biological functions such as interactions between antioxidative reactions, xenobiotic protection and maintenance of genome integrity.


    GRANTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by the Forschungszentrum Karlsruhe and Bundesministerium fuer Bildung und Forschung.


    ACKNOWLEDGMENTS
 
We thank Simone Schindler, Andy Cato, Norma Howells, Kevin White, Martin Hofmann, Peter Herrlich, and all members of the Pankratz laboratory for their help.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: M. J. Pankratz, Institut fuer Genetik, Forschungszentrum Karlsruhe, Postfach 3640, 76021 Karlsruhe, Germany (E-mail: michael.pankratz{at}itg.fzk.de).

10.1152/physiolgenomics.00203.2003.

* M. Bauer and A. C. Hamm contributed equally to this work. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Allolio B and Arlt W. DHEA treatment: myth or reality? Trends Endocrinol Metab 13: 288–294, 2002.[CrossRef][Web of Science][Medline]
  2. Anderson RM, Bitterman KJ, Wood JG, Medvedik O, and Sinclair DA. Nicotinamide and PNC1 govern lifespan extension by caloric restriction in Saccharomyces cerevisiae. Nature 423: 181–185, 2003.[CrossRef][Medline]
  3. Antebi A, Yeh WH, Tait D, Hedgecock EM, and Riddle DL. daf-12 encodes a nuclear receptor that regulates dauer diapause and developmental age in C. elegans. Genes Dev 15: 1512–1527, 2000.
  4. Bodnar JS, Chatterjee A, Castellani LW, Ross DA, Ohmen J, Cavalcoli J, Wu C, Dains KM, Catanese J, Chu M, Sheth SS, Charugundla D, Demant P, West DB, de Jong P, and Lusis AJ. Positional cloning of the combined hyperlipidemia gene Hyplip1. Nat Genet 30: 110–116, 2002.[CrossRef][Web of Science][Medline]
  5. Boyd JM, Malstrom S, Subramanian T, Venkatesh LK, Schaeper U, Elangovan B, D’Sa-Eipper C, and Chinnadurai G. Adenovirus E1B 19 kDa and Bcl-2 proteins interact with a common set of cellular proteins. Cell 79: 341–351, 1994.[CrossRef][Web of Science][Medline]
  6. Bruick RK. Expression of the gene encoding the proapoptotic Nip3 protein is induced by hypoxia. Proc Natl Acad Sci USA 97: 9082–9087, 2000.[Abstract/Free Full Text]
  7. Brusilow SW, Danney M, Waber LJ, Batshaw M, Buton B, Levitsky L, Roth K, McKeethren C, and Ward J. Treatment of episodic hyperammonemia in children with inborn errors of urea synthesis. N Engl J Med 310: 1630–1634, 1984.[Abstract]
  8. Cao S, Dhahbi JM, Mote PL, and Spindler SR. Genomic profiling of short- and long-term caloric restriction effects in the liver of aging mice. Proc Natl Acad Sci USA 98: 10630–10635, 2001.[Abstract/Free Full Text]
  9. Chawla A, Repa JJ, Evans RM, and Mangelsdorf DJ. Nuclear receptors and lipid physiology: opening the X-files. Science 294: 1866–1870, 2001.[Abstract/Free Full Text]
  10. Clarke S. Protein methylation. Curr Opin Cell Biol 5: 977–983, 1993.[CrossRef][Medline]
  11. Clarke S. Aging as war between chemical and biochemical processes: protein methylation and the recognition of age-damaged proteins for repair. Ageing Res Rev 2: 263–285, 2003.[CrossRef][Medline]
  12. Danesch U, Hoeck W, and Ringold GM. Cloning and transcriptional regulation of a novel adipocyte-specific gene, Fsp27. CAAT-enhancer-binding protein (C/EBP) and C/EBP-like proteins interact with sequences required for differentiation-dependent expression. J Biol Chem 267: 7185–7193, 1992.[Abstract/Free Full Text]
  13. Dhahbi JM, Mote PL, Wingo J, Tillman JB, Walford RL, and Spindler S. Calories and aging alter gene expression for gluconeogenic, glycolytic, and nitrogen-metabolizing enzymes. Am J Physiol Endocrinol Metab 277: E352–E359, 1999.[Abstract/Free Full Text]
  14. Di Bacco A and Gill G. The secreted glycoprotein CREG inhibits cell growth dependent on the mannose-6-phosphate/insulin-like growth factor II receptor. Oncogene 22: 5436–5445, 2003.[CrossRef][Web of Science][Medline]
  15. Figge A, Lammert F, Paigen B, Henkel A, Matern S, Korstanje R, Shneider BL, Chen F, Stoltenberg E, Spatz K, Hoda F, Cohen DE, and Green RM. Hepatic over-expression of murine Abcb11 increases hepatobiliary lipid secretion and reduces hepatic steatosis. J Biol Chem 279: 2790–2799, 2004.[Abstract/Free Full Text]
  16. Fijino T, Takei YA, Sone H, Ioka RX, Kamataki A, Magoori K, Takahashi S, Sakai J, and Yamamoto TT. Molecular identification and characterization of two medium-chain acyl-CoA synthetases, MACS1 and the Sa gene product. J Biol Chem 276: 35961–35969, 2001.[Abstract/Free Full Text]
  17. Finch CE and Ruvkun G. The genetics of aging. Annu Rev Genomics Hum Genet 2: 435–462, 2001.[CrossRef][Web of Science][Medline]
  18. FitzPatrick DR, Germain-Lee E, and Valle D. Isolation and characterization of rat and human cDNAs encoding a novel putative peroxisomal enoyl-CoA hydratase. Genomics 27: 457–466, 1995.[CrossRef][Medline]
  19. Ford ES, Smith SJ, Stroup DF, Steinberg KK, Mueller PW, and Thacker SB. Homocyst(e)ine and cardiovascular disease: a systematic review of the evidence with special emphasis on case-control studies and nested case-control studies. Int J Epidemiol 31: 59–70, 2002.[Abstract/Free Full Text]
  20. Forestier M, Banninger R, Reichen J, and Solioz M. Betaine homocysteine methyltransferase: gene cloning and expression analysis in rat liver cirrhosis. Biochim Biophys Acta 1638: 29–34, 2003.[Medline]
  21. Fujita T, Shirasawa T, and Maruyama N. Expression and structure of senescence marker protein-30 (SMP30) and its biological significance. Mech Ageing Dev 107: 271–280, 1999.[CrossRef][Web of Science][Medline]
  22. Gasmi L and McLennan AG. The mouse Nudt7 gene encodes a peroxisomal nudix hydrolase specific for coenzyme A and its derivatives. Biochem J 357: 33–38, 2001.[CrossRef][Medline]
  23. Gerisch B, Weitzel C, Kober-Eisermann C, Rottiers V, and Antebi A. A hormonal signaling pathway influencing C. elegans metabolism, reproductive development, and life span. Dev Cell 1: 841–851, 2001.[CrossRef][Web of Science][Medline]
  24. Hertzel AV and Bernlohr DA. Cloning and chromosomal location of the murine keratinocyte lipid-binding protein gene. Gene 221: 235–243, 1998.[CrossRef][Medline]
  25. Hill JO, Wyatt HR, Reed GW, and Peter JC. Obesity and the environment: where do we go from here? Science 299: 853–855, 2003.[Abstract/Free Full Text]
  26. Holla VR, Adas F, Imig JD, Zhao X, Price E, Olsen N, Kovacs WJ, Magnuson MA, Keeney DS, Breyer MD, Falck JR, Waterman MR, and Capdevila JH. Alterations in the regulation of androgen-sensitive Cyp4a monooxygenases cause hypertension. Proc Natl Acad Sci USA 98: 5211–5216, 2001.[Abstract/Free Full Text]
  27. Howitz KT, Bitterman KJ, Cohen HY, Lamming DW, Savu S, Wood JG, Zipkin RE, Chung P, Kisielewski A, Zhang L, Schere B, and Sinclair DA. Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature 425: 191–196, 2003.[CrossRef][Medline]
  28. Hunt MC, Solaas K, Kase BF, and Alexson SE. Characterization of an acyl-CoA thioesterase that functions as a major regulator of peroxisomal lipid metabolism. J Biol Chem 277: 1128–1138, 2002.[Abstract/Free Full Text]
  29. Inubushi T, Shikiji M, Endo K, Kakegawa H, Kishino Y, and Katunuma N. Hormonal and dietary regulation of lysosomal cysteine proteinases in liver under gluconeogenesis conditions. Biol Chem 377: 539–542, 1996.[Medline]
  30. Jogl G and Tong L. Crystal structure of carnitine acetyltransferase and implications for the catalytic mechanism and fatty acid transport. Cell 112: 113–122, 2003.[CrossRef][Web of Science][Medline]
  31. Johnson FB, Sinclair DA, and Guarente L. Molecular biology of aging. Cell 96: 291–302, 1999.[CrossRef][Web of Science][Medline]
  32. Kang H, Benzer S, and Min K. Life extension in Drosophila by feeding a drug. Proc Natl Acad Sci USA 99: 838–843, 2002.[Abstract/Free Full Text]
  33. Kappas A, Sassa S, Galbraith RA, and Nordmann Y. The porphyrias. In: The Metabolic Basis of Inherited Disease, edited by Scriver CR, Beaudet AL, Sly WS, and Valle D. New York: McGraw Hill, 1989.
  34. Karlic H, Leohninger A, Laschan C, Lapin A, Bohmer F, Huemer M, Guthann E, Rappold E, and Pfeilstocker M. Downregulation of carnitine acyltransferases and organic cation transporter OCTN2 in mononuclear cells in healthy elderly and patients with myelodysplastic syndromes. J Mol Med 81: 435–442, 2003.[Medline]
  35. Kelley KM, Oh Y, Gargosky SE, Gucev Z, Matsumoto T, Hwa V, Ng L, Simpson DM, and Rosenfeld RG. Insulin-like growth factor-binding proteins (IGFBPs) and their regulatory dynamics. Int J Biochem Cell Biol 28: 619–637, 1996.[CrossRef][Web of Science][Medline]
  36. Kenyon C. A conserved regulatory systems for aging. Cell 105: 165–168, 2001.[CrossRef][Web of Science][Medline]
  37. Kikuta Y, Kasyu H, Kusunose E, and Kusunose M. Expression and catalytic activity of mouse leukotriene B4 omega-hydroxylase, CYP4F14. Arch Biochem Biophys 383: 225–232, 2000.[CrossRef][Medline]
  38. Kurtz DM, Tolwani RJ, and Wood PA. Structural characterization of the mouse long-chain acyl-CoA dehydrogenase gene and 5' regulatory region. Mamm Genome 9: 361–365, 1998.[CrossRef][Medline]
  39. Lin SJ, Defossez PA, and Guarente L. Requirement of NAD and SIR2 for life-span extension by calorie restriction in Saccharomyces cerevisiae. Science 289: 2022–2068, 2000.[CrossRef]
  40. Longo VD. Mutations in signal transduction proteins increase stress resistance and longevity in yeast, nematodes, fruit flies, and mammalian neuronal cells. Neurobiol Aging 20: 479–486, 1999.[CrossRef][Web of Science][Medline]
  41. Longo VD and Finch CE. Evolutionary medicine: from dwarf model systems to healthy centenarians? Science 299: 1342–1346, 2003.[Abstract/Free Full Text]
  42. Lu SC, Alvarez L, Huang ZZ, Chen L, An W, Corrales FJ, Avila MA, Kanel G, and Mato JM. Methionine adenosyltransferase 1A knockout mice are predisposed to liver injury and exhibit increased expression of genes involved in proliferation. Proc Natl Acad Sci USA 98: 5560–5565, 2001.[Abstract/Free Full Text]
  43. Mato JM, Corrales FJ, Lu SC, and Avila MA. S-adenosylmethionine: a control switch that regulates liver function. FASEB J 16: 15–26, 2002.[Abstract/Free Full Text]
  44. Mazat L, Lafont S, Berr C, Debuire B, Tessier JF, Dartigues JF, and Baulieu EE. Prospective measurements of dehydroepiandrosterone sulfate in a cohort of elderly subjects: relationship to gender, subjective health, smoking habits, and 10-year mortality. Proc Natl Acad Sci USA 98: 8145–8150, 2991.
  45. Melendez A, Talloczy Z, Seaman M, Eskelinen E, Hall DH, and Levine B. Autophagy genes are essential for dauer development and life-span extension in C. elegans. Science 301: 1387–1391, 2003.[Abstract/Free Full Text]
  46. Michal M. Biochemical Pathways. Heidelberg: Akademische Verlag, 1999.
  47. Mozier NM, McConnell KP, and Hoffman JL. S-adenosyl-L-methionine:thioiether S-methyltransferase, a new enzyme in sulfur and selenium metabolism. J Biol Chem 263: 4527–4531. 1988.[Abstract/Free Full Text]
  48. Muoio DM and Lynis Dohm G. Peripheral metabolic actions of leptin. Best Pract Res Clin Endocrinol Metab 16: 653–666, 2002.[CrossRef][Medline]
  49. Murata T and Yamaguchi M. Molecular cloning of the cDNA coding for regucalcin and its mRNA expression in mouse liver: the expression is stimulated by calcium administration. Mol Cell Biochem 173: 127–133, 1997.[Medline]
  50. Nadal A, Marrero PF, and Haro D. Down-regulation of the mitochondrial 3-hydroxy-3-methylglutyryl-coA synthase gene by insulin: the role of the forkhead transcription factor FKHRL1. Biochem J 366: 289–297, 2002.[Medline]
  51. Ntambi JM, Miyazaki M, Stoehr JP, Lan H, Kendziorski CM, Yandell BS, Song Y, Cohen P, Friedman J, and Attie AD. Loss of stearoyl-CoA desaturase-1 function protects mice against adiposity. Proc Natl Acad Sci USA 99: 11482.11486, 2002.[Abstract/Free Full Text]
  52. Ntambi JM and Miyazaki M. Recent insights into stearoyl-CoA desaturase-1. Curr Opin Lipidol 14: 255–261, 2003.[CrossRef][Web of Science][Medline]
  53. Ray R, Chen G, Vande Velde C, Cizeau J, Park JH, Reed JC, Gietz RD, and Greenberg AH. BNIP3 heterodimerizes with Bcl-2/Bcl-X(L) and induces cell death independent of a Bcl-2 homology 3 (BH3) domain at both mitochondrial and nonmitochondrial sites. J Biol Chem 275: 1439–1448, 2000.[Abstract/Free Full Text]
  54. Ren S, Marques D, Redford K, Hylemon PB, Gil G, Vlahcevic ZR, and Pandak WM. Regulation of oxysterol 7{alpha}-hydroxylase (CYP7B1) in the rat. Metabolism 52: 636–642, 2003.[CrossRef][Medline]
  55. Rogina B, Helfand S, and Frankel S. Longevity regulation by Drosophila Rpd3 deacetylase and caloric restriction. Science 298: 1745, 2002.[Free Full Text]
  56. Scassa M, Varone C, Montero L, and Canepa ET. Insulin inhibits delta-aminolevulinate synthase gene expression in rat hepatocytes and human hepatoma cells. Exp Cell Res 244: 460–469, 1998.[CrossRef][Web of Science][Medline]
  57. Schaefer EJ. Lipoproteins, nutrition, and heart disease. Am J Clin Nutr 75: 191–212, 2002.[Abstract/Free Full Text]
  58. Scislowski PW, Foster AR, and Fuller MF. Regulation of oxidative degradation of L-lysine in rat liver mitochondria. Biochem J 300: 887–891, 1994.
  59. Scriver CR, Beaudet L, Sly WS, and Valle D. The Metabolic Basis of Inherited Disease. New York: McGraw Hill, 1989.
  60. Shalev A, Pise-Masison CA, Radonovich M, Hoffmann SC, Hirschberg B, Brady JN, and Harlan DM. Oligonucleotide microarray analysis of intact human pancreatic islets: identification of glucose-responsive genes and a highly regulated TGFß signaling pathway. Endocrinology 142: 3695–3698, 2002.
  61. Shu Z, Smith S, Wang L, Rice MC, and Kmiec EB. Disruption of muREC2/RAD51L1 mice results in early embryonic lethality which can be partially rescued in a p53(–/–) background. Mol Cell Biol 12: 8686–8693, 1999.
  62. Simon AF, Shih C, Mack A, and Benzer S. Steroid control of longevity in Drosophila melanogaster. Science 299: 1407–1410, 2003.[Abstract/Free Full Text]
  63. Sohal RS and Weindruch R. Oxidative stress, caloric restriction, and aging. Science 273: 59–63, 1996.[Abstract]
  64. Stadman ER. Protein oxidation and aging. Science 257: 1220–1224, 1992.[Abstract/Free Full Text]
  65. Starai VJ, Celic I, Cole RN, Boeke JD, and Escalante-Semerena JC. Sir2-dependent activation of acetyl-CoA synthetase by deacetylation of active lysine. Science 298: 2390–2392, 2002.[Abstract/Free Full Text]
  66. Stypmann J, Gläser K, Roth W, Tobin DJ, Petermann I, Matthias R, Mönnig G, Haverkamp W, Breithardt G, Schmahl W, Peters C, and Reinheckel T. Dilated cardiomyopathy in mice deficient for the lysosomal cysteine peptidase cathepsin L. Proc Natl Acad Sci USA 99: 6234–6239, 2002.[Abstract/Free Full Text]
  67. Su AI, Guidotti LG, Pezacki JP, Chisari F, and Schultz PG. Gene expression during the priming phase of liver regeneration after partial hepatectomy in mice. Proc Natl Acad Sci USA 99: 11181–11186, 2002.[Abstract/Free Full Text]
  68. Tatar M, Bartke A, and Antebi A. The endocrine regulation of aging by insulin-like signals. Science 299: 1346–1351, 2003.[Abstract/Free Full Text]
  69. Taubes G. The soft science of dietary fat. Science 29: 2536–2545, 2001.
  70. Taubes G. Insulin insults may spur Alzheimer’s disease. Science 301: 40–41, 2003.[Abstract/Free Full Text]
  71. Tillman JB, Dhahbi JM, Mote PL, Walford RL, and Spindler SR. Dietary caloric restriction in mice induces carbamyl phosphate synthetase I gene transcription tissue specifically. J Biol Chem 271: 3500–3506, 1996.[Abstract/Free Full Text]
  72. Uthus EO, and Brown-Borg HM. Altered methionine metabolism in long living Ames dwarf mice. Exp Gerontol 38: 491–498, 2002.
  73. Vairapandi M, Balliet AG, Hoffman B, and Liebermann DA. GADD45b and GADD45g are cdc2/cyclinB1 kinase inhibitors with a role in S and G2/M cell cycle checkpoints induced by genotoxic stress. J Cell Physiol 192: 327–338, 2002.[CrossRef][Web of Science][Medline]
  74. Vande Velde C, Cizeau J, Dubik D, Alimonti J, Brown T, Israels S, Hakem R, and Greenberg AH. BNIP3 and genetic control of necrosis-like cell death through the mitochondrial permeability transition pore. Mol Cell Biol 15: 5454–5468.
  75. Visvader JE, Venter D, Hahm K, Santamaria M, Sum EY, O’Reilly L, White D, Williams R, Armes J, and Lindeman GJ. The LIM domain gene LMO4 inhibits differentiation of mammary epithelial cells in vitro and is overexpressed in breast cancer. Proc Natl Acad Sci USA 98: 14452–14457, 2001.[Abstract/Free Full Text]
  76. Wang Y, De Keulenaer GW, and Lee RT. Vitamin D(3)-up-regulated protein-1 is a stress-responsive gene that regulates cardiomyocyte viability through interaction with thioredoxin. J Biol Chem 277: 26496–26500, 2002.[Abstract/Free Full Text]
  77. Watanabe R, Fujii H, Odani S, Sakakibara J, Yamamoto A, Ito M, and Ono T. Molecular cloning of a cDNA encoding a novel fatty acid-binding protein from rat skin. Biochem Biophys Res Commun 200: 253–259, 1994.[Medline]
  78. Waters C. Practical issues with COMT inhibitors in Parkinson’s disease. Neurology 55: S57–S59, 2000.[Medline]
  79. Weindruch R, Kayo T, Lee CK, and Prolla TA. Microarray profiling of gene expression in aging and its alteration by caloric restriction in mice. J Nutr 131: 918S–923S, 2001.[Abstract/Free Full Text]
  80. Yang YH, Dudoit S, Luu P, Lin DM, Peng V, Ngai J, and Speed TP. Normalization for cDNA microarray data: robust composite method addressing single and multiple slide systematic variation. Nucleic Acids Res 30: e15, 2002.[Abstract/Free Full Text]
  81. Yen S. Dehydroepiandrosterone sulfate and longevity: new clues for an old friend. Proc Natl Acad Sci USA 98: 8167–8169, 2001.[Free Full Text]
  82. Yoo J, Ghiassi M, Jirmanova L, Balliet AG, Hoffman B, Fornace AJ, Liebermann DA, Bottinger EP, and Roberts AB. Transforming growth factor-beta-induced apoptosis is mediated by Smad-dependent expression of GADD45b through p38 activation. J Biol Chem 278: 43001–43007, 2003.[Abstract/Free Full Text]
  83. Zhao XQ, Latinwo L, Liu XX, Lee ES, Lamango N, and Charlton CG. L-Dopa upregulates the expression and activities of methionine adenosyl transferase and catechol- O-methyltransferase. Exp Neurol 171: 127–138, 2001.[CrossRef][Medline]
  84. Zimmet P, Alberti K, and Shaw J. Global and societal implications of the diabetes epidemic. Nature 414: 782–787, 2001.[CrossRef][Medline]
  85. Zinke I, Schütz CS, Katzenberger JD, Bauer M, and Pankratz MJ. Nutrient control of gene expression in Drosophila: microarray analysis of starvation and sugar-dependent response. EMBO J 22: 6162–6173, 2002.[CrossRef]
  86. Zubieta J, Heitzeg MM, Smith YR, Bueller JA, Xu K, Xu Y, Koeppe RA, Stohler CS, and Goldman D. COMT val158met genotype affects mu-opioid neurotransmitter responses to a pain stressor. Science 299: 1240–1243, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
L. L. Grasfeder, S. Gaillard, S. R. Hammes, O. Ilkayeva, C. B. Newgard, R. B. Hochberg, M. A. Dwyer, C.-y. Chang, and D. P. McDonnell
Fasting-Induced Hepatic Production of DHEA Is Regulated by PGC-1{alpha}, ERR{alpha}, and HNF4{alpha}
Mol. Endocrinol., August 1, 2009; 23(8): 1171 - 1182.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
S. Lkhagvadorj, L. Qu, W. Cai, O. P. Couture, C. R. Barb, G. J. Hausman, D. Nettleton, L. L. Anderson, J. C. M. Dekkers, and C. K. Tuggle
Microarray gene expression profiles of fasting induced changes in liver and adipose tissues of pigs expressing the melanocortin-4 receptor D298N variant
Physiol Genomics, June 10, 2009; 38(1): 98 - 111.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
R. R Almon, D. C DuBois, W. Lai, B. Xue, J. Nie, and W. J Jusko
Gene expression analysis of hepatic roles in cause and development of diabetes in Goto-Kakizaki rats
J. Endocrinol., March 1, 2009; 200(3): 331 - 346.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J.-O. Andressoo, G. Weeda, J. de Wit, J. R. Mitchell, R. B. Beems, H. van Steeg, G. T. J. van der Horst, and J. H. Hoeijmakers
An Xpb Mouse Model for Combined Xeroderma Pigmentosum and Cockayne Syndrome Reveals Progeroid Features upon Further Attenuation of DNA Repair
Mol. Cell. Biol., March 1, 2009; 29(5): 1276 - 1290.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
R. E. Drew, K. J. Rodnick, M. Settles, J. Wacyk, E. Churchill, M. S. Powell, R. W. Hardy, G. K. Murdoch, R. A. Hill, and B. D. Robison
Effect of starvation on transcriptomes of brain and liver in adult female zebrafish (Danio rerio)
Physiol Genomics, November 12, 2008; 35(3): 283 - 295.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
S.-J. Reilly, V. Tillander, R. Ofman, S. E.H. Alexson, and M. C. Hunt
The Nudix Hydrolase 7 is an Acyl-CoA Diphosphatase Involved in Regulating Peroxisomal Coenzyme A Homeostasis
J. Biochem., November 1, 2008; 144(5): 655 - 663.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J. J. Loor, R. E. Everts, M. Bionaz, H. M. Dann, D. E. Morin, R. Oliveira, S. L. Rodriguez-Zas, J. K. Drackley, and H. A. Lewin
Nutrition-induced ketosis alters metabolic and signaling gene networks in liver of periparturient dairy cows
Physiol Genomics, December 19, 2007; 32(1): 105 - 116.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
K. F. Tacer, D. Kuzman, M. Seliskar, D. Pompon, and D. Rozman
TNF-{alpha} interferes with lipid homeostasis and activates acute and proatherogenic processes
Physiol Genomics, October 19, 2007; 31(2): 216 - 227.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
C. Selman, N. D. Kerrison, A. Cooray, M. D. W. Piper, S. J. Lingard, R. H. Barton, E. F. Schuster, E. Blanc, D. Gems, J. K. Nicholson, et al.
Coordinated multitissue transcriptional and plasma metabonomic profiles following acute caloric restriction in mice
Physiol Genomics, November 21, 2006; 27(3): 187 - 200.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
M. Bauer, J. D. Katzenberger, A. C. Hamm, M. Bonaus, I. Zinke, J. Jaekel, and M. J. Pankratz
Purine and folate metabolism as a potential target of sex-specific nutrient allocation in Drosophila and its implication for lifespan-reproduction tradeoff
Physiol Genomics, May 16, 2006; 25(3): 393 - 404.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
R. S. Settivari, S. Bhusari, T. Evans, P. A. Eichen, L. B. Hearne, E. Antoniou, and D. E. Spiers
Genomic analysis of the impact of fescue toxicosis on hepatic function
J Anim Sci, May 1, 2006; 84(5): 1279 - 1294.
[Abstract] [Full Text] [PDF]


Home page
J Gerontol A Biol Sci Med SciHome page
J. C. Corton and H. M. Brown-Borg
Peroxisome Proliferator-Activated Receptor {gamma} Coactivator 1 in Caloric Restriction and Other Models of Longevity
J Gerontol A Biol Sci Med Sci, December 1, 2005; 60(12): 1494 - 1509.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
Y. Cheon, T. Y. Nara, M. R. Band, J. E. Beever, M. A. Wallig, and M. T. Nakamura
Induction of overlapping genes by fasting and a peroxisome proliferator in pigs: evidence of functional PPAR{alpha} in nonproliferating species
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2005; 288(6): R1525 - R1535.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
L. K Heilbronn, S. R Smith, C. K Martin, S. D Anton, and E. Ravussin
Alternate-day fasting in nonobese subjects: effects on body weight, body composition, and energy metabolism
Am. J. Clinical Nutrition, January 1, 2005; 81(1): 69 - 73.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. E. Finch
The neurotoxicology of hard foraging and fat-melts
PNAS, December 28, 2004; 101(52): 17887 - 17888.
[Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
K. Pardee, J. Reinking, and H. Krause
Nuclear Hormone Receptors, Metabolism, and Aging: What Goes Around Comes Around
Sci. Aging Knowl. Environ., November 24, 2004; 2004(47): re8 - re8.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. C. Corton, U. Apte, S. P. Anderson, P. Limaye, L. Yoon, J. Latendresse, C. Dunn, J. I. Everitt, K. A. Voss, C. Swanson, et al.
Mimetics of Caloric Restriction Include Agonists of Lipid-activated Nuclear Receptors
J. Biol. Chem., October 29, 2004; 279(44): 46204 - 46212.
[Abstract] [Full Text] [PDF]


This Article
Free upon publication Free Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
17/2/230    most recent
00203.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (49)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bauer, M.
Right arrow Articles by Katzenberger, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bauer, M.
Right arrow Articles by Katzenberger, J. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.