Physiol. Genomics Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 11: 53-63, 2002. First published August 27, 2002; doi:10.1152/physiolgenomics.00108.2001
1094-8341/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
11/2/53    most recent
00108.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Agca, C.
Right arrow Articles by Donkin, S. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Agca, C.
Right arrow Articles by Donkin, S. S.
Received 13 November 2001; accepted in final form 23 August 2002.
Physiological Genomics 11:53-63 (2002)
1094-8341/02 $5.00 © 2002 American Physiological Society

Cloning and characterization of bovine cytosolic and mitochondrial PEPCK during transition to lactation

Cansu Agca , Randall B. Greenfield , Jennifer R. Hartwell and Shawn S. Donkin

Department of Animal Sciences, Purdue University, West Lafayette, Indiana 47906


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 References
 
The cytosolic (C) and mitochondrial (M) forms of phosphoenolpyruvate carboxykinase (PEPCK; EC 4.1.1.32) are encoded by two different nuclear genes in mouse, human, and chicken. Our objective was to clone the two forms of PEPCK for bovine and determine their expression during the immediate periparturient interval in dairy cows. Bovine PEPCK-C cDNA contains 2,592 nucleotides and contains 84% similarity to the coding sequence of human PEPCK-C cDNA. A 449-nt partial clone of the 3' end of PEPCK-M is 76% similar to the corresponding sequence of human PEPCK-M. The coding sequence of bovine PEPCK-C and coding sequence of the partial PEPCK-M clone were 58% similar but the similarities in the 3'-untranslated regions were negligible. Northern blot analysis revealed single transcripts of 2.85 and 2.35 kb for PEPCK-C and PEPCK-M, respectively. The transition to lactation did not alter PEPCK-M transcript expression, but expression of PEPCK-C mRNA was transiently increased during early lactation, indicating that enhanced hepatic gluconeogenesis during this period may be tied to enhanced capacity for cytosolic rather than mitochondrial formation of phosphoenolpyruvate.

gene expression; parturition


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 References
 
PHOSPHOENOLPYRUVATE CARBOXYKINASE (PEPCK) is a pace-setting enzyme in gluconeogenesis that catalyzes the formation of phosphoenolpyruvate from oxaloacetate. Two isozymes of PEPCK are compartmentalized to the mitochondria (PEPCK-M) and cytosol (PEPCK-C), and the relative activity within each cellular compartment differs across species (13). These isozymes have similar kinetic properties but are encoded by separate nuclear genes in all species studied to date (15).

Approximately equal activities of PEPCK-M and PEPCK-C are present in ruminant liver (13, 31). The activity of PEPCK-C is determined by the rate of transcription of the PEPCK-C gene and rate of turnover of its mRNA (15). The activity of PEPCK-M in liver appears to be constitutive in adult animals (15) but is developmentally regulated in avians (29). Specific induction of PEPCK-M in mammary tissue during the transition to lactation has been noted for guinea pig (19). Previous characterizations of PEPCK mRNA expression in bovine liver (14, 30) have utilized rat PEPCK cDNA probes and have not attempted to differentiate between expression of PEPCK isozymes.

The flux through each PEPCK isozyme and substrate preference for gluconeogenesis may be determined by the availability of NADH in cytosol (13). For example, in avian liver the absence of PEPCK-C and sole presence of PEPCK-M precludes the synthesis of glucose from pyruvate and alanine but not lactate. Metabolism of lactate generates NADH, which is then consumed in the glyceraldehyde-3-phosphate dehydrogenase reaction, whereas alanine and pyruvate metabolism do not generate a matching reducing equivalent.

In ruminants, gluconeogenesis from propionate and presumably pyruvate or alanine may not be limited by cytosolic NADH (1). In mature cows, gluconeogenesis from alanine and propionate are increased during the immediate postpartum interval (25), and increased expression of pyruvate carboxylase during the transition to lactation is consistent with increased potential for alanine metabolism (14). Propionate metabolism is not directly dependent on pyruvate carboxylase, but at least 60% of propionate flux to glucose is dependent on PEPCK-M (1). Increased gluconeogenesis from pyruvate, alanine, or propionate in response to the onset of calving may result from increased channeling of these precursors to glucose but relies on adequate total PEPCK activity to accommodate increased substrate metabolism. Previous analyses of changes in PEPCK mRNA indicate a lack of effect of dietary protein on PEPCK mRNA (14, 16); however, these analyses do not distinguish between the different PEPCK mRNA transcripts. The primary objectives of the present work were to clone the cDNAs for the isozymes of bovine PEPCK, to differentiate expression of their respective mRNA, and determine changes in the abundance of their mRNA transcripts in liver of dairy cows during the transition to lactation.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 References
 
Liver biopsy, total RNA isolation, and cDNA cloning.
Liver samples were obtained from Holstein cows using a needle biopsy procedure (14) and frozen in tubes containing 4 M guanidinium thiocyanate, 25 mM sodium citrate (pH 7.4), 0.5% sarcosyl, and 0.1 M ß-mercaptoethanol until RNA isolation. Samples were homogenized, and total RNA was isolated using the phenol:chloroform:isoamyl alcohol extraction method (10). Liver samples obtained from cows fed a prepartum diet that contained 11.8% crude protein, 26.7% rumen undegradable protein (percentage of crude protein), 1.50 Mcal net energy of lactation/kg dry matter (14) were used as a source of RNA for PCR cloning and in developing the PEPCK-M and PEPCK-C cDNA probes. Characterization of binding of the PEPCK cDNA variants to bovine mRNA was determined using total liver RNA samples from a different set of cows (16). Expression of PEPCK-M and PEPCK-C mRNA was determined for cows fed the low-protein (14.1% crude protein, 29% rumen undegradable protein, 1.62 net energy of lactation/kg dry matter) and high-protein (16.2% crude protein, 39% rumen undegradable protein, 1.65 net energy of lactation/kg dry matter) control diets lacking rumen-protected choline (16). Management practices, diets, prepartum feed intake, subsequent milk production, and blood metabolites for cows used to obtain both sets of samples have been described previously (14, 16). Animal handling and sample collection procedures were approved by the Purdue Animal Care and Use Committee.

Total RNA was reverse transcribed using Superscript II reverse transcriptase (Life Technologies, Grand Island, NY) at 42°C for 1 h. Random hexamers or oligo(dT) were used as primers for first-strand cDNA synthesis. The reverse transcription (RT) reaction product was used in subsequent PCR reactions. Primers (Integrated DNA Technologies, Coralville, IA) corresponding to regions of identity between human (GenBank accession no. L05144), rat (GenBank accession no. AH007109), and mouse (GenBank accession no. AF009605) PEPCK-C were used for PCR cloning of bovine PEPCK-C cDNA. Each primer for RT-PCR and 3' rapid amplification of cDNA ends (RACE) contained a BamHI restriction enzyme site (Table 1). A SalI restriction site was added to the primer for 5'-RACE to facilitate ligation to pGEM 3Z cloning vector (Promega, Madison, WI). Primer pairs used to generate each clone are shown in Table 1.


View this table:
[in this window]
[in a new window]
 
Table 1. Primers used to generate PEPCK-C clones

 
High Fidelity Platinum Taq (Life Technologies, Grand Island, NY) was used for the PCR reactions. The conditions of the PCR reactions were: 3 min at 95°C, initial denaturation; 35 cycles of 45 s at 94°C, denaturation; 45 s at 50–55°C, annealing; 60 s at 72°C, extension; and 7 min at 72°C, final extension. The cDNA generated by PCR was digested with the appropriate restriction enzyme (BamHI or SalI) and ligated using T4 ligase (Life Technologies) into pGEM 3Z plasmid (Promega) and transfected to E. coli. The resulting plasmid preparations were purified using Wizard Plus SV DNA purification system (Promega). At least two different cDNA clones from two different PCR reactions for each section amplified were sequenced at the High Definition Sequencing Center at Purdue University using a Pharmacia ALFExpress DNA sequencer (Pharmacia Biotech, Piscataway, NJ).

Clone bPEPCK-C400–1 was used to design three gene-specific primers (GSP) for use in 5'-RACE to clone the 5' end of bovine PEPCK-C. The GSP I (CATGCTGAACGGGATGACAATAC) annealed to 555–576 bases in coding sequence, GSP II (GGAAATCGGATGTTGAATGCTT) annealed to 509–530 bases in coding sequence, and GSP III (AAGTCGACCGTATCTCTTTGCTCTCG) annealed to 427–446 bases in the coding sequence (Table 1). The GSP I was used in RT reaction to generate first-strand cDNA. Template RNA was digested using RNase H and T1 (Life Technologies). Nucleotides and primers were removed by GlassMAX DNA isolation spin cartridge system (Life Technologies). Subsequent to addition of deoxycytosine (C) residues to the 3' end of the first-strand cDNA by terminal deoxynucleotidyl transferase (Life Technologies), the C-tailed cDNA and primers GSP II and 5'-RACE anchor primer [(CUA)4GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG; Life Technologies] were used for hot start PCR, which was initiated by the addition of C-tailed cDNA at 75°C. The GSP III (Table 1), containing a SalI site and Universal amplification primer CUACUACUACUAGGCCACGCGTCGACTAGTAC (Life Technologies) were used for nested hot start PCR in which cDNA was added to the reaction at 75°C. The PCR conditions, cloning of PCR products and DNA sequencing were as described above.

The 3'-RACE protocol was used for amplification of 3' end of the bovine PEPCK-C cDNA. An oligo(dT) primer with the 5' addition of tandem EcoRI and BamHI sites was used to synthesize the first-strand cDNA. The forward primer (CAGGATCCTTAGCTARAATGCACA) corresponding to the sequence for PEPCK-C from bases 2301–2326 with an added 5' BamHI site was used for the initial PCR reaction followed by semi-nested PCR using oligo(dT) primer containing the 5' addition of tandem EcoRI and BamHI sites and the nested primer (CAGGATCCAAAASATACTTGAGCTG). The PCR conditions and cloning of PCR products and sequencing were as described above.

The cloning of PEPCK-M cDNA was similar to the 3' end cloning of PEPCK-C. The primers PEPCK-M1 (AAGGATCCTTCCTGTGGCCAGGCT) and the nested primer PEPCK-M2 (AAAGGATCCGTGCTAGACTGGATCTG) were used for semi-nested PCR. These were deduced from regions of similarity for human (NM-004563) and mouse (AA044561) PEPCK-M sequences obtained from GenBank.

Sequence data analysis.
The similarities of the clones to the other PEPCK-C and PEPCK-M cDNA clones were determined at GeneStream II Network Servers for Biology (http://xylian.igh.cnrs.fr/) using Align software (Version 2.0) (26). The Expert Protein Analysis System Translate software at the Swiss Institute of Bioinformatics (http://expasy.cbr.nrc.ca/tools/dna.html) was used to determine the amino acid sequence based on the nucleotide sequence (3). Basic Local Alignment Search Tool (BLAST 2.1) (2) was conducted through the National Center for Biotechnology Information web site (http://www.ncbi.nlm.nih.gov/BLAST).

Northern blot hybridization.
Liver biopsy samples were obtained at -28, -14, +1, +28, and +56 days relative to calving from 10 Holstein cows as described previously (16). Total RNA was extracted from biopsy samples, and 20 µg was separated by electrophoresis through a 1% agarose gel and transferred to GeneScreen membrane (NEN Life Science Products, Boston, MA) and prehybridized as previously described (11).

The cDNA probe for PEPCK-C corresponded to the clone bPEPCK-C3' (Table 1). The cDNA probe for PEPCK-M (bPEPCK-M3') was generated by digestion of bPEPCK-M (Fig. 3) at an internal HindII site, which eliminated a region of similarity between PEPCK-C and PEPCK-M (Fig. 3A). The respective cDNA inserts were excised from plasmids by restriction enzyme digestion and separated by low-melting temperature agarose gel electrophoresis and purified. The 32P-labeled cDNA probes were prepared using [{gamma}-32P]dCTP and the Ready-to-Go DNA labeling beads dCTP random oligonucleotide priming kit (Pharmacia) to a specific activity of ~109 cpm/µg DNA. Membranes were probed sequentially (11) for PEPCK-C, PEPCK-M, and 18S rRNA (14). Membranes were exposed to Kodak X-Omat film for 1–3 days at -80°C. The removal of labeled probes from membranes was verified using a Geiger counter and lack of signal upon exposure to Kodak X-Omat film. Abundance of mRNA for each transcript was quantified from digital scans of autoradiographic images using Kodak Digital Science 1D Image Analysis software (Eastman Kodak, Rochester, NY). The size of the transcripts was determined by the migration distance relative to RNA standards using Kodak Digital Science 1D Image Analysis software (Eastman Kodak)



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 3. Alignment of the coding region (A) and of the 3'-UTR (B) of bovine partial PEPCK-M cDNA and bPEPCK-C3' sequence. The stop codons for PEPCK-M and PEPCK-C 3' clones (A, boxed sequences) were aligned, and sequences were compared for similarity. The coding sequences of PEPCK-M and PEPCK-C clones are 57.5% similar. A region of PEPCK-M was removed 5' to an internal HindII site (denoted by the underscored sequence), and the remaining PEPCK-M3' sequence (top line, B) was subcloned and used in Northern blot analysis. The PEPCK-M3' clone lacks similarity to PEPCK-C3' including the terminal 40 bases of coding sequence and 3'-UTR (B). UTR, untranslated region; PEPCK-M, mitochondrial form of PEPCK.

 
Quantification of PEPCK-M and PEPCK-C mRNA.
To quantify the amount of PEPCK-C and PEPCK-M mRNA, we prepared sense cRNA standards from bPEPCK-C3' and bPEPCK-M3' plasmids, using the in vitro Maxiscript RNA kit (Ambion, Austin, TX). Plasmid template was removed by DNase I digestion, and each cRNA was purified separately using MicroSpin G-25 columns (Amersham Pharmacia Biotech). The quantity of RNA was determined by the absorbance of light at 260 nm, and cRNA standards for PEPCK-C and PEPCK-M were prepared separately by serial dilution of the stock sense RNA solutions.

Twenty micrograms of total RNA from five cows, collected 28 days prior to and 28 days after calving, was separated through a 1% agarose. Approximately 15 min before the completion of separation, the power supply was switched off, then cRNA standards were added to the wells of the agarose gel, and electrophoresis was resumed. After completion of the separation, nucleotides were transferred to GeneScreen membrane (NEN Life Science Products). The membrane was sequentially hybridized with 32P-labeled bPEPCK-M3' and bPEPCK-C3' probes as described above.

The intensity of binding of the labeled probes to bPEPCK-C3' and bPEPCK-M3' cRNA standards was determined using Kodak Digital Science 1D Image Analysis software (Eastman Kodak). Each set of standards was run in triplicate, and density of signal from the autoradiogram analysis was used to generate prediction equations for PEPCK-C and PEPCK-M mRNA in the samples. Because the lengths of the cRNA standards were considerably shorter than the sample mRNA, the cRNA standards were corrected for the number of deoxycytosine residues in the mRNA relative to the number in cRNA. Bovine PEPCK-C mRNA contains 709 C, and the cRNA standard contains 41 C, therefore a factor of 17.3 (706/41) was used to correct the difference of length between the probe and the mRNA. Because the full-length sequence of bovine PEPCK-M is not known, the adjustment was approximated based on sequence information for human PEPCK-M. Human PEPCK-M mRNA contains 624 C and bPEPCK-M contains 74 C; therefore, a factor of 8.4 (624/74) was used to correct for the length difference of the cRNA standards and sample mRNA. The prediction equations were PEPCK-C (pg) = 11.07 x e0.00007(I) and PEPCK-M (pg) = 2.5899 x e0.00007(I), where I is the intensity of PEPCK mRNA in the sample. The equations for PEPCK-C and PEPCK-M fit the standards’ data with coefficients of correlation of 0.93 and 0.88, respectively. The membrane was also probed for 18S rRNA, and differences in loading and transfer of RNA among samples were adjusted by normalizing the PEPCK-M and PEPCK-C data to the overall mean intensity of the 18S signal.

Southern blot hybridization.
Genomic DNA from liver was isolated using a genomic DNA isolation kit (Promega, Madison, WI). Bovine genomic DNA (20 µg) was digested separately with 200 U of EcoRI, BamHI, HindIII, and the combination of EcoRI and BamHI for 16 h. Samples were separated through a 0.8% agarose gel at 1.5 V/cm overnight and transferred to GeneScreen membrane (NEN Life Science Products). Membranes were prehybridized for 8 h in 10% dextran sulfate, 1% SDS, and 6x SSC (1x SSC is 0.15 M sodium chloride, 0.015 M sodium citrate, pH 7) and hybridized overnight with bPEPCK-M3' or bPEPCK-C3' cDNA probes. After hybridization, the membranes were washed with 1% SDS and 2x SSC for 15 min at room temperature and 0.1% SDS and 0.1x SSC for 30 min at 65°C and exposed to Kodak X-Omat film for 3 days.

Assay for PEPCK activity.
A subset of samples from cows fed a 14.1% protein diet (16) were used to determine the relationship between PEPCK enzyme activity and PEPCK transcript abundance. Liver biopsy samples (~0.5 g) were rinsed in saline and immediately frozen in liquid nitrogen and stored at -80°C until further analysis of PEPCK activity. Samples were rapidly thawed, blotted dry, and weighed, and crude tissue extracts were prepared by homogenizing in three volumes of ice-cold 0.1 M sucrose, 50 mM potassium phosphate (pH 7.4), and 0.25 mM EDTA (pH 7.4) using a Tissuemizer (Tekmar, Cincinnati, OH). Samples were then sonicated with a probe sonicator (Ultrasonics, Plainview, NY) for 10 s to disrupt mitochondria. The homogenate was kept on ice at all times. Samples obtained from three cows at -28, -14, +1, +28, and +56 days relative to calving were analyzed for PEPCK activity as described by Ballard and Hanson (5) with the addition of NADH and malate dehydrogenase to ensure the conversion of oxaloacetate to malate (4). Reactions and were terminated after 10 min by the addition of 0.25 ml of 10% trichloroacetic acid. Preliminary tests indicated linearity of the assay during this interval. Tubes were centrifuged to remove protein, and an aliquot of the clear supernatant was removed, spotted on a filter paper disk, and placed in an enclosed chamber and purged with CO2 and dried to displace any free 14CO2. Radioactivity remaining in the dried filters was determined by liquid scintillation counting. Protein content of the homogenate was determined using the Pierce BCA protein assay. One unit of PEPCK activity corresponds to the incorporation of 1 µmol of 14CO2 into product per milligram protein per minute.

Statistical analysis.
Data were analyzed as a randomized block design using the GLM procedure of SAS (28). The model accounted for effects of treatment (prepartum dietary protein), cow within treatment, day relative to calving, and treatment by day relative to calving. There were no effects of prepartum diets on PEPCK mRNA; therefore, only the effect of day relative to calving is reported. Effects of day relative to calving and treatment by day relative to calving were analyzed using the residual error as the F-statistic denominator. Values are reported as means with associated standard errors. Means were considered different if P < 0.05. Pearson correlation coefficients were obtained using the PROC CORR procedure of SAS (28).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 References
 
Bovine PEPCK-C cDNA clones.
Six overlapping PEPCK-C cDNA clones were generated and characterized. Each of the PCR products were ligated to a plasmid vector, transfected to E. Coli XL1-B and grown on agar plates. Two separate colonies containing the clones were prepared and sequenced in forward and reverse. Size of the cDNA fragments ranged from 255 to 1,114 bp, and regions of overlap between the clones ranged from 8 to 395 bp. Sequence analysis of bovine PEPCK-C cDNA indicates the presence of a poly-A signal (AATAAA) located 15 bases from the poly-A tail.

Bovine PEPCK-C and PEPCK-M cDNA and PEPCK-C predicted amino acid sequence.
Bovine PEPCK-C cDNA consists of 2,592 bases including 138 bases of 5'-untranslated region (5'-UTR), 1,866 bases of coding sequence and 588 bases of 3'-UTR (Fig. 1). The complete PEPCK-C sequence is 77% and 75% similar to human and mouse, respectively, and the coding sequence has a minimum of 83% similarity to human, mouse, and rat. The translated sequence encodes a 622 amino acid protein that is 87% similar to human, mouse, and rat (Fig. 2) and contains 13 cysteinyl residues, as well as putative oxaloacetate, GTP, and Mg2+ binding domains characteristic of PEPCK from other species (21).



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 1. Nucleic acid and predicted amino acid sequence of the cytosolic form of bovine liver phosphoenolpyruvate carboxykinase (PEPCK-C). The underscored regions for the amino acid sequence information represent a putative oxaloacetate binding domain (residues 232–244), GTP binding domain (residues 285–291), and Mg2+ binding domain (residues 307–311). The double underscored sequence within the 3' noncoding region is the polyadenylation signal consensus sequence.

 


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 2. Amino acid sequence alignment of PEPCK-C for bovine, human, rat, and mouse. Asterisks indicate positions that are fully conserved. Colons (":") indicates strongly conserved amino acids, and periods (".") denote weakly conserved amino acid residues.

 
The sequence corresponding to a partial clone of bPEPCK-M contains 247 bases of coding region and 202 bases of 3'-UTR that are 76% similar to the corresponding human sequence. Comparison of bovine PEPCK-C and the partial sequence of PEPCK-M indicates 58% similarity for the coding sequences and negligible similarity within the 3'-UTR (Fig. 3).

Northern blot analysis relationship with total PEPCK activity and abundance of PEPCK isoforms.
Transcripts identified by Northern blotting were ~2.85 vs. 2.35 kb for PEPCK-C and PEPCK-M, respectively (Fig. 4). The relative abundance of PEPCK-C mRNA was increased (P < 0.05) moderately by 28 days postcalving but was similar to precalving levels by 56 days postcalving. The abundance of PEPCK-M was unchanged resulting in an increase (P < 0.05) in the ratio of PEPCK-C to PEPCK-M during this interval (Table 2). Quantitative Northern analysis of total RNA samples indicates an abundance of PEPCK-C and PEPCK-M mRNA that was ~24.6 ± 17.2 and 1.9 ± 0.2 pg per µg of total RNA (means and SE), respectively, at -28 days relative to calving (Fig. 5). After calving the abundance of PEPCK-C and PEPCK-M mRNA was ~59.6 ± 17.2 and 1.8 ± 0.2 pg per µg of total RNA. Although based on a limited number of samples, there was a tendency for PEPCK-C to be elevated (P = 0.18), whereas PEPCK-M was not different for the two sampling times (P = 0.77). Likewise, the ratio of PEPCK-C to PEPCK-M tended to differ (10.9 vs. 35.4; P = 0.14) for samples taken at -28 and +28 days relative to calving. The quantitative data corroborate an increase in PEPCK-C and lack of change in PEPCK-M for the precalving and postcalving comparison. These time points were chosen for quantitative analysis of PEPCK mRNA, because they represent the broadest range in relative expression for most cows based on Northern analysis (Fig. 4). The quantitative data (Fig. 5) should be interpreted with caution, however, due to the limited number of samples analyzed and the variation between individual cows for precalving and postcalving samples. Northern analysis (Fig. 4) provides an estimate of the effect of transition to calving using a greater number of cows (n = 10). The expression of PEPCK-C mRNA, determined by either method, is numerically increased approximately twofold at 28 days postcalving. However, there is considerable variation in the response of individual animals determined by Northern blots analysis such that only 6 of 10 cows display a change in PEPCK-C mRNA on day 28 relative to calving; furthermore, these changes are transient (Fig. 4).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4. Northern blot analysis of PEPCK-C (A) and PEPCK-M (B) for 10 cows. Sequential liver biopsies were obtained on the days relative to calving as indicated, and 20 µg of total RNA was successively probed with PEPCK-C3' and PEPCK-M3' cDNA. The size of molecular weight standards is indicated on the right. The probes for PEPCK-C and PEPCK-M detect single transcripts of 2.85 and 2.35 kb, respectively.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Relative abundance of PEPCK-M and PEPCK-C during the transition to calving

 


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 5. Relative abundance of bPEPCK-C and bPEPCK-M in bovine liver samples. Total RNA was collected from liver biopsy samples obtained from five cows at -28 and +28 days relative to calving. Total RNA was partially separated through 1% agarose, and known quantities of PEPCK-C and PEPCK-M cRNA were applied to the gel. The standard cRNA and samples were probed sequentially using PEPCK-C (top), PEPCK-M (middle), and 18S (bottom) cDNA.

 
The activity in bovine liver is closely correlated with PEPCK-C but not PEPCK-M mRNA, with a Pearson correlation coefficient for PEPCK-C mRNA and PEPCK activity of 0.76 (P < 0.05) (Fig. 6). There is a lack of correlation (P = 0.72) between PEPCK activity and PEPCK-M mRNA and between PEPCK-M mRNA and PEPCK-C mRNA (P = 0.37).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 6. Relationship between PEPCK-C mRNA and activity of PEPCK in bovine liver. Bovine liver samples were collected from three cows at -28, -14, +1, +28, and +56 days relative to calving and analyzed for PEPCK activity and PEPCK mRNA expression. Data points represent corresponding values for PEPCK activity and PEPCK-C ({blacksquare}) or PEPCK-M ({square}) mRNA.

 
Southern blot analysis.
The differential banding pattern obtained by Southern blot analysis of bovine genomic DNA with PEPCK-M3' and PEPCK-C3' confirmed that PEPCK-M and PEPCK-C are two separate genes (Fig. 7). Restriction enzyme digestion reveals single hybridization bands for bPEPCK-C3' of ~4, 20, 1, and 10 kb, for digestion with EcoRI, BamHI, HindIII, and the combination of EcoRI and BamHI, respectively. Bands detected for the bPEPCK-M3' probe were 12, 7, and less than 1 kb for the BamHI-digested genomic DNA. Double digestion with EcoRI and BamHI yielded intense bands at 12 and 8 kb, a minor band less than 5 kb, and two bands less than 1 kb. Single bands of 12 and 8 kb were detected using the shortened form of bPEPCK-M3' as a probe and samples digested with the EcoRI or HindIII, respectively.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 7. Southern blot analysis of bovine PEPCK-C (left) and PEPCK-M (right). Genomic DNA was isolated from liver, digested with the restriction enzymes indicated, size separated through a 0.8% agarose gel, transferred to GeneScreen membrane, and sequentially probed with bPEPCK-C3' and PEPCK-M3'. The different patterns of hybridization confirm the presence of two PEPCK genes for bovines.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 References
 
The presence of PEPCK activity in the cytosol and mitochondria is one of the important features of gluconeogenesis that permits compartmentalization of the pathway and results in the characteristic pattern of regulation and use of lactate and pyruvate. The distribution of this activity is uniquely species dependent, and most mammals display both a mitochondrial and cytosolic form of the PEPCK enzyme. Rodents express primarily PEPCK-C and both forms are found in liver of the developing chicken, yet only the mitochondrial form is found in liver from the adult chicken. There are approximately equal activities of PEPCK-M and PEPCK-C in the ruminant (13) and human (17) liver. The activity of PEPCK-C is regulated by nutritional and hormonal stimuli at the level of transcription of the PEPCK-C gene. In contrast, the activity of PEPCK-M and rate of turnover of its corresponding mRNA appear to be constitutive (15). Sequence data similarity exists between rat and bovine PEPCK-C (14). The high degree of conservation of PEPCK-C among species has led others to speculate that PEPCK-C is the more primordial form of the enzyme (33).

Control of PEPCK-C activity is largely exerted through transcription of the gene through activation of basal, tissue-specific, and hormone-dependent promoter elements within the 5' region of the PEPCK-C gene (15). Crucial liver control elements are located within -460 to +73 of the promoter. Six primary protein binding sites that contain docking sites for at least 15 separate transcription factors have been characterized by DNase I footprinting (15). The cAMP response element, CRE-I, acting synergistically with P3 and P4, is primarily responsible for the cAMP-mediated increase in PEPCK-C transcription (15). Insulin counteracts the effects of cAMP by repressing the promoter perhaps by blocking the ability of glucocorticoids to promote activity of accessory factor-2 (24). There is some indication that PEPCK-C expression may be inhibited directly by glucose, as is the case with other insulin-responsive genes. This is intriguing based on the observation that glucokinase is lacking in the ruminant liver (5) but may represent a metabolic advantage considering the continual need for gluconeogenesis in ruminants. Although the PEPCK-C gene is generally thought to be transcriptionally controlled, alternative regulation has been described for PEPCK-C mRNA stability that involves cAMP action on a 3' noncoding sequence (20). It is not surprising that the myriad of hormonal and nutritional changes that accompany the progression of lactation in dairy cows (6) induces the expression of PEPCK-C mRNA. The nutritional and hormonal factors that precipitate changes in PEPCK-C mRNA expression in other species have not been characterized for bovines. Several of these factors are confounded with the homeorhetic adaptations that comprise the onset and progression of lactation. Direct cross-species extrapolation with regard to nutritional and hormonal changes that regulate PEPCK expression must be viewed cautiously, as corresponding data that examine the direct modulation of PEPCK-C are not yet available for cattle.

The relative abundance of PEPCK mRNA isoforms indicates a potential 10-fold difference in the activities of each enzyme in favor of greater activity of PEPCK-C, provided that there is equivalent translation efficiency of both mRNA and similar stability of each enzyme. Available data for relative activities of PEPCK-M and PEPCK-C in ruminants indicates 66–76% of PEPCK activity in the cytosol of adult sheep (31), yet in fetal sheep PEPCK-M activity predominates (23). The shifts in the ratio of PEPCK-C to PEPCK-M observed during feed restriction or diabetes in mature sheep (31) and between hypoglycemic, hyperinsulinemic, and normal fetal sheep (23) are the consequence of changes in the activity of the cytosolic form of the enzyme. The present data support an increase in the activity of PEPCK-C in early lactation. These data do not reflect the magnitude of the relationship for activities of PEPCK-C and PEPCK-M activity. Estimates of the translation efficiency of mRNA and stability of the PEPCK enzyme in both cellular compartments are necessary to adequately predict the effects of the transition to lactation on their maximum relative activities.

The PEPCK isozymes have been most extensively characterized for the domesticated chicken (Gallus gallus) (33). The amino acid sequence deduced from corresponding cDNA sequence is 80% identical for the chicken isozymes, whereas comparison of their nucleotide sequences is 60% similar, but the untranslated regions of the two mRNA lack similarity. In chicken, the mitochondrial form contains ~1,700 nt of 3' untranslated sequence, whereas the 3' region of the cytosolic form contains 500 nt. Northern blot analysis detects 4.2- and 3.4-kb bands for PEPCK-M in chicken that are easily distinguishable from the 2.8-kb PEPCK-C mRNA. The 4.2- and 3.4-kb PEPCK-M mRNA vary among birds and appear to be the transcription products of polymorphic alleles (29). A single transcript was revealed for bovine PEPCK-M. Northern blot analysis of human liver mRNA reveals the human PEPCK-M to be 2.25 kb and PEPCK-C to be 2.75 kb. Bovine PEPCK mRNA transcripts, determined by Northern blot analysis, were ~2.35 ± 0.02 and 2.85 ± 0.07 kb (mean and SD; n = 9 samples) for PEPCK-M and PEPCK-C, respectively. These data and the sequence data for PEPCK-C would suggest the addition of a poly-A tail of ~200–300 nt. Southern blotting confirms that PEPCK-M and PEPCK-C are products of separate genes.

Although PEPCK-M is usually considered as unregulated and constitutive (17), there is limited evidence to suggest that the activity of PEPCK-M in rabbit liver is specifically reduced with fasting and accompanies a ninefold increase in PEPCK-C activity (22). In ruminants the activity of soluble (cytosolic) and precipitable (mitochondrial) forms of PEPCK lack appreciable responsiveness to dietary and hormonal stimuli (8, 12, 31). Limited data with respect to structural changes in bovine liver that accompany the progression of lactation suggest a decrease in mitochondrial number per cell that is not accompanied by an increase in mitochondrial size (27). Disproportionate changes in the activity of mitochondrial enzymes with altered mitochondrial volume have been noted (9); therefore, it is possible that the activity of PEPCK-M could be maintained during the transition to lactation despite decreased mitochondrial volume. The activities of PEPCK-M and PEPCK-C in guinea pig mammary tissue, per gram of tissue, increased 43- and 10-fold, respectively, by 5–8 days of lactation, whereas mammary tissue weight increased only 4-fold (19). Although these data point to the potential for specific changes in PEPCK-M, their cause is undetermined. The present data suggest that the capacity for PEPCK-M activity in bovine is not compromised due to a decrease in the abundance of its corresponding mRNA.

The stoichiometry of gluconeogenesis dictates that formation of phosphoenolpyruvate from propionate, pyruvate, and some amino acids requires the independent synthesis of NADH in the cytosol for the subsequent reduction of 1,3-diphosphoglycerate in gluconeogenesis. It has been proposed that PEPCK-C is required for gluconeogenesis from amino acids, and PEPCK-M is more suited to gluconeogenesis from lactate (32). Pyruvate and amino acids are metabolized to oxaloacetate in mitochondria and are shuttled to the cytosol as malate, from which NADH and oxaloacetate are regenerated followed by phosphoenolpyruvate (PEP) formation that is catalyzed by PEPCK-C. Lactate can also be metabolized to PEP in mitochondria of species that possess appreciable PEPCK-M activity (18). Increasing the use of amino acids and propionate for gluconeogenesis may depend on adequate activity of PEPCK-C and independent generation of cytosolic NADH. Reduction in feed intake during the transition to lactation reduces rumen production of propionate, a major gluconeogenic substrate. Lactate recycling to glucose, although critical for supplying glucose for extrahepatic tissues, provides little net increase in glucose entry, whereas amino acids from intestinal absorption and endogenous protein degradation may serve to increase whole body glucose economy. Increasing the supply of glucose carbon by increasing the postruminal supply of amino acids has been suggested as an avenue increasing glucose entry for the periparturient dairy cow (6). The lack of increase in PEPCK-C during the periparturient period in dairy cows coupled with increased gluconeogenesis from alanine and propionate during the immediate postpartum interval (25) suggests that cytosolic NADH and total PEPCK activity do not limit gluconeogenesis from amino acids during this period. The fact that gluconeogenesis from propionate is partially reduced by ~40% in the presence of quinolinate, an inhibitor of PEPCK-C, suggests that PEPCK-C is required for maximal glucose synthesis (1). As lactation progresses and the demand for glucose to support lactose synthesis and mammary metabolism increases, a concomitant increase in PEPCK-C expression may be necessary to accommodate increased hepatic propionate supply as a consequence of increased feed intake.


    ACKNOWLEDGMENTS
 
This work was supported in part by funds from the Indiana Agricultural Research Programs (paper no. 16,381) as part of North Central Regional Research Committee NC-185.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: S. S. Donkin, Dept. of Animal Sciences, 1151 Lilly Hall, Purdue Univ., West Lafayette, IN 47907 (E-mail: sdonkin{at}purdue.edu).

10.1152/physiolgenomics.00108.2001.


    References
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 References
 

  1. Aiello RJ and Armentano LE. Gluconeogenesis in goat hepatocytes is affected by calcium, ammonia and other key metabolites but not primarily through cytosolic redox state. Comp Biochem Physiol B Biochem Mol Biol 88: 193–201, 1987.[Medline]
  2. Altschul SF, Gish W, Miller W, Myers EW, and Lipman DJ. Basic local alignment search tool. J Mol Biol 215: 403–410, 1990.[Web of Science][Medline]
  3. Appel RD, Bairoch A, and Hochstrasser DF. A new generation of information retrieval tools for biologists: the example of the ExPASy WWW server. Trends Biochem Sci 19: 258–260, 1994.[Web of Science][Medline]
  4. Atkin BM, Utter MF, and Weinberg MB. Pyruvate carboxylase and phosphoenolpyruvate carboxykinase activity in leukocytes and fibroblasts from a patient with pyruvate carboxylase deficiency. Pediatr Res 13: 38–43, 1979.[Web of Science][Medline]
  5. Ballard FJ and Hanson RW. Phosphoenolpyruvate carboxykinase and pyruvate carboxylase in developing rat liver. Biochem J 104: 866–871, 1969.
  6. Bell AW. Regulation of organic nutrient metabolism during transition from late pregnancy to early lactation. J Anim Sci 73: 2804–2819, 1995.[Abstract]
  7. Bell AW, Burhans WS, and Overton TR. Protein nutrition in late pregnancy, maternal protein reserves and lactation performance in dairy cows. Proc Nutr Soc 59: 119–126, 2000.[Web of Science][Medline]
  8. Butler TM and Elliot JM. Effect of diet and glucocorticoid administration of liver phosphoenolpyruvate carboxykinase activity in the dairy cow. J Dairy Sci 53: 1727–1733, 1970.[Abstract/Free Full Text]
  9. Cascarano J, Chambers PA, Schwartz E, Poorkaj P, and Gondo RE. Organellar clusters formed by mitochondrial-rough endoplasmic reticulum associations: an ordered arrangement of mitochondria in hepatocytes. Hepatology 22: 837–846, 1995.[Medline]
  10. Chomczynski PN and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–167, 1987.[Web of Science][Medline]
  11. Donkin SS, McNall AD, Swencki BS, Peters JL, and Etherton TD. The growth hormone dependent decrease in hepatic fatty acid synthase mRNA is the result of a decrease in gene transcription. J Mol Endocrinol 16: 151–158, 1996.[Abstract/Free Full Text]
  12. Filsell OH, Jarrett IG, Taylor PH, and. Keech DB. Effects of fasting, diabetes and glucocorticoids on gluconeogenic enzymes in the sheep. Biochim Biophys Acta 184: 54–63, 1969.[Medline]
  13. Garber A, Ballard FJ, and Hanson RW. The significance of mitochondrial phosphoenolpyruvate formation in the regulation of gluconeogenesis in guinea pig liver. In: Metabolism and the Regulation of Metabolic Processes in Mitochondria, edited by Mehlman MA and Hanson RW. New York: Academic, 1972, p. 109–135.
  14. Greenfield RB, Cecava MJ, and Donkin SS. Changes in mRNA expression of gluconeogenic enzymes in liver of dairy cattle during the transition to lactation. J Dairy Sci 83: 1228–1236, 2000.[Abstract]
  15. Hanson RW and Reshef L. Regulation of phosphoenolpyruvate carboxykinase (GTP) gene expression. Annu Rev Nutr 66: 581, 1997.
  16. Hartwell JR, Cecava MJ, and Donkin SS. Impact of rumen undegradable protein and rumen-protected choline on mRNA expression for enzymes in gluconeogenesis and ureagenesis in liver of periparturient dairy cows. J Dairy Sci 84: 490–497, 2000.
  17. Hod Y, Cook JS, Weldon SL, Short JM, Wynshaw-Boris A, and Hanson RW. Differential expression of the genes for the mitochondrial and cytosolic forms of phosphoenolpyruvate carboxykinase. Ann NY Acad Sci 478: 31–45, 1987.
  18. Holcomb T, Curthoys NP, and Gstraunthaler G. Subcellular localization of PEPCK and metabolism of gluconeogenic substrains of renal cell lines. Am J Physiol Cell Physiol 268: C449–C457, 1995.[Abstract/Free Full Text]
  19. Jones DH, Raymer DM, and Schoelen SL. The activity of phosphoenolpyruvate carboxykinase throughout the lactation cycle of the guinea pig mammary gland. Proc Soc Exp Biol Med 192: 16–22, 1989.[Medline]
  20. Lemaigre FP and Rousseau GG. Transcriptional control of genes that regulate glycolysis and gluconeogenesis in adult liver. Biochem J 303: 1–14, 1994.[Medline]
  21. Modaressi S, Christ B, Bratke J, Zahn S, Heise T, and Jungermann K. Molecular cloning, sequencing and expression of the cDNA of the mitochondrial form of phosphoenolpyruvate carboxykinase from human liver. Biochem J 315: 807–814, 1996.[Web of Science][Medline]
  22. Monteil C, Fillastre JP, and Morin JP. Expression and subcellular distribution of phosphoenolpyruvate carboxykinase in primary cultures of rabbit kidney proximal tubule cells: comparative study with renal and hepatic PEPCK in vivo. Biochim Biophys Acta 1243: 437–445, 1995.[Medline]
  23. Narkewicz MR, Carver TD, and Hay WW Jr. Induction of cytosolic phosphoenolpyruvate carboxykinase in the ovine fetal liver by chronic fetal hypoglycemia and hypoinsulinemia. Pediatr Res 33: 493–496, 1993.[Web of Science][Medline]
  24. O’Brien RM and Granner DK. PEPCK gene as model of inhibitory effects of insulin on gene transcription. Diabetes Care 13: 327–339, 1990.[Abstract]
  25. Overton TR, Drackley JK, Douglas GN, Emmert LS, and Clark JH. Hepatic gluconeogenesis and whole-body protein metabolism of periparturient dairy cows as affected by source of energy and intake of the prepartum diet. J Dairy Sci 81: 295, 1998.
  26. Person WR, Wood T, Zhang Z, and Miller W. Comparison of DNA sequences with protein sequences. Genomics 46: 24–36, 1997.[Web of Science][Medline]
  27. Reid IM, Harrison RD, and Collins RA. Fasting and refeeding in the lactating dairy cow. 2. The recovery of liver cell structure and function following a six-day fast. J Comp Pathol 87: 253–265, 1977.[Medline]
  28. SAS Users Guide: Statistics (release 6.03 edition). Cary, NC: SAS Institute, 1988.
  29. Savon S, Hakimi P, and Hanson RW. Expression of the genes for the mitochondrial and cytosolic forms of phosphoenolpyruvate carboxykinase in avian liver during development. Biol Neonate 64: 62–68, 1993.[Medline]
  30. She P, Lindberg GL, Hippen AR, Beitz DC, and Young JW. Regulation of messenger ribonucleic acid expression for gluconeogenic enzymes during glucagon infusions into lactating cows. J Dairy Sci 82: 1153–1163, 1999.[Abstract]
  31. Taylor PH, Wallace JC, and Keech DB. Gluconeogenic enzymes in sheep. Biochim Biophys Acta 237: 179, 1971.[Medline]
  32. Watford M, Hod Y, Chiao YB, Utter MF, and Hanson RW. The unique role of the kidney in gluconeogenesis in the chicken. The significance of a cytosolic form of phosphoenolpyruvate carboxykinase. J Biol Chem 256: 10023–10027, 1981.[Free Full Text]
  33. Weldon SL, Rando A, Matathias AS, Hod Y, Kalonick PA, Savon S, Cook JS, and Hanson RW. Mitochondrial phosphoenolpyruvate carboxykinase from the chicken. Comparison of the cDNA and protein sequences with the cytosolic isozyme. J Biol Chem 265: 7308–7317, 1990.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J ANIM SCIHome page
R. F. Cooke, J. D. Arthington, D. B. Araujo, G. C. Lamb, and A. D. Ealy
Effects of supplementation frequency on performance, reproductive, and metabolic responses of Brahman-crossbred females
J Anim Sci, September 1, 2008; 86(9): 2296 - 2309.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
S. Haga, S. Fujimoto, T. Yonezawa, K. Yoshioka, H. Shingu, Y. Kobayashi, T. Takahashi, Y. Otani, K. Katoh, and Y. Obara
Changes in Hepatic Key Enzymes of Dairy Calves in Early Weaning Production Systems
J Dairy Sci, August 1, 2008; 91(8): 3156 - 3164.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
E. L. Karcher, M. M. Pickett, G. A. Varga, and S. S. Donkin
Effect of dietary carbohydrate and monensin on expression of gluconeogenic enzymes in liver of transition dairy cows
J Anim Sci, March 1, 2007; 85(3): 690 - 699.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
G. Ferreira and W. P. Weiss
Effect of Biotin on Activity and Gene Expression of Biotin-Dependent Carboxylases in the Liver of Dairy Cows
J Dairy Sci, March 1, 2007; 90(3): 1460 - 1466.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
J. K. Drackley, S. S. Donkin, and C. K. Reynolds
Major advances in fundamental dairy cattle nutrition.
J Dairy Sci, April 1, 2006; 89(4): 1324 - 1336.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
E. L. Williams, S. M. Rodriguez, D. C. Beitz, and S. S. Donkin
Effects of Short-Term Glucagon Administration on Gluconeogenic Enzymes in the Liver of Midlactation Dairy Cows
J Dairy Sci, February 1, 2006; 89(2): 693 - 703.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J. J. Loor, H. M. Dann, R. E. Everts, R. Oliveira, C. A. Green, N. A. J. Guretzky, S. L. Rodriguez-Zas, H. A. Lewin, and J. K. Drackley
Temporal gene expression profiling of liver from periparturient dairy cows reveals complex adaptive mechanisms in hepatic function
Physiol Genomics, October 17, 2005; 23(2): 217 - 226.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
B. J. Bradford and M. S. Allen
Phlorizin Administration Increases Hepatic Gluconeogenic Enzyme mRNA Abundance but Not Feed Intake in Late-Lactation Dairy Cows
J. Nutr., September 1, 2005; 135(9): 2206 - 2211.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
J. C. Velez and S. S. Donkin
Feed Restriction Induces Pyruvate Carboxylase but not Phosphoenolpyruvate Carboxykinase in Dairy Cows
J Dairy Sci, August 1, 2005; 88(8): 2938 - 2948.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
H. M. Hammon, C. Philipona, Y. Zbinden, J. W. Blum, and S. S. Donkin
Effects of Dexamethasone and Growth Hormone Treatment on Hepatic Gluconeogenic Enzymes in Calves
J Dairy Sci, June 1, 2005; 88(6): 2107 - 2116.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
J. C. Velez and S. S. Donkin
Bovine Somatotropin Increases Hepatic Phosphoenolpyruvate Carboxykinase mRNA in Lactating Dairy Cows
J Dairy Sci, May 1, 2004; 87(5): 1325 - 1335.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
H. M. Hammon, S. N. Sauter, M. Reist, Y. Zbinden, C. Philipona, C. Morel, and J. W. Blum
Dexamethasone and colostrum feeding affect hepatic gluconeogenic enzymes differently in neonatal calves
J Anim Sci, December 1, 2003; 81(12): 3095 - 3106.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
11/2/53    most recent
00108.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Agca, C.
Right arrow Articles by Donkin, S. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Agca, C.
Right arrow Articles by Donkin, S. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online