|
|
||||||||
1 Interdepartmental Nutrition Program, Purdue University, West Lafayette 47907
2 Department of Statistics, Purdue University, West Lafayette 47907
3 Center for Medical Genomics, Indiana University School of Medicine, Indianapolis, Indiana 46202
| ABSTRACT |
|---|
|
|
|---|
microarray; Wnt; transforming growth factor ß; phosphatidylinositol 3-kinase
| INTRODUCTION |
|---|
|
|
|---|
Within each segment of the intestine is the crypt-villus axis. In the crypt, stem cells in the lower portion proliferate and migrate up toward the villus and downward to the nadir of the crypt. As the cells migrate, they receive signals that stimulate them to commit and differentiate into one of the several intestinal cell phenotypes, e.g., paneth cells, enteroendocrine cells, goblet cells, M cells, caveolated tuft cells, and absorptive epithelial cells (9). The mechanism by which crypt stem cells of the mature intestine commit and differentiate into each of these cell lineages is not fully clear.
A number of cells systems have been developed to study the differentiation of proliferating crypt-like cells into functioning enterocytes (12; 45). The colonic adenocarcinoma cell line Caco-2 is unique among these models in that upon contact inhibition of proliferation, cultures of the parental Caco-2 cell line, as well as a number of clonal lines, spontaneously differentiate and acquire the phenotype of a mature absorptive epithelial cell, i.e., cellular polarization, development of tight junctions and a well-developed brush-border membrane, and expression of a number of brush-border hydrolases (e.g., sucrase-isomaltase, lactase) that are characteristic of the small intestine (12, 49). Although investigators have examined the activity and role of specific signaling pathways across the crypt-villus axis as well as the transcription factors controlling the villus-specific expression of specific genes, we do not have a complete picture of the molecular changes that lead to absorptive epithelial cell differentiation.
DNA microarrays offer researchers a unique opportunity to conduct a broad survey of the changes in gene expression that accompany a biological process such as absorptive epithelial cell differentiation. Microarrays have been used to analyze whole intestine gene expression in mice (2), postconfluent differentiation of the parental Caco-2 cell line (37), and other processes (35, 39). However, a systematic examination with rigorous statistical analysis of the expression data has not yet been reported in this field. Here we examine the changes in gene expression that occur as the BBe subclone of Caco-2 progresses from proliferation to a differentiated enterocyte with features of mature, small-intestinal epithelial cells. Our results demonstrate the value of a detailed statistical approach to evaluating microarray data and they provide us insight into the pathways that may be critical to the cell during this process.
| EXPERIMENTAL DESIGN AND METHODS |
|---|
|
|
|---|
Microarray Analysis
RNA quality was further tested using a bioanalyzer (Agilent Technologies, Palo Alto, CA) and by measuring absorbance from 200 to 350 nm. Four separate RNA preparations, each from an independent dish of cells, were analyzed for each time point. Starting from 10 µg of total RNA for each sample, cDNA was synthesized and biotinylated cRNA was generated by in vitro transcription, following the standard Affymetrix protocols (http://www.affymetrix.com/support/technical/manual/expression_manual.affx). Biotinylated cRNAs were fragmented, and each sample was hybridized to an Affymetrix U95A GeneChip (12,363 sequences) at 42°C for 17 h, then washed, stained, and scanned following the standard Affymetrix protocol. Expression data were generated using the Affymetrix Microarray Suite software version 4.0.
Statistical Evaluation of the Microarray Data
A rigorous statistical analysis is essential to determine which genes are differentially expressed relative to the noise inherent in microarray analysis (42). For this work, the following steps were taken.
First, the number of genes evaluated was reduced by including only those genes called "present" by the Affymetrix software for at least three of four replicates in at least one stage of differentiation. A second reduction was based on the findings of Mills and Gordon (40), who showed that false positives are more frequent in genes at the lowest level of expression. As a result, we calculated the first quartile of expression level (i.e., 590 arbitrary units) and excluded genes whose mean expression at all three stages of culture was less than this value.
Next, we utilized a linear mixed model (i.e., random effect ANOVA or split plot design; Ref. 50) to explain known sources of variation and test the hypothesis that there is a change in expression of a gene between any two stages with respect to the average expression of all genes at the same stage. Since this ANOVA model assumes constant error variance, the "log average ratio" was chosen as the measure of gene expression that most closely approximates this assumption. In addition, a bootstrapping scheme was applied to minimize the potential consequences of nonnormal data (19). Overall, this approach includes data standardization to account for systematic noise due to the experiment and within the technology, accounts for correlation between the expression measures (i.e., correlation of expression measures within a GeneChip), and allows for an inference procedure that determinates differentially expressed genes.
Finally, three specific pairwise comparisons were made between the stages of culture for each gene: 2 days vs. 8 days, 8 days vs. 15 days, and 2 days vs. 15 days. Given the large number of comparisons (3 comparisons x 4,612 genes after filtering = 13,836 comparisons), the hypothesis tests were adjusted to balance the type I (false positive) and type II (false negative) error rates. In principle, two major alternatives are available: procedures controlling the familywise error rate detection (e.g., Bonferroni correction;
divided by the number of comparisons) and procedures controlling the false discovery rate (5). Conclusions presented here are based on the false discovery rate criterion due to its better control of the type II errors.
After identifying the differentially expressed genes, the genes were clustered by self-organizing maps (58) using GeneCluster version 2.0 from the Whitehead Institute/MIT Center for Genome Research (http://www-genome.wi.mit.edu/cancer/software/software.html). We used a 4 x 3 matrix and the default settings of the software (50 epochs, 1 seed, random vectors method of initialization, bubble neighborhood definition,
i =0.1,
i =5,
f = 0.005,
f = 0.2).
Cross-Validation of Microarray Data
Three methods were used to provide validation for our microarray results. First, we examined the internal consistency of our data using the genes on our list of differentially expressed genes that were represented at least twice on the Affymetrix U95A GeneChip. We examined whether the duplicates for these genes were placed into identical or similar clusters. In addition, the average 8-day and 15-day expression values were expressed relative to the average 2-day value (as maximum/minimum value) to define a fold change, and we plotted the fold changes at 8 and 15 days from replicate 1 against those from replicate 2; a linear regression was calculated. Second, we determined whether the experimental approach identified genes whose expression had previously been reported to change during normal small intestinal differentiation. Finally, we validated the differential expression of seven genes by reverse transcription PCR (RT-PCR). The RNA samples that had been analyzed by microarray were pooled by stage (5 µg of RNA from each of the four replicates within a stage). cDNA samples were prepared from the pooled RNA samples, and PCR was conducted on the cDNA samples as we have described previously (20). PCR primers were designed in Jellyfish (LabVelocity; http://jellyfish.labvelocity.com/), and eight gene targets were examined: glyceraldehyde phosphate dehydrogenase (GAPDH = control gene) (GenBank ID no. X02231), forward primer 5' CCATGGAGAAGGCTGGGG 3', reverse primer 5' CAAAGTTGTCATGGATGACC 3', annealing temperature (Ta) = 55°C, 17 cycles; sucrase-isomaltase (no. X63597), forward primer 5' GGTGGTCACATCCTACCATGTCAAG 3', reverse primer 5' CCAGTTGATTTCTATTGGTTCTTCT 3', Ta = 55°C, 25 cycles; TGFßII receptor (no. D50683), forward primer 5' CCTACTCTGTCTGTGGATGACCT 3', reverse primer 5' GATCTCTCAACACGTTGTCCTTC 3', Ta = 61°C, 29 cycles; CSF receptor I (no. M33210), forward primer 5' TACCCCAAGAAGGATGTGAGAG 3', reverse primer 5' GGTAACGTATTGAGAACCCACTC 3', Ta = 61°C, 31 cycles; aryl hydrocarbon receptor (no. L19872), forward primer 5' CCACAACATTCCAAATGTACAGA 3', reverse primer 5' AGTGGCTGAAGATGTGTGGTAGT 3', Ta = 61°C, 31 cycles; PDGF receptor (no. J03278), forward primer 5' GATGAGGAGTTTCTGAGGAGTGA 3', reverse primer 5' GTTGAGGAGGTGTTGACTTCATT 3', Ta = 61°C, 31 cycles; c-fos (no. V01512), forward primer 5' GGTGCATTACAGAGAGGAGAAAC 3', reverse primer 5' CCTGGCTCAACATGCTACTAACT 3', Ta = 61°C, 31 cycles; and jagged (no. U77914), forward primer 5' ATGACTGTAATACCTGCCAGTGC 3', reverse primer 5' TCCGTAGTAAGACCTGGTGACAT 3', Ta = 61°C, 31 cycles.
After the PCR reaction, the PCR products were separated on 3% agarose gels, then stained with ethidium bromide, and a digital image was recorded under UV light using the FluorS Imaging system (Bio-Rad).
Gene Classification and Functional Group Analysis
Genes were categorized into one of 26 different functional categories based upon bioprocess and molecular functions described in the annotation tables available for each target at the NetAffx analysis center (http://www.affymetrix.com/analysis/index.affx). These categories were further refined by the target of the bioprocess or molecular action (e.g., catabolism, amino acid; proliferation, induction; signaling, MAPK pathway). The clusters and groups of related clusters were examined for the functional categories present. These categories, as well as the Affymetrix annotation tables, were used to identify genes that are associated with specific signaling pathways. Genes involved in specific signaling pathways were listed and examined for coordinate changes in regulation.
Access to the Data
These data have been submitted to the Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo).
| RESULTS |
|---|
|
|
|---|
|
2-thiol proteinase inhibitor, and cytochrome P(1)-450 family I. The later two entries had very low expression values at 2 days for one of the replicates that resulted in a very high expression ratio in one replicate but a less dramatic fold change in the other. However, the replicates of these two genes ended up in identical clusters.
|
3, and
1-antitrypsin. Several other genes related to the phenotype of small intestinal nutrient transport were also expressed at high levels in differentiated BBe cells, e.g., iron absorption genes hephaestin, DCT1, transferrin receptor, the folate receptor, and aquaporin 3. Several genes that others have found to be expressed in Caco-2 cells were absent in our microarray analysis, i.e., dipeptidyl peptidase IV (18), lactase (61), and calbindin D9k (20). This suggests that the level of these mRNAs is below the detection limit of the microarray, a condition that is likely to be true for BBe expression of calbindin D9k (20) or that the probe sets for these mRNA species are poorly designed.
|
|
|
|
Transitional genes.
The number of genes present in the two clusters characterized by a spike or nadir of expression at 8 days in culture is small (63 total in clusters 3 and 10), making global statements about the shared function of these genes difficult. However, a greater proportion of genes in these clusters were involved in signaling or transcriptional control (21/62 = 33.9%) compared with either up- or downregulated genes (17.6 and 16.4%, respectively). Cluster 3 contained genes encoding TGFßII receptor
, PDGF receptor, CSF-I receptor, and TNF receptor superfamily member 11b (osteoprotegerin).
Upregulated genes.
The groups showing upregulation of gene expression with growth arrest and differentiation (groups 5 and 6) have a greater proportion of genes involved in metabolism (15.5% of genes in differentially expressed genes in these groups vs. 7.1% in groups 1 and 2). These genes include those for lipid metabolism (e.g., apolipoproteins CI, CIII, B100, H, and M; apolipoprotein B mRNA editing protein; LXR
; and SREBP-1) vitamin and mineral metabolism (e.g., retinal binding protein 4, selenium binding protein 1, selenophosphate sythetase 2, biotinidase, hephaestin, DCT1, transferrin receptor, and folate receptor), nutrient transport/digestion (Fig. 4C), and xenobiotic metabolism (12/14 xenobiotic metabolizing genes found in our list of differentially expressed genes were in groups 5 and 6, Fig. 4B). In addition, 8 of the 12 unique genes controlling oxidative stress are found in cluster 5 (Fig. 4A). While 27 genes in the "proliferation" category were upregulated, 16 of these genes were clearly, functionally linked to the inhibition of cell cycle. Similarly, 11 of 22 upregulated proteolysis-related genes encode for inhibitors. Finally, more genes with unknown or ambiguous function were found in groups 5 and 6 (141 genes or 26.7% of the total in those groups) than in groups 1 and 2 (83 genes or 14.8%).
|
, and NK cell transcript 4 (Fig. 5A)], whereas other groups of genes were upregulated during the transition from proliferation to differentiation [e.g., occludin and fibrinogen-
, -ß, and -
(Fig. 5A)] or after differentiation [e.g., contactin and transmembrane 4 superfamily member 6 (Fig. 5A)].
|
, TGFß family member, and fibromodulin) or the differentiated phenotype (latent TGFß binding protein 4, TGFß early growth response gene, and activin A receptor II) (Fig. 6C).
|
| DISCUSSION |
|---|
|
|
|---|
divided by the number of comparisons) severely reduced the number of genes identified to 227. Although most of these genes were also on our list of 1,150, the difference between the Bonferroni results and our own indicates that this comes at the expense of a high false-negative rate (>1,000 differentially expressed genes excluded). As a simple alternative to statistical analysis of microarray data, some investigators have utilized a threefold change in expression as a rigorous cutoff for defining a meaningful difference. However, our statistical analysis shows that 35% of the 601 "present" genes identified as differentially expressed using the threefold cutoff were not in our list of differentially expressed genes. This indicates that the fold-change approach, which does not account for variability in the expression of the genes, is also subject to a high false-positive rate. Although this was improved by filtering out genes in the lowest quartile of expression, the fold-difference approach still ignores more modest changes that may have biological significance. Previously, Mariadason et al. (37) studied the spontaneous differentiation of the parental Caco-2 cell line using spotted cDNA microarrays and confluent cultures of cells as a reference point. They observed that Caco-2 cell differentiation downregulated the expression of 70% of the genes on their arrays, and they suggested that their data supported the use of Caco-2 cells as a model for studying colonocyte differentiation. In the data reported by Mariadason et al. (37), 322 genes were also found on our list of differentially expressed genes (i.e., exact name matches). When we compared these data [using the expression ratio of our data from 8-day and 15-day cultures of BBe cells to the expression ratio of their data from 5 days postconfluent (9 days in culture) and 14 days postconfluent (18 days in culture)], the correlation between these ratios was very poor (r2 = 0.01). Although this lack of correlation could be due to using comparisons with different baselines (i.e., confluent cells vs. 50% confluent cells), we think that the main cause of this poor correlation is differences in our approach. In contrast to the strong correlation that we observed between duplicates within our data set (r2 = 0.84), the correlation between 97 duplicates that we found in the Mariadason et al. data set of named, differentially expressed genes was generally weak (r2 = 0.15), suggesting their approach (spotted array, no sample replicates) was likely to identify only genes with robust changes in gene expression.
In addition to the report by Mariadason et al. (37), others have used DNA microarrays to evaluate the impact of butyrate, tricostatin A, sulindac, and curcumin on gene expression profiles in Caco-2 (56) or SW620 cells (39). These studies also focus on the expression changes associated with growth arrest and the downregulation of cell cycle. In addition, Tadjali et al. (57) used a filter array spotted with 18,149 expressed sequence tags (ESTs) and found that the number of genes expressed in differentiated cultures of parental Caco-2 cells (7 days postconfluent) was reduced compared with undifferentiated cells (3 day cultures). In contrast to these reports, our microarray analysis reveals that the BBe clone of Caco-2 expresses a small intestinal phenotype upon differentiation (Table 2), consistent with what others have found for the parental line and several Caco-2 clones (12, 49). It is this characteristic that has made Caco-2 cells a valuable tool for the study of differentiation-induced gene expression in enterocytes, e.g., sucrase-isomaltase (8), lactase-phloridzin hydrolase (31), calbindin D9k (1, 33), and dipeptidyl peptidase IV (18). However, it is clear that the Caco-2 cell and its clones are not small intestinal enterocytes and that the acquisition of this phenotype likely reflects a regression to a fetal phenotype. During weeks 1428 of human fetal development, the colon develops villus-like projections and expresses the small intestinal marker enzyme, sucrase-isomaltase (32). Bates et al. (2) have conducted a survey of mouse tissues and found 571 genes were expressed to a greater degree in at least one segment of the intestine. Forty-nine of the genes identified in that screen were present in the BBe cell cultures. While 35 of these genes were expressed predominantly in mouse small intestine, 14 were expressed predominantly in the lower intestine. Thus it appears that the Caco-2 cell differentiation leads to a hybrid cell with both colonocyte and enterocyte characteristics.
The major strength of the microarray approach is that it can identify relationships between phenotypes and gene expression that can serve as the basis for future hypothesis testing. Although many potential stories can be told with microarray data, we feel that the most interesting one that arose from our analysis relates to the regulation of genes that are involved in, or utilize, specific signaling pathways, i.e., cell-cell and cell-matrix interactions, Wnt, PI3-kinase, and TGFß signaling. Modulation of these pathways may be important for the development of the enterocyte (or colonocyte) phenotype.
Cell-cell/cell-matrix interactions.
The role of interaction between integrins and extracellular matrix during enterocyte differentiation is well characterized (4, 54) and involves the coordinated production of proteins from both the intestinal epithelium and mesenchymal cells (46). Our data suggest that distinct families of genes involved in cell-cell or cell-matrix interactions are expressed in proliferating as opposed to postproliferative or differentiated cells. Expression of genes for the cell adhesion molecules bystin-like protein, NK cell transcript 4, and zyxin, the junction-associated proteins vinculin and brain-heart protocadherin, and the integrin/matrix proteins NAG-2, laminin-
1 and -ß1, and the proto-oncogene integrin-linked kinase genes was highest in proliferating cells. However, as cells stopped proliferating, the mRNA level for a large number of other genes in this category increased (Fig. 5); few of these genes changed further from 8 to 15 days in culture. This suggests that cell-cell, cell-matrix interactions are more likely involved with the early process of differentiation (i.e., growth arrest and commitment) than postproliferative acquisition of the differentiated phenotype. Several interesting examples suggesting this are given in the sections below.
Wnt signaling.
The Wnt signaling pathway has been implicated in the control of intestinal proliferation; deregulation or mutation within members of this pathway leads to excessive proliferation and has been implicated in colon cancer (e.g., mutations in the inhibitory factor APC) (9). In undifferentiated Caco-2 cells, overexpression of APC or ß-catenin, and expression of a dominant negative form of TCF-4, a transcription factor that mediates Wnt action, significantly increased promoter activity of alkaline phosphatase and intestinal fatty acid binding protein, but not sucrase reporter genes (38). This suggests that blocking Wnt signaling is a critical step for the development of at least some of the differentiated phenotype in Caco-2. Our microarray data found that a number of TCF gene targets (c-myc, cyclin D1) and Wnt signaling components (frizzled, PP2A subunits, PKC iota) are coordinately downregulated by differentiation. The downregulation of Wnt signaling may result from specific cell-cell or cell-matrix interactions. Perreault et al. (47) recently showed that the transcription factor Fox1 activates the Wnt pathway by increasing the expression of extracellular proteoglycans which act as coreceptors for Wnt, i.e., syndecan-1. The downregulation that we observed in the expression of the desmosome component plakophilin-2 could be an essential step in suppression of Wnt signaling. Expression of plakophilin-2 in SW480 colon tumor cells upregulates endogenous ß-catenin signaling activity, and this can be abolished by ectopic expression of E-cadherin (14).
PI3-kinase.
The role of the PI3-kinase signaling pathway in enterocyte differentiation is controversial. Laprise et al. (34) showed that inhibition of PI3-kinase with LY294002 inhibits differentiation of the Caco-2 2/15 clone (e.g., sucrase expression, formation of a well-developed brush-border membrane). In their study, PI3-kinase was recruited to, and activated by, E-cadherin-mediated cell-cell contacts, leading to the assembly of adherens junctions and enterocyte differentiation. In contrast, Wang et al. (62) found that inhibition of PI3-kinase by wortmannin enhanced basal and sodium butyrate-induced proliferation of HT-29 cells and the parental line of Caco-2. They later showed that PI3-kinase inhibition or PTEN activation activates the cdx-2 gene promoter through a pathway that includes NF-
B activation (28). While we also see an upregulation of cdx-2 mRNA levels during differentiation in our microarray data (2.2-fold from 2 to 15 days in culture), our data appear to support the studies by Laprise et al. (34). We find that genes encoding PI3-kinase pathway-related genes are generally upregulated during the transition stage between proliferation and differentiation (Fig. 6B). PAK1 (p21 activated kinase 1) is a kinase activated by PI3-kinase through stimulation of the PDGF receptor in NIH 3T3 cells (52). In mast cells, PDGF receptor activation stimulates cell-matrix adhesion through fibronectin by the independent activation of PI3-kinase and phospholipase C
1 (29). In our study, fibronectin mRNA levels were high at 2 and 8 days in culture but fell by 70% afterward. This suggests that activation of PI3-kinase (and PAK1) through the PDGF receptor could be involved in matrix-induced differentiation but is not needed thereafter. Finally, we found that differentiation was associated with the expression of the erbB2 (HER2), erbB3 (HER3), and TOB (transducer of erbB2). Increased expression of erbB2 and erbB3 is seen after maturation of mammary epithelium in rats (17). In 15-day-old cultures of the T84 colonic epithelial cell line, stimulation of these receptors can activate PI3-kinase and lead to inhibition of calcium-dependent chloride secretion (27). These data suggest that erbB2 and erbB3 may utilize the PI3-kinase pathway to control epithelial cell differentiation and differentiated function of intestinal epithelium.
TGFß-related signaling.
Our data suggest that activation of TGFß signaling through the TGFßII receptor
could be involved in the transition from proliferation to differentiation (2-fold upregulation of mRNA at 8 days). Suppression of TGFß type II receptor by ras transformation in intestinal epithelial cells leads to resistance to the growth inhibitory actions of TGFß (10), and colon cancer in mice may be due to PKC ßII induced suppression of the TGFßII receptor (41). Similarly, disruption of the gene encoding latent TGFß binding protein 4 leads to epithelial cells with reduced levels of phosphorylated Smad2, overexpression of c-myc, and uncontrolled proliferation (53). Increased levels of TGFß early growth response gene (also known as TGFß inducible early gene, TIEG) mRNA indicates that the TGFß signaling pathway has been activated by differentiation in BBe cells; TIEG is a zinc finger transcription factor family member whose expression is rapidly induced in cells treated with TGFß (55). In MG-63 osteosarcoma cells, TIEG mRNA overexpression leads to changes that mimic the effect of TGFß treatment (23), indicating that TIEG is the mediator of the prodifferentiating effects of TGFß. The downregulated TGFß family member genes we identified include members of the inhibin/activin system (6) and several BMP family members; these have not been extensively studied in the context of intestinal biology. However, activin A is known to promote growth arrest and differentiation in a number of tissues (13, 15) and inhibins work in antagonism of activin action (7). Thus our observation that inhibin-ß B and C mRNA levels are downregulated while activin A receptor II mRNA levels increase during differentiation are consistent with a role for these TGFß family members in differentiation.
Conclusion.
Our data demonstrate the value of a rigorous statistical approach to the analysis of microarray data. By using procedures to balance type I and II errors we created a more reliable list of genes that are differentially expressed during BBe cell differentiation (i.e., compared with independent t-tests or fold change). This analysis revealed that the BBe cell expresses the molecular signature of both a colonocyte and an enterocyte. As such, researchers should used caution when extrapolating data from these cells to explain the biology of the normal colon or small intestine.
Cluster analysis and functional assessment of the differentially expressed genes has identified interesting patterns of change in the expression of genes associated with several signaling pathways. These changes provide a foundation for future hypothesis based experiments on the role of specific family members within the TGFß, Wnt, and PI3-kinase signaling pathways during enterocyte differentiation. An unresolved issue is how the patterns of change we observed in these (or other) pathways activates the expression of genes that characterize the differentiated phenotype of an absorptive epithelial cell, e.g., iron transport genes (DCT1, hephaestin), sucrase-isomaltase, and MRP3. Additional studies on the posttranslational modification of transcription factors implicated in intestine-specific gene expression [i.e., HNF-1
, cdx-2, and GATA-4 (8, 31)], similar to those that demonstrate the importance of p38 kinase in cdx-2-mediated gene transcription (25), will be necessary to clarify this issue.
| ACKNOWLEDGMENTS |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-54111 (to J. C. Fleet). The Center for Medical Genomics at Indiana University School of Medicine is supported in part by a grant from the Indiana 21st Century Research and Technology Fund (to H. J. Edenberg) and by the Indiana Genomics Initiative. The Indiana Genomics Initiative of Indiana University is supported in part by the Lilly Endowment.
| FOOTNOTES |
|---|
Address for reprint requests and other correspondence: J. C. Fleet, 1264 Stone Hall, Purdue Univ., West Lafayette, IN 47907 (E-mail: fleetj{at}cfs.purdue.edu).
10.1152/physiolgenomics.00152.2002.
| References |
|---|
|
|
|---|
B-dependent pathway. Gastroenterology 123: 11631178, 2002.[Web of Science][Medline]
. Am J Physiol Gastrointest Liver Physiol 281: G69G84, 2001.This article has been cited by other articles:
![]() |
M.-L. Wang, S. A. Keilbaugh, T. Cash-Mason, X. C. He, L. Li, and G. D. Wu Immune-mediated signaling in intestinal goblet cells via PI3-kinase- and AKT-dependent pathways Am J Physiol Gastrointest Liver Physiol, November 1, 2008; 295(5): G1122 - G1130. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. V. Graham, F. Wang, D. R. Clayburgh, J. X. Cheng, B. Yoon, Y. Wang, A. Lin, and J. R. Turner Tumor Necrosis Factor-induced Long Myosin Light Chain Kinase Transcription Is Regulated by Differentiation-dependent Signaling Events: CHARACTERIZATION OF THE HUMAN LONG MYOSIN LIGHT CHAIN KINASE PROMOTER J. Biol. Chem., September 8, 2006; 281(36): 26205 - 26215. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |