|
|
||||||||
1 Department of Medicine and Physiology, University of Wisconsin, Madison, Wisconsin 53792
2 Departments of Internal Medicine, Pediatrics, and Molecular Pharmacology, Mayo Clinic, Rochester, Minnesota 55905
| ABSTRACT |
|---|
|
|
|---|
-subunit of the ion channel that carries Na current in human heart. From a human cardiac cDNA library we recloned SCN5A. The new clone hH1b differed from existing clones hH1 in four and from hH1a in three positions. The common polymorphism H558R was uniquely present in hH1b. Voltage clamp study showed minor but potentially important kinetic differences between hH1b and the other clones. More dramatically, when the LQT3 mutation M1766L was introduced into the different clones, Na current was markedly reduced in the hH1 and hH1a backgrounds, whereas in hH1b the Na current was not reduced. Immunocytochemistry experiments showed a trafficking defect for M1766L Na channels in hH1 and hH1a but not in hH1b. The double-mutation M1766L/H558R in the hH1a background restored normal trafficking and current including persistent late current, suggesting the disease phenotype was the result of a "double hit" that included the common polymorphism, H558R. These results show that the choice of background clone must be carefully considered in mutagenesis studies. This also represents an example of intragenic complementation, the first for such a large protein. ion channels; trafficking defect; polymorphisms; LQT3; intragenic complementation
| INTRODUCTION |
|---|
|
|
|---|
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
3 kb of 5' Nav1.5 gene, and 5'CACCCCCGGGGATCCAGAGC 3' and 5' TTCAGTGTGTCCTGGCCAG 3' were used to clone
3 kb of the 3'. Human cardiac mRNA (Clontech, Palo Alto, CA), RETRscript (Ambion, Austin, TX), and pfu DNA polymerase were used to perform RT-PCR. A reverse transcription protocol reaction was performed according to the manufacturers recommended procedure. PCR thermocyling involved one cycle of denaturation at 94°C for 1 min, then 35 cycles of amplification at 94°C for 1 min, 50°C for 1 min, and 72°C for 8 min, at end of one cycle of extension at 72°C for 20 min. The PCR products were cloned into pCR-BluntII-TOPO vector (Invitrogen, Carlsbad, CA). The PCR products were sequenced with thermostable polymerases and fluorescently labeled dideoxy terminators. The sequencing reaction samples were analyzed with automated DNA sequencers (ABI models 377XL and 377-96) at the Biotech Center of the University of Wisconsin. The sequence has been submitted to GenBank (accession no. AF482988). The complete clone was pulled out in two overlapping pieces and was sequenced completely three times for verification. PCR cloning differs from the usual method of creating a cDNA library. No claim is made that the clone obtained by this method is more accurate than the previous clones, only that it is a third independent clone.
Gene expression and mutagenesis.
The Nav1.5 clones, hH1 [kindly provided by Dr. Al George (8), GenBank accession no. M77235] in prcCMV (Invitrogen) and hH1a [kindly provided by Dr. H. Hartmann (10)] and hH1b in pcDNA3 (Invitrogen), were expressed in HEK293 cells. The amino acid numbering follows that of the original hH1 clone comprising 2,016 amino acids. The transfections were performed with Superfect (Qiagen, Valencia, CA) according to the manufacturers recommended protocol. A GFP protein was cotransfected (at 1:10) as a marker to identify the transfected cells. HEK293 cells were harvested 24 h after transfection to measure macroscopic current. HEK293 cells were cultured as previous described (13). Mutations were generated using an Excite mutagenesis kit (Stratagene, La Jolla, CA). The method for mutagenesis was based on the manufacturers suggested protocol. The M1766L mutation was created with 5' TTC CTC ATC GTG GTT AAC CTG TAC ATT GCC ATC 3' and 5' GGA GAT GAT GAT GTA GGT GG 3' primers. The histamine-to-arginine substitution at position 558 was generated with 5' C GAG AGC CAC CGC GCA TCA CTG CTG 3' and 5' CT CTC CCC CGC TGT GCT GTT TTC 3' primers. DNA was isolated and purified with the Qiagen column and protocol. After mutagenesis the clone was resequenced to verify that the mutation was made as designed.
Immunocytochemistry.
The FLAG epitope was introduced between S1 and S2 in domain I (DI) for the immunocytochemistry experiments. Transfected and nontransfected HEK293 cells were fixed with 4% paraformaldehyde at room temperature for 20 min. The fixed cells were blocked with 5% goat serum and 0.2% Triton PBS solution at room temperature for 30 min. After the blocking procedure, the cells were incubated with the mouse anti-FLAG M2 primary antibody (Stratagene) at the ratio of 1:2,000 overnight at 4°C. On the next day, the cells were washed with PBS before 1:100 fluorescein-conjugated goat anti-mouse antibody (Jackson, West Grove, PA) was applied as the secondary antibody and allowed to react for 1 h at room temperature in the dark. The cells were washed with PBS solution and fixed with a solution containing 90% glycerol and 10% sodium bicarbonate. A Bio-Rad MRC 1024 laser scanning system with 15 mW mixed gas (krypton/argon) laser was utilized to view immunofluorescent labeled cell. The Bio-Rad MRC 1024 system was mounted on a Nikon Diaphot 200 inverted microscope. Images of the fluorescent-labeled cells were scanned under a x40 objective with normal speed, x2 zoom. The confocal system was set to 3.6 for iris, laser power at 100%, and camera sensitivity gain to 900. A Kalman collection filter with 5 frames per image was applied to record the image.
Voltage clamp techniques.
Details of the whole cell patch-clamp technique to measure macroscopic INa including late INa have been previously published (13). The bath (extracellular) solution contained (in mM) 140 NaCl, 4 KCl, 1.8 CaCl2, 0.75 MgCl2, and 5 HEPES (pH 7.4 set with NaOH). The pipette (intracellular) solution contained (in mM) 120 CsF, 15 CsCl, 2 EGTA, 5 HEPES, and 5 NaCl (pH 7.4 with CsOH). Data was recorded at room temperature using pCLAMP 8 (Axon Instruments Foster City, CA). Voltage clamp protocols are presented with the data.
Data analysis.
Peak INa and late INa were obtained after passive leak subtraction as described previously (13). Activation and inactivation data were fitted to a standard Boltzmann equation using Clampfit 8 (Axon Instrument) and recovery and decay data to a two-exponential equation. The equations used are the same as Nagatomo et al. (13). Goodness of fit was determined both visually and by a sum of squares errors. One-way ANOVA was performed to determine statistical significance among three or more groups of mean data. Statistical significance was determined by P < 0.05.
| RESULTS |
|---|
|
|
|---|
|
|
Kinetic studies of three hNav1.5 clones.
The INa kinetics for hH1 (8) and hH1a (10) from separate studies in the literature showed only minor differences that could be attributed to different expression systems and study techniques including solutions, temperature, and protocols. Subtle differences in kinetics such as decay rates, inactivation midpoints, and late INa, however, may be important in controlling repolarization. We studied these three clones concurrently (on the same day) under identical conditions in the same experimental patch-clamp setup. The three clones generally showed similar current time courses (Fig. 2A). Summary data for activation, steady-state inactivation, and recovery (Fig. 2B and Table 2) showed minor differences. Although not identical, the parameters were only statistically different for the midpoint of inactivation for hH1 (-95 mV) vs. hH1a (-86 mV). Late INa measured at 240 ms after the start of the depolarization was no different among the three clones (data not show).
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
-subunit designated hH1b. Amino acid sequences for the three clones hH1, hH1a, and hH1b, together with the sequence from the Celera database, differ in up to five amino acid positions (Table 1). A difference found only in the hH1b clone, R558 rather than H558, is also a previously reported amino acid polymorphism (11) with
2030% of white humans heterozygous for H558R in a population study (17). A separate analysis of healthy subjects indicates that
3040% of individuals are heterozygous for H558R with no significant difference in the allelic frequency between whites and blacks (M. J. Ackerman, unpublished data). It should be noted that the term mutation refers to any heritable or spontaneous germ line (sporadic) change in DNA sequence. The term common polymorphism refers to sequence variations occurring among populations of individuals of the same or different ethnicities with a certain allelic frequency (usually >1%) that may underlie differences in health. Clinicians and physiologists also use the term polymorphism to denote a mutation occurring with some frequency in the population that does not cause overt disease or protein dysfunction (11, 15), which is also called a nonpathogenic mutation (15). Another difference found only in hH1a, A559 rather than T559, is not a known polymorphism; that is, no population studies have been done. A third difference found only in hH1b, I618 rather than L618, is also not a known polymorphism, but the conservative change of a leucine to an isoleucine is a known high-frequency spontaneous change. The fourth and fifth differences (Q1027 and Q1077) are both found only in hH1 and are not known to be polymorphisms. The latter, the insertion of Q at 1077 in hH1, occurs at an intron-exon boundary and could represent alternative splicing. Aside from the known polymorphism at position 558, the Celera sequence agrees with the "majority" and differs from hH1 at two positions (1027 and 1077), from hH1a at one position (559), and from hH1b at one position (619). These differences may be cloning errors, or they may be actual polymorphisms. Further population studies are needed to make this determination and to more definitively determine the "correct" sequence for Nav1.5.
We have shown that the three clones have very similar but not identical kinetic function (Table 2 and Fig. 2). The midpoint of inactivation was significantly more negative for hH1 (-95 mV) than it was for hH1a (-86 mV), with hH1b being in the middle (-90 mV) and not significantly different from either one within the limitations of this study. This difference has possible significance, because with the lack of difference in activation midpoint, the more positive the inactivation relationship, the more "window" current. Window current has been implicated in the control of repolarization for SCN5A mutants (1). Relatively subtle differences in the early rate of decay of INa current may also play a role in determining repolarization by effects on other currents and the early plateau time course (6, 16). Here caution is urged in interpretation of the voltage clamp data, as decay rates are exquisitely sensitive to voltage control problems. In our analysis, however, decay experiments were selected to have low and similar current densities with activation slopes >5.5. We conclude that the kinetic profiles are very similar but that subtle differences in the wild-type clones may be important for predisposition to arrhythmia. The differences in these channels, should they prove to be polymorphisms in the population, may be candidates for predisposition to acquired repolarization abnormalities.
The most dramatic difference between the three clones, however, is the rescue of the expression defect for M1766L when expressed in the hH1b background (Fig. 3) compared with hH1 and hH1a. The known polymorphism H558R and the variation L618I are the only differences between hH1 or hH1a compared with hH1b (Table 1). The double mutation experiments provide strong evidence that amino acid at position 558 was responsible for the profound differences in trafficking and INa expression level. The term "intragenic complementation" refers to the case where a mutation at one locus in a gene interacts with a mutation at another locus to restore function of the gene product. The phenomenon has been widely reported in nature, but previous examples in humans have involved small multimeric proteins where separate alleles restored enzyme function (18). The restoration of protein function by H558R does, however, fit the original definition of intragenic complementation (7) and represents a unique example. How could amino acids located over 1,200 residues away from each other interact to restore function? Amino acids 558 and 1766 are both located intracellularly (Fig. 1) and in theory could interact where DI and DIV come together in the folded tertiary structure. In the human enzyme argininosuccinate lyase, mutations at different loci on separate monomers interact to affect the thermodynamic stability of the protein (18). Further study is required to elucidate the precise structural determinants as well as the mechanism of this restoration in hNav1.5.
We have shown that the "background" in which SCN5A mutations are expressed may impact profoundly the results of studies obtained in heterologous expression systems. The polymorphism also probably played a role in the pathogenesis of the arrhythmia syndrome in the patient presenting with M1766L (14). We had previously shown that the patient had a prolonged QT interval, and that the "mexiletine-rescued" M1766L-hH1a showed a typical late INa (14), but we were puzzled why the patient would manifest QT prolongation in the absence of mexiletine. In light of our observation that hH1b rescued M1766L expression, we reexamined the patients genomic DNA and found that in addition to the pathogenic mutation, M1766L, the patient was indeed heterozygous for the H558R polymorphism. Because the patient manifested QT prolongation, it might be assumed that one allele contained both R558 and L1766, resulting in a rescued Na current with increased late current. The functional evidence provided herein suggests a "double hit" requiring both mutations on the same allele. Unfortunately, no postmortem tissue permitting the isolation of SCN5A mRNA transcript from the decedent was available to confirm this speculation, only blood in EDTA preservative. Because of the large number of intervening base pairs we could not determine from the available genomic DNA whether or not they were on the same allele. Also, linkage analysis was not possible because the M1766L mutation was a spontaneous germ line mutation.
If the M1766L mutation were to reside on the more common H558-containing allele, then this would be predicted to cause loss of function and Brugada syndrome or conduction system disease. This could be one mechanism for the observation that some mutations can present with different clinical phenotypes in different persons (5). A "double hit" involving mutations R1232W and T1620M was previously implicated to cause a trafficking defect for the Brugada syndrome (3).
Caution must always be used in extrapolating basic studies to the clinical setting. The question of whether the expression levels and the kinetic behavior of different wild-type and mutated hNav1.5 channels in these experimental expression systems faithfully recapitulate their function in intact heart remains a common limitation. Nevertheless, our findings provide a caveat for those using heterologous expression systems that the choice of background clone is important. Also our findings suggest that the particular channel background sequence in patients may be important in defining functional properties of putative arrhythmia-causing mutations in SCN5A. The search for "modifier genes" must include the disease-causing gene itself.
| ACKNOWLEDGMENTS |
|---|
This study was supported by an American Heart Association Northland Affiliate Predoctoral Fellowship (to B. Ye), a Doris Duke Clinical Scientist Development Award and a Mayo Foundation Clinical Research Award (to M. J. Ackerman), and by National Heart, Lung, and Blood Institute Grant HL-66378 (to J. C. Makielski).
| FOOTNOTES |
|---|
Address for reprint requests and other correspondence: J. C. Makielski, Dept. of Medicine, Univ. of Wisconsin, 600 Highland Ave H6/349, Madison, WI 53792 (E-mail: jcm{at}medicine.wisc.edu).
10.1152/physiolgenomics.00117.2002.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. Cheng, D. W. Van Norstrand, A. Medeiros-Domingo, C. Valdivia, B.-h. Tan, B. Ye, S. Kroboth, M. Vatta, D. J. Tester, C. T. January, et al. {alpha}1-Syntrophin Mutations Identified in Sudden Infant Death Syndrome Cause an Increase in Late Cardiac Sodium Current Circ Arrhythm Electrophysiol, December 1, 2009; 2(6): 667 - 676. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Ye and J. M. Nerbonne Proteolytic Processing of HCN2 and Co-assembly with HCN4 in the Generation of Cardiac Pacemaker Channels J. Biol. Chem., September 18, 2009; 284(38): 25553 - 25559. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Lowe, O. Palygin, N. Bhasin, T. J. Hund, P. A. Boyden, E. Shibata, M. E. Anderson, and P. J. Mohler Voltage-gated Nav channel targeting in the heart requires an ankyrin-G dependent cellular pathway J. Cell Biol., January 10, 2008; 180(1): 173 - 186. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Albert, E. G. Nam, E. B. Rimm, H. W. Jin, R. J. Hajjar, D. J. Hunter, C. A. MacRae, and P. T. Ellinor Cardiac Sodium Channel Gene Variants and Sudden Cardiac Death in Women Circulation, January 1, 2008; 117(1): 16 - 23. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-H. Tan, P. Iturralde-Torres, A. Medeiros-Domingo, S. Nava, D. J. Tester, C. R. Valdivia, T. Tusie-Luna, M. J. Ackerman, and J. C. Makielski A novel C-terminal truncation SCN5A mutation from a patient with sick sinus syndrome, conduction disorder and ventricular tachycardia Cardiovasc Res, December 1, 2007; 76(3): 409 - 417. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Lehnart, M. J. Ackerman, D. W. Benson Jr, R. Brugada, C. E. Clancy, J. K. Donahue, A. L. George Jr, A. O. Grant, S. C. Groft, C. T. January, et al. Inherited Arrhythmias: A National Heart, Lung, and Blood Institute and Office of Rare Diseases Workshop Consensus Report About the Diagnosis, Phenotyping, Molecular Mechanisms, and Therapeutic Approaches for Primary Cardiomyopathies of Gene Mutations Affecting Ion Channel Function Circulation, November 13, 2007; 116(20): 2325 - 2345. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Medeiros-Domingo, T. Kaku, D. J. Tester, P. Iturralde-Torres, A. Itty, B. Ye, C. Valdivia, K. Ueda, S. Canizales-Quinteros, M. T. Tusie-Luna, et al. SCN4B-Encoded Sodium Channel 4 Subunit in Congenital Long-QT Syndrome Circulation, July 10, 2007; 116(2): 134 - 142. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Wang, R. R. Desai, L. Crotti, M. Arnestad, R. Insolia, M. Pedrazzini, C. Ferrandi, A. Vege, T. Rognum, P. J. Schwartz, et al. Cardiac Sodium Channel Dysfunction in Sudden Infant Death Syndrome Circulation, January 23, 2007; 115(3): 368 - 376. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Arnestad, L. Crotti, T. O. Rognum, R. Insolia, M. Pedrazzini, C. Ferrandi, A. Vege, D. W. Wang, T. E. Rhodes, A. L. George Jr, et al. Prevalence of Long-QT Syndrome Gene Variants in Sudden Infant Death Syndrome Circulation, January 23, 2007; 115(3): 361 - 367. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Schulze-Bahr Arrhythmia Predisposition: Between Rare Disease Paradigms and Common Ion Channel Gene Variants J. Am. Coll. Cardiol., October 27, 2006; 48(9_Suppl_A): A67 - A78. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-H. Tan, C. R. Valdivia, C. Song, and J. C. Makielski Partial expression defect for the SCN5A missense mutation G1406R depends on splice variant background Q1077 and rescue by mexiletine Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1822 - H1828. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Poelzing, C. Forleo, M. Samodell, L. Dudash, S. Sorrentino, M. Anaclerio, R. Troccoli, M. Iacoviello, R. Romito, P. Guida, et al. SCN5A Polymorphism Restores Trafficking of a Brugada Syndrome Mutation on a Separate Gene Circulation, August 1, 2006; 114(5): 368 - 376. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Bunch and M. J. Ackerman Promoting Arrhythmia Susceptibility Circulation, January 24, 2006; 113(3): 330 - 332. [Full Text] [PDF] |
||||
![]() |
K. Liu, T. Yang, P. C. Viswanathan, and D. M. Roden New Mechanism Contributing to Drug-Induced Arrhythmia: Rescue of a Misprocessed LQT3 Mutant Circulation, November 22, 2005; 112(21): 3239 - 3246. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kaab and E. Schulze-Bahr Susceptibility genes and modifiers for cardiac arrhythmias Cardiovasc Res, August 15, 2005; 67(3): 397 - 413. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-f. Wu, E. Gordon, E. P. Hoffman, and S. C. Cannon A C-terminal skeletal muscle sodium channel mutation associated with myotonia disrupts fast inactivation J. Physiol., June 1, 2005; 565(2): 371 - 380. [Abstract] [Full Text] [PDF] |
||||
![]() |
H W Hwang, J J Chen, Y J Lin, R C Shieh, M T Lee, S I Hung, J Y Wu, Y T Chen, D M Niu, and B T Hwang R1193Q of SCN5A, a Brugada and long QT mutation, is a common polymorphism in Han Chinese J. Med. Genet., February 1, 2005; 42(2): e7 - e7. [Full Text] [PDF] |
||||
![]() |
B. P. Delisle, B. D. Anson, S. Rajamani, and C. T. January Biology of Cardiac Arrhythmias: Ion Channel Protein Trafficking Circ. Res., June 11, 2004; 94(11): 1418 - 1428. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. C. H. Kerr, F. E. Holmes, and D. Wynick Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat J. Biol. Chem., June 4, 2004; 279(23): 24826 - 24833. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q Wang, S Chen, Q Chen, X Wan, J Shen, G A Hoeltge, A A Timur, M T Keating, and G E Kirsch The common SCN5A mutation R1193Q causes LQTS-type electrophysiological alterations of the cardiac sodium channel J. Med. Genet., May 1, 2004; 41(5): e66 - e66. [Full Text] [PDF] |
||||
![]() |
C. R Valdivia, D. J Tester, B. A Rok, C.-b. J Porter, T. M Munger, A. Jahangir, J. C Makielski, and M. J Ackerman A trafficking defective, Brugada syndrome-causing SCN5A mutation rescued by drugs Cardiovasc Res, April 1, 2004; 62(1): 53 - 62. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Priori Inherited Arrhythmogenic Diseases: The Complexity Beyond Monogenic Disorders Circ. Res., February 6, 2004; 94(2): 140 - 145. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Makielski, B. Ye, C. R. Valdivia, M. D. Pagel, J. Pu, D. J. Tester, and M. J. Ackerman A Ubiquitous Splice Variant and a Common Polymorphism Affect Heterologous Expression of Recombinant Human SCN5A Heart Sodium Channels Circ. Res., October 31, 2003; 93(9): 821 - 828. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |